2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.
-
Upload
christine-andrews -
Category
Documents
-
view
215 -
download
0
Transcript of 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.
![Page 1: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/1.jpg)
2014-10-30
Seong-Eui Hong
![Page 2: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/2.jpg)
Background
1987 2002 2005 2007
2012 2013
![Page 3: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/3.jpg)
Identification of palindromic and repetitive se-quence
![Page 4: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/4.jpg)
Study on the repetitive DNA sequence
![Page 5: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/5.jpg)
Suggestion of the role in cell immunity
![Page 6: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/6.jpg)
Experimental confirmation of adaptive immunity
![Page 7: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/7.jpg)
Mechanisms of CRISPR in adaptive immunity
Figure from http://www.biochem.or.kr/ksbmb_webzine
tracrRNA: trans-acting crRNA
![Page 8: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/8.jpg)
Genome editing using CRISPR
![Page 9: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/9.jpg)
Introduction
• Aim: Generation of cancer model using CRISPR in mice
• Target gene: 1) Pten2) p533) beta-catenin
![Page 10: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/10.jpg)
Generation of Pten mutations in adult animals using CRISPR
• Pten: negative regulator of PI3K/Akt
Step1: cloning of pX330 vector co-expressing an sgRNA targeting Pten (sgPten) and Cas9
Step2: in vitro mutation in mouse 3T3 cell using sgPtenStep3: in vivo delivery of luciferase plasmid DNA using
hydrodynamic tail-vein injection, which can deliver DNA to 20% of hepatocytes
Step4: in vivo delivery sgPten and sgGFP in FVB mice dur-ing 2 weeks
![Page 11: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/11.jpg)
Result: delivery of sgPten
• 3.36% hepatocytes with (-) Pten staining• 0.4% hepatocytes with intermediate Pten staining
(=heterozygous mutation)
• Elevated staining of pAkt in sgPten mice• Oil red O staining indicates lipid accumulation in sg-
Pten mice, which is a known phenotype in Pten muta-tion in liver
• Conclusion: in vivo CRISPR-mediated genome editing was able to
generate Pten (-) cells in the liver, mimicking liver-spe-cific conditional deletion of Pten in mice
![Page 12: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/12.jpg)
Question: Loss of Pten is due to CRISPR-me-diated mutation?
Method: Deep sequencing• 2.66% of the reads had indels
in Pten locus• 0.56% indels in sgGFP• Most of variants were pre-
dicted to cause frameshift mutations
• 1~2bp indels cause the dis-ruption of the Pten reading frame
• These indels were at the predicted sgPten induced Cas9 cutting site
• Whereas the indels in sg-GFP distributes randomly
• Pten loss (scored by IHC) strongly correlated with the Pten indels
Conclusion: These data indicate that for most cells, ex-pression of the sgPten vector results in muta-tion of Pten
![Page 13: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/13.jpg)
Question: long-term phenotype following sgPten treatment?
• Method:
Analysis the livers from 3 sgPten-treated mice at 4 months
• Lipid accumulation• Pten loss• Elevated pAkt• No induction of p53 despite the activation of pAkt• No tumor up to 4 months
![Page 14: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/14.jpg)
Question: off-target?
• Recent studies identified that Cas9 can tolerate mismatches between sgRNA and genomic DNA depending on the sgRNA sequence and the position of the mismatches
• Question: potential off-target effects of sgPten in the liver?
• Method:
1) Prediction of sgPten off-target sites using a published prediction tool
2) Amplification of the Pten locus and the top four potential off-target sites us-ing Surveyor assay Result:
There were no Surveyor nuclease cut-ting, indicating that the frequency ofoff-target editing is below the limit of detection of this assay
![Page 15: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/15.jpg)
Test of a nickase version of Cas9
• Cas9 generates double strand breaks
• Cas9(D10A) makes single-strand DNA (ssDNA) breaks and was re-ported to have further reduced levels of off-target effects
![Page 16: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/16.jpg)
Test of a nickase version of Cas9
• By deep sequencing, 2.76% indels at the Pten locus compared to 0.26% in sgGFP-treated mice were observed
• Pten (-) cells were observed
![Page 17: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/17.jpg)
Generation of p53 mutations in adult an-imals using CRISPR
• 6.061% of indels in p53 was observed• No tumor up to 3 months
![Page 18: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/18.jpg)
Co-injected sgPten and sgp53• 4.06% for Pten and 6.46% for p53• At 3 months post-injection, all 5 mice developed
liver tumors with bile duct differentiation fea-tures
• Tumors were positive for cytokeratin 19, a marker of bilinear lineage cells
• bi-allelic mutations of both genes
Tumor ID Gene Sequences (indels=red)
T2 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAAC-AAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAA--AAAGG
p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCT--GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGACGCCAGG
T3 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG
p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTG-GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG
T4 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAAC-AAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG
p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTG-GCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG
T5 Pten ATGACAGCCATCATCAAAGAGATCGTTAGCAG-AACAAAAGGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACCAAAAGG
p53 ATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGGATGACTGCCATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAAGCCAGG
![Page 19: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/19.jpg)
Question: Can CRISPR be used to directly in-troduce gain of-function mutations?
• Target: Ctnnb1 gene, which encodes b-catenin, a transcription factor in the Wnt signalling pathway that is frequently mutated in liver cancer
• Phosphorylation at four ser/thr results in the degradation of Ctnnb1
• Method: co-injection of two pX330 plasmids carrying i) sgRNA targeting Ctnnb1 and ii) 200 nt ssDNA oligonucleotide containing four point mu-tation
• in five mice injected with sgbcatenin and ssDNA, 0.5% of hepatocytes ex-hibited nuclear b-catenin
• Accumulation of b-catenin was asso-ciated with increased levels of glu-tamine synthetase, a b-catenin target gene
![Page 20: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/20.jpg)
Targeting of b-catenin
• Reduced level of p-b-catenin• Nuclear accumulation of b-catenin
As a result of deep sequencing, small but de-tectablepercentage of sequencing reads contained the four ‘G’ point mutations present in the ssDNA
Conclusion:These data demonstrate that CRISPR system can be used to directly induce gain-of-function mutation or other substitutions via homolo-gous recombination in vivo
![Page 21: 2014-10-30 Seong-Eui Hong. Background 1987 2002 2005 2007 2012 2013.](https://reader034.fdocuments.net/reader034/viewer/2022051416/56649ead5503460f94bb4ba5/html5/thumbnails/21.jpg)
Conclusion
• The authors illustrate the potential to directly disrupt tumor suppressor genes and generate point mutations in oncogenes in adult mouse liver using the CRISPR/Cas system
• This approach generated compound Pten and p53 indels at low fre-quency but was sufficient to induce multifocal tumors
• More efficient delivery techniques, such as adenovirus or adeno-as-sociated virus, more potent sgRNAs, and longer homologous re-combination templates might also improve the overall efficiency of this method and expand the range of tissue that could be targeted
• Consistent with recent studies showing that long-term Cas9/sgRNA ex-pression is not toxic in cells