· 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5,...

8

Transcript of  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5,...

Page 1:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 2:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 3:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 4:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 5:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 6:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 7:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense
Page 8:  · 2013. 8. 23. · Also, 5 bp (TTCTC) and 3 bp (TCT) intromc indels in intron 3 and Intron 5, respectively, were identified. Out of 23 exomc polymorphisms, 15 SNPs are the nussense

Intron LTE

Intron LTE

Intron ‘‘sliding’’ and the diversity of intron positions · 10739. and downstream splice junctions (13, 29). The mechanism in Fig. 1B invokes balanced indels (26, 28). Martinez

Intron ‘‘sliding’’ and the diversity of intron positions · 10739. and downstream splice junctions (13, 29). The mechanism in Fig. 1B invokes balanced indels (26, 28). Martinez

Genetic Diseases3.1 x 109 bp In Mitochondria 16,569 bp Gene Coding Sequences (Exon) Non coding Sequences (Intron) Non-gene (Extragenetic) Repetitive DNA Tandem repeats (satellite,

Genetic Diseases3.1 x 109 bp In Mitochondria 16,569 bp Gene Coding Sequences (Exon) Non coding Sequences (Intron) Non-gene (Extragenetic) Repetitive DNA Tandem repeats (satellite,

REVIEW Open Access Origin and evolution of spliceosomal ......Keywords: Intron sliding, Intron gain, Intron loss, Spliceosome, Splicing signals, Evolution of exon/intron structure,

REVIEW Open Access Origin and evolution of spliceosomal ......Keywords: Intron sliding, Intron gain, Intron loss, Spliceosome, Splicing signals, Evolution of exon/intron structure,

The enduring mystery of intron-mediated enhancement · intron mediated enhancement and intron dependent spatial expres-sion, Transgenic Res. 18 (2009) 151–162. A.B. Rose, R.L. Last,

The enduring mystery of intron-mediated enhancement · intron mediated enhancement and intron dependent spatial expres-sion, Transgenic Res. 18 (2009) 151–162. A.B. Rose, R.L. Last,

Weighting indels as phylogenetic markers of 18S rDNA ... · Weighting indels as phylogenetic markers of 18S rDNA sequences in Diptera and Strepsiptera Lars Vogt* Systematik und Evolution

Weighting indels as phylogenetic markers of 18S rDNA ... · Weighting indels as phylogenetic markers of 18S rDNA sequences in Diptera and Strepsiptera Lars Vogt* Systematik und Evolution

INTRON TECHNOLOGY HOLDINGS LIMITED

INTRON TECHNOLOGY HOLDINGS LIMITED

MPG Workshop / February 17, 2011 QPipeline: variant ...€¦ · Call indels! Filter indels! Call SNPs! Filter SNPs! Combine into a single VCF! Functionally annotate! (missense, nonsense,

MPG Workshop / February 17, 2011 QPipeline: variant ...€¦ · Call indels! Filter indels! Call SNPs! Filter SNPs! Combine into a single VCF! Functionally annotate! (missense, nonsense,

BMC Genomics BioMed Central - Visual Data Analysis Lab et al. - 2009 - Genomic... · generally of ~50 bp, ii) a single intron of between ~80 and ~500 bp and iii) a variable (V) exon

BMC Genomics BioMed Central - Visual Data Analysis Lab et al. - 2009 - Genomic... · generally of ~50 bp, ii) a single intron of between ~80 and ~500 bp and iii) a variable (V) exon

Group I & II intron

Group I & II intron

Fungal Genome Size and Intron Evolution

Fungal Genome Size and Intron Evolution

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

CYP2D6 Variation v1 - PharmVarintron 1, exon 2, intron 2-exon 3, intron 4, exon 5, exon 7-intron 8, intron 7, exon 9 none Panserat et al. 1995 Gaedigk et al. 2010 Gaedigk et al, 2010

SGS INTRON Bulletin 24

SGS INTRON Bulletin 24

VariantCalling’’ (using’High0throughputSequencing’Data)’ · – Whatkind’of’variaon’occurs?’SNPs,’indels ... Possible’biases’in’sequences ... • Reads’containing’non0genomic’DNA’e.g

VariantCalling’’ (using’High0throughputSequencing’Data)’ · – Whatkind’of’variaon’occurs?’SNPs,’indels ... Possible’biases’in’sequences ... • Reads’containing’non0genomic’DNA’e.g

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.

INTRON-D plus – Bene˜ ts · INTRON-D plus – Networked The INTRON-D plus can be e˚ ectively integrated into many common network environments allowing for data and speech communication

INTRON-D plus – Bene˜ ts · INTRON-D plus – Networked The INTRON-D plus can be e˚ ectively integrated into many common network environments allowing for data and speech communication

Komg, Kiosterstralse 41 Klosterstraße 39 Indels GmbH ... · Komg, Kiosterstralse 41 Klosterstraße 39 Indels GmbH, Klosterstraße 34 Krankenhäger Str. 28 rktplatz sel, Marktptatz

Komg, Kiosterstralse 41 Klosterstraße 39 Indels GmbH ... · Komg, Kiosterstralse 41 Klosterstraße 39 Indels GmbH, Klosterstraße 34 Krankenhäger Str. 28 rktplatz sel, Marktptatz

INTRO INTRO –– REAL REAL--TIME PCRTIME PCR1).pdfthe protein titin contains 234 exons!) THE HUMAN GENOME PROJECT (2) • Avarage intron length = 3,365 bp • Avarage 5’UTR length

INTRO INTRO –– REAL REAL--TIME PCRTIME PCR1).pdfthe protein titin contains 234 exons!) THE HUMAN GENOME PROJECT (2) • Avarage intron length = 3,365 bp • Avarage 5’UTR length

Development of INDELs markers in oilseed rape …download.xuebalib.com/xuebalib.com.38776.pdfDevelopment of INDELs markers in oilseed rape (Brassica napus L.) using re-sequencing data

Development of INDELs markers in oilseed rape …download.xuebalib.com/xuebalib.com.38776.pdfDevelopment of INDELs markers in oilseed rape (Brassica napus L.) using re-sequencing data

Eng Mech Intron

Eng Mech Intron