2014 manchester-reproducibility
-
Upload
ctitusbrown -
Category
Data & Analytics
-
view
1.165 -
download
1
description
Transcript of 2014 manchester-reproducibility
Six ways to Sunday: approaches to computational
reproducibility in non-model system sequence
analysis.
C. Titus [email protected] 21, 2014
Hello!Assistant Professor; Microbiology; Computer
Science; etc.
More information at:
• ged.msu.edu/• github.com/ged-lab/• ivory.idyll.org/blog/• @ctitusbrown
The challenges of non-model sequencing
• Missing or low quality genome reference.
• Evolutionarily distant.
• Most extant computational tools focus on model organisms –o Assume low polymorphism (internal variation)o Assume reference genomeo Assume somewhat reliable functional annotationo More significant compute infrastructure
…and cannot easily or directly be used on critters of interest.
Shotgun sequencing & assembly
http://eofdreams.com/library.html;http://www.theshreddingservices.com/2011/11/paper-shredding-services-small-business/;http://schoolworkhelper.net/charles-dickens%E2%80%99-tale-of-two-cities-summary-analysis/
Shotgun sequencing analysis goals:
• Assembly (what is the text?)o Produces new genomes & transcriptomes.o Gene discovery for enzymes, drug targets, etc.
• Counting (how many copies of each book?)o Measure gene expression levels, protein-DNA
interactions• Variant calling (how does each edition
vary?)o Discover genetic variation: genotyping, linkage
studies…o Allele-specific expression analysis.
AssemblyIt was the best of times, it was the wor, it was the worst of times, it was the isdom, it was the age of foolishness
mes, it was the age of wisdom, it was th
It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of
foolishness
…but for lots and lots of fragments!
Shared low-level fragments may
not reach the threshold for
assembly.
Lamprey mRNAseq:
Pooling all your data is important
Introducing k-mers
CCGATTGCACTGGACCGA (<- read)
CCGATTGCAC CGATTGCACT GATTGCACTG ATTGCACTGG TTGCACTGGA TGCACTGGAC GCACTGGACC ACTGGACCGA
K-mers give you an implicit alignment
CCGATTGCACTGGACCGATGCACGGTACCGTATAGCCCATGGACCGATTGCACTGGACCGATGCACGGTACCG
K-mers give you an implicit alignment
CCGATTGCACTGGACCGATGCACGGTACCGTATAGCCCATGGACCGATTGCACTGGACCGATGCACGGTACCGCATGGACCGATTGCACTGGACCGATGCACGGACCG
(with no accounting for mismatches or indels)
De Bruijn graphs – assemble on overlaps
J.R. Miller et al. / Genomics (2010)
The problem with k-mers
CCGATTGCACTGGACCGATGCACGGTACCGTATAGCCCATGGACCGATTGCACTCGACCGATGCACGGTACCG
Each sequencing error results in k novel k-mers!
Conway T C , Bromage A J Bioinformatics 2011;27:479-486
© The Author 2011. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]
Assembly graphs scale with data size, not
information.
Practical memory measurements (soil)
Velvet measurements (Adina Howe)
Data set size and cost• $1000 gets you ~100m “reads”, or about 10-40
GB of data, in ~week.
• > 1000 labs doing this regularly.
• Each data set analysis is ~custom.
• Analyses are data intensive and memory intensive.
Efficient data structures & algorithms
Shotgun sequencing is massively
redundant; can we eliminate redundancy
while retaining information?
Analog: JPEG lossy compression
Sparse collections of k-mers can be stored efficiently in
Bloom filters
Pell et al., 2012, PNAS; doi: 10.1073/pnas.1121464109
Data structures & algorithms papers
• “These are not the k-mers you are looking for…”, Zhang et al., arXiv 1309.2975, in review.
• “Scaling metagenome sequence assembly with probabilistic de Bruijn graphs”, Pell et al., PNAS 2012.
• “A Reference-Free Algorithm for Computational Normalization of Shotgun Sequencing Data”, Brown et al., arXiv 1203.4802, under revision.
Data analysis papers• “Tackling soil diversity with the assembly of large,
complex metagenomes”, Howe et al., PNAS, 2014.
• Assembling novel ascidian genomes & transcriptomes, Lowe et al., in prep.
• A de novo lamprey transcriptome from large scale multi-tissue mRNAseq, Scott et al., in prep.
Lab approach – not intentional, but working
out.
This leads to good things.
(khmer software)
Cu
rren
t re
searc
h(khmer software)
Testing & version control – the not so
secret sauce• High test coverage - grown over time.
• Stupidity driven testing – we write tests for bugs after we find them and before we fix them.
• Pull requests & continuous integration – does your proposed merge break tests?
• Pull requests & code review – does new code meet our minimal coding etc requirements?o Note: spellchecking!!!
On the “novel research” side:
• Novel data structures and algorithms;• Permit low(er) memory data analysis;• Liberate analyses from specialized hardware.
Running entirely w/in cloud
Complete data; AWS m1.xlarge
~40 hours
(See PyCon 2014 talk; video and blog post.)
MEMORY
On the “novel research” side:
• Novel data structures and algorithms;• Permit low(er) memory data analysis;• Liberate analyses from specialized hardware.
This last bit? => reproducibility.
Reproducibility!
Scientific progress relies on
reproducibility of analysis. (Aristotle,
Nature, 322 BCE.)
“There is no such thing as ‘reproducible science’. There is only ‘science’, and ‘not
science.’” – someone on Twitter (Fernando Perez?)
Disclaimer
Not a researcher of reproducibility!
Merely a practitioner.
Please take my points below as an argument and not as research conclusions.
(But I’m right.)
My usual intro:We practice open science!
Everything discussed here:• Code: github.com/ged-lab/ ; BSD license• Blog: http://ivory.idyll.org/blog (‘titus brown blog’)• Twitter: @ctitusbrown• Grants on Lab Web site:
http://ged.msu.edu/research.html• Preprints available.
Everything is > 80% reproducible.
My usual intro:We practice open science!
Everything discussed here:• Code: github.com/ged-lab/ ; BSD license• Blog: http://ivory.idyll.org/blog (‘titus brown blog’)• Twitter: @ctitusbrown• Grants on Lab Web site:
http://ged.msu.edu/research.html• Preprints available.
Everything is > 80% reproducible.
My lab & the diginorm paper.
• All our code was already on github;• Much of our data analysis was already in the
cloud;• Our figures were already made in IPython
Notebook• Our paper was already in LaTeX
IPython Notebook: data + code =>
My lab & the diginorm paper.
• All our code was already on github;• Much of our data analysis was already in the
cloud;• Our figures were already made in IPython
Notebook• Our paper was already in LaTeX
…why not push a bit more and make it easily reproducible?
This involved writing a tutorial. And that’s it.
To reproduce our paper:
git clone <khmer> && python setup.py installgit clone <pipeline>cd pipelinewget <data> && tar xzf <data>make && cd ../notebook && makecd ../ && make
Now standard in lab --All our papers now have:
• Source hosted on github;• Data hosted there or on
AWS;• Long running data
analysis => ‘make’• Graphing and data
digestion => IPython Notebook (also in github)
Qingpeng Zhang
Research process
Literate graphing & interactive exploration
The process• We start with pipeline reproducibility• Baked into lab culture; default “use git; write
scripts”
Community of practice!
• Use standard open source approaches, so OSS developers learn it easily.
• Enables easy collaboration w/in lab• Valuable learning tool!
Growing & refining the process
• Now moving to Ubuntu Long-Term Support + install instructions.
• Everything is as automated as is convenient.
• Students expected to communicate with me in IPython Notebooks.
• Trying to avoid building (or even using) new tools.
• Avoid maintenance burden as much as possible.
1. Use standard OS; provide install instructions
• Providing install, execute for Ubuntu Long-Term Support release 14.04: supported through 2017 and beyond.
• Avoid pre-configured virtual machines!o Locks you into specific cloud homes.o Challenges remixability and extensibility.
2. Automate• Literate graphing now easy with knitr and IPython
Notebook.
• Build automation with make, or whatever. To first order, it does not matter what tools you use.
• Explicit is better than implicit. Make it easy to understand what you’re doing and how to extend it.
Myths of reproducible research
(Opinions from personal experience.)
Myth 1: Partial reproducibility is hard.
“Here’s my script.” => Methods
More generally,• Many scientists cannot replicate any part of their
analysis without a lot of manual work.• Automating this is a win for reasons that have
nothing to do with reproducibility… efficiency!
See: Software Carpentry.
Myth 2: Incomplete reproducibility is
uselessParaphrase: “We can’t possibly reproduce the
experimental data exactly, so we shouldn’t bother with anything else, either.”
(Analogous arg re software testing & code coverage.)
• …I really have a hard time arguing the paraphrase honestly…
• Being able to reanalyze your raw data? Interesting.• Knowing how you made your figures? Really useful.
Myth 3: We need new platforms
• Techies always want to build something (which is fun!) but don’t want to do science (which is hard!)
• We probably do need new platforms, but stop thinking that building them does a service.
• Platforms need to be use driven. Seriously.
• If you write good software for scientific inquiry and make it easy to use reproducibly, that will drive virtuousity.
Myth 4. Virtual Machine reproducibility is an end
solution.
• Good start! Better than nothing!
But:• Limits understanding & reuse.• Limits remixing: often cannot install other
software!
• “Chinese Room” argument: could be just a lookup table.
Myth 5: We can use GUIs for reproducible
research(OK, this is partly just to make people think ;)
• Almost all data analysis takes place within a larger pipeline; the GUI must consume entire pipeline in order to be reproducible.
• IFF GUI wraps command line, that’s a decent compromise (e.g. Galaxy) but handicaps researchers using novel approaches.
• By the time it’s in a GUI, it’s no longer research.
Our current efforts?• Semantic versioning of our own code: stable
command-line interface.
• Writing easy-to-teach tutorials and protocols for common analysis pipelines.
• Automate ‘em for testing purposes.
• Encourage their use, inclusion, and adaptation by others.
khmer-protocols
khmer-protocols:• Provide standard “cheap”
assembly protocols for the cloud.
• Entirely copy/paste; ~2-6 days from raw reads to assembly, annotations, and differential expression analysis. ~$150 per data set (on Amazon rental computers)
• Open, versioned, forkable, citable….
Literate testing• Our shell-command tutorials for bioinformatics
can now be executed in an automated fashion – commands are extracted automatically into shell scripts.
• See: github.com/ged-lab/literate-resting/.
• Tremendously improves peace of mind and confidence moving forward!
Leigh Sheneman
Doing things right=> #awesomesauce
Concluding thoughts• We are not doing anything particularly neat on
the computational side... No “magic sauce.”
• Much of our effort is now driven by sheer utility:o Automation reduces our maintenance burden.o Extensibility makes revisions much easier!o Explicit instructions are good for training.
• Some effort needed at the beginning, but once practices are established, “virtuous cycle” takes over.
What bits should people adopt?
• Version control!
• Literate graphing!
• Automated “build” from data => results!
• Make available data as early in your pipeline as possible.
More concluding thoughts
• Nobody would care that we were doing things reproducibly if our science wasn’t decent.
• Make sure students realize that faffing about on infrastructure isn’t science.
• Research is about doing science. Reproducibility (like other good practices) is much easier to proselytize if you can link it to progress in science.
Biology & sequence analysis is in a perfect place for
reproducibility
We are lucky! A good opportunity!
• Big Data: laptops are too small;• Excel doesn’t scale any more;• Few tools in use; most of them are $$ or UNIX;• Little in the way of entrenched research practice;
Thanks!
Talk is on slideshare: slideshare.net/c.titus.brown
E-mail or tweet me:[email protected]@ctitusbrown