2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria...
Transcript of 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria...
![Page 1: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/1.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 1/11
Induced resistance in tomato plants to the toxin-dependent necrotrophic
pathogen Alternaria alternata
Mayumi Egusa a, Hajime Akamatsu b,1, Takashi Tsuge c, Hiroshi Otani b, Motoichiro Kodama b,*
a The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japanb Laboratory of Plant Pathology, Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japanc Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa, Nagoya 464-8601, Japan
a r t i c l e i n f o
Article history:
Accepted 3 February 2009
Keywords:
Alternaria alternata
Host-specific toxin
AAL-toxin
Salicylic acid
Jasmonic acid
Induced resistance
Solanum lycopersicum
a b s t r a c t
A necrotrophic pathogen, the tomato pathotype of Alternaria alternata ( Aa) causes Alternaria stem canker
on tomato. Its pathogenicity depends on the production of host-specific AAL-toxin. Pre-inoculation with
nonpathogenic Aa or pretreatment an elicitor prepared from Aa reduced disease symptoms by the
pathogen. Salicylic acid (SA)- and jasmonic acid (JA)-dependent defense responses in tomato are not
involved in the resistance to the pathogen induced by nonpathogenic A a. The results suggest that an
alternative and unknown signaling pathway independent of SA- and JA-signaling might modulate the
induced resistance by activating the expression of the multiple defense genes.
2009 Elsevier Ltd. All rights reserved.
1. Introduction
Plants are exposedto a large numberof microorganisms, most of
which are not able to invade plants because of the preformed
resistance, including cell wall and antimicrobial compounds, and
because of induced resistance, including the elicitor-induced
production of phytoalexin and pathogenesis-related (PR) proteins
[1–4]. There are many reports concerning the resistance conferred
by a specific interaction between the fungal avirulence gene ( Avr )
and the plant resistance gene (R), called gene-for-gene resistance
[1,3,5]. Because gene-for-gene resistance is generally regarded as
race/cultivar specific, this type of resistance is called host resistance
and the products of Avr genes are the specific elicitors [2,3,5]. On
the other hand, the resistance that does not depend on R/ Avr
interaction and is induced in broad range of host plants againstbroad spectrum pathogens has been considered as basal resistance,
general resistance or non-host resistance which is triggered by
non-specific or general elicitors known as microbe-associated
molecular patterns (MAMPs) [1,2,5,6]. Recently, several MAMPs,
including bacterial flagellin (e.g., flg22 highly conserved 22 amino
acids in flagellin [7]), lipopolysaccharide, elongation factor Tu (EF-
Tu [8]), and fungal chitin and b-glucans [9,10] have been well
characterized. MAMPs are constitutively present in microbes and
are essential for viability, for example as main structural compo-
nents of cell walls or membranes, and bacterial motility.
Plant defense responses are activated by the perception of these
elicitors or MAMPs through signal transduction pathways. Salicylic
acid (SA) and jasmonic acid (JA)/ethylene (ET) signaling have been
well demonstrated as playing important roles in both basal and
specific resistance [2,11–13,19]. It is well known that SA signaling is
important for resistance against biotrophic pathogens, whereas JA/
ET signaling is important against necrotrophic pathogens, and that
these signaling pathways interact with each other in a complicated
manner [11–13]. Application of SA and its analogs enhanced
resistance in Arabidopsis or tobacco against Erwinia carotovora,
Peronospora parasitica, Phytophthora parasitica, Pseudomonassyringae pv. maculicola, and tobacco mosaic virus [12–16]. On the
other hand, exogenous JA and methyl jasmonate (MeJA) application
plant induced resistance against Alternaria brassicicola, Botrytis
cinerea and Phytophthora infestans [12,13,17,18]. Furthermore,
expression of SA- or JA-dependent genes was increased infection
with virulent and a virulent pathogens [19].
In addition to this evidence, the isolation of signaling mutants
has helped to elucidate the role of signaling in host defense
responses. Transgenic Arabidopsis plants expressing NahG, which
are unable to accumulate SA and express the SA-dependent PR-
genes [20], npr1/nim1, which have a defect in responding to SA and
* Corresponding author. Tel./fax:þ81 857 31 5364.
E-mail address: [email protected] (M. Kodama).1 Present address: Biological Resources Division, Japan international Research
Center for Agricultural Sciences, 1-1 Ohwashi, Tsukuba, Ibaraki 305-8686 Japan.
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology
j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / p m p p
0885-5765/$ – see front matter 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.pmpp.2009.02.001
Physiological and Molecular Plant Pathology 73 (2009) 67–77
![Page 2: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/2.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 2/11
expressing SA-dependent genes [14,15], and sid2, which fail to
accumulate SA [21], have shown enhanced susceptibility not only
to virulent and a virulent pathogens but also to non-host patho-
gens, including Blumeria graminis, Erysiphe orontii, Peronospora
parasitica, P. syringae pv. maculicola and Uromyces vignae
[12,14,15,21–23]. In contrast, the JA-related tomato mutant def1,
which is defective in the octadecanoid synthesis pathway and in
the systemic wound signaling pathway [24,25], exhibited increased
susceptibility to Fusarium oxysporum f. sp. lycopersici, P. syringae, P.
infestans and Verticillium dahliae [26]. The JA-insensitive Arabi-
dopsis coi1 mutant [27] also showed enhanced susceptibility
against A. brassicicola and B. cinerea [12].
Alternaria alternata (Fries) Keissler ( Aa) is a ubiquitous fungus
that can be found on many kinds of plants and other substrata.
While having a general potential for aggressiveness, most of them
are unable to invade the potential host plants due to basal, general
or non-host resistance [28,29]. However, some of these fungal
pathogens are necrotrophic and produce host-specific toxins (HSTs)
that cause necrotic cell death only on susceptible plant cultivars
[28–31]. HSTs are defined as pathogen effectors that induce toxicity
and promote disease only in the susceptible host plants [32].
The tomato pathotype of Aa, which produces host-specific AAL-
toxins, causes Alternaria stem canker on susceptible tomato culti-vars [28,33]. AAL-toxins have shown to induce the infection of
nonpathogenic Aa, which does not produce these toxins, on
susceptible tomato cultivars at low concentrations [34]. AAL-toxin-
deficient mutants cannot cause symptoms on susceptible tomatoes
[35]. These results indicate that the AAL-toxins play an essential
role in the pathogenicity of the tomato- Aa pathotype. The structure
of the AAL-toxins, which is a chemically related analog of the
mycotoxin fumonisins produced by Fusarium moniliforme, has
already been determined [36,37]. AAL-toxins and fumonisins are
sphinganine-analog mycotoxins that induce apoptotic cell death in
susceptible tomato and mammalian cells by inhibiting ceramide
biosynthesis [38–40]. In the resistant cultivar, insensitivity to AAL-
toxin is conferred by the resistance gene Asc-1 (Alternaria stem
canker), a homolog of the yeast longevity assurance gene (LAG1),which appears to salvage the endoplasmic reticulum-to-Golgi
transportation of glycosylphosphatidylinositol-anchored proteins
by the production of alternative ceramide [41].
Although roles for toxins as effectors of disease susceptibility
have been well characterized in many plant-pathogen interactions,
there is little knowledge on the mechanisms of general, basal or
non-host resistance in host plants against toxigenic and necrotro-
phic pathogens that depend on toxins for their pathogenesis,
except for defense responses in rough lemon against Aa [42–44].
We have analyzed the induced- and basal-defense responses of
plants against Aa, using the Aa/AAL-toxin and tomato interaction as
a model system. Here, we demonstrate that the resistance against
pathogenic Aa was induced by infection with nonpathogenic Aa.
Furthermore, SA- and JA-dependent signaling pathways are notinvolved in host defense against the necrotrophic and toxin-
dependent Aa pathogen. Rather, the induced resistance might be
activated by alternative unknown signaling involving the activated
expression of multiple defense genes.
2. Materials and methods
2.1. Fungal strains and plant materials
The tomato pathotype of A. alternata ( Aa) (synonym A. alternata
f. sp. lycopersici, synonym A. arborescens) strain As-27, which
produces host-specific AAL-toxins, and nonpathogenic strain O-94
producing no AAL-toxin, was maintained on potato dextrose agar
(PDA) (Difco, Detroit, MI, USA) slopes or as 15% glycerol stocks at
80 C. For pathogenicity tests, spores of the fungus were prepared
as previously described [45]. Corynespora cassiicola [46,47] strain
LC93020, which produces the host-specific CCT-toxin, was main-
tained on PDA as described above, and conidia of the fungus were
prepared as described previously [48]. B. cinerea strain O-235 was
maintained on PDA and conidia were prepared by culturing on V-8
Juice agar plates under Black Light Blue (BLB) light for 2 days and
then in the dark for 1 week. Spores formed on the plates were
harvested by brushing the surface of the plates and suspended in
distilled water containing 1% peptone.
Tomato plants (Solanum lycopersicum L.) were grown in steril-
ized soil in a growth chamber (Growth Cabinet MLR-350, Sanyo,
Osaka) with a 16 h photoperiod at 25 C. After 5 weeks of growth,
tomato plants were grown in a greenhouse at 24–26 C. Tomato
cultivar Aichi-first (AF; Toyohashi Seed Co., Aichi, Japan) was highly
susceptible to the tomato pathotype of Aa, and cultivar Micro-Tom
was resistant [48]. The jasmonate biosynthetic mutant def1 [24,25]
was kindly provided by G.A. Howe, and the NahG [20] transgenic
tomato mutant expressing the SA hydroxylase gene was provided
by J. Jones.
2.2. Assay for induced resistance
The detached leaves of tomato cultivar AF (8 weeks old)
were inoculated with spore suspension (106 spores ml1) of the
nonpathogenic strain O-94 using a glass atomizer and incubated in
a moist chamber for 6 h at25 C. The leaves were then washed with
distilled water (DW) and sprayed with spore suspension
(106 spores ml1) of the virulent strain As-27 or spore suspensions
(105 spores ml1) of LC93020. Thenecrotic lesionarea wasobserved
4 days post-inoculation (dpi).
A whole plant of the cultivar Micro-Tom (5-weeks-old) was
inoculated with spore suspension of O-94, covered with a plastic
bag and maintained under the same conditions as described above.
After 24 h, the plant was rinsed with DWand inoculated with spore
suspension (5106 spores ml1) of B. cinerea. The necrotic area was
determined by using ATTO analyzing software (ATTO Densitographseries Version 2.0, ATTO, Tokyo, Japan) at 3 dpi.
2.3. Microscopic observation
Inoculated leaves were fixed and decolorized in ethanol-acetic
acid solution (3:1, v/v) until chlorophyll was removed. The leaves
were then stained with aniline blue (0.1%, w/v) in lactophenol
(1:1:1:1, v/v/v/v, lactic acid/glycerol/phenol/water) at 65 C for 3 h.
The infection behaviors, spore germination, appressorium forma-
tion and infection haypha formation were observed under a light
microscope (Nikon, Tokyo, Japan).
2.4. Real-time PCR
For the estimation of in plant fungal biomass, fungal genomic
DNAs were extracted from 0.1 g of inoculated leaves with DNeasy
Plant Mini Kit (Qiagen, Tokyo, Japan), following the manufacturer’s
instructions. Extracted DNA was diluted 1/100 and used for real-
time PCR template. Real-time PCR was performed using SYBER
Green system on a LightCycler (Roche Diagnostics, Tokyo, Japan).
Five ml of diluted DNA was added to a 20-ml reaction containing 4 ml
SYBER Green Mastermix, 0.5 mM gene specific primers pairs. The
primer pairs (DeH-F, 50-CTCCGCCTGCCAATGTGATTAC-30 and E8T7,
50-GCGTACCAAGGCACGTGCTCAA-30) designed for amplification of
the gene for AAL-toxin biosynthesis ( ALT1) were used for detecting
the tomato pathotype of Aa [34,49]. PCR was performed with an
initial stepof 10 min at 95 C followedby 35cycles of5 sat 95 C,6 s
at68
C,10 s at 72
C, and then melting program of 0 s at 95
C, and
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 68
![Page 3: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/3.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 3/11
slowly heated from 73 to 97 C at0.1 C s1. The primerpairs (CCT-F,
50-GGCGAGCTGATTATTGAAGG-30 and CCT-R, 50-CCTGTGGGAA-
TAAAGTCTGG-30) designed for amplification of the gene for a non-
ribosomal peptide synthetase specifically found in C. cassiicola
strains (M. Kodama, personal communication) were used for
quantifying the DNAs of C. cassiicola. PCR was performed with an
initial stepof 10 min at95 C followed by35 cyclesof 1 s at 95 C,5 s
at 60 C,18 s at 72 C, and then melting program of 0 s at 95 C, and
slowly heated from 65 to 97 C at 0.2 C s1. Standard curve was
created with fungal genomic DNAs as a template, which prepared
from As-27 or LC93020 mycelia by DNeasy Plant Mini Kit (Qiagen).
To analyze the expression of genes for disease resistance in
tomato, a whole plant of AF (5-weeks-old) was inoculated with O-
94 spore suspensions (106 spores ml1) by spray treatment. The
plants were covered with a plastic bag to keep a high-humidity and
incubated at 25 C in a growth chamber. After 6, 12 and 24 h of
incubation, leaveswere harvestedand total RNA was extracted with
RNeasy Plant Mini Kits (Qiagen), following the manufacturer’s
instructions. Total RNA was treated with DNase I (Nippongene,
Toyama, Japan) to remove traces of contaminating DNA and 1 mg of
RNA was converted into cDNA by the RNA PCR kit (AMV) Ver. 3.0
(Takara,Shiga,Japan)using random9 mers primer, according to the
manufacturer’s conditions. Real-time PCR was conducted with 2 mlof the cDNA sample and the specific primers indicated in Table 1 as
described above. PCR was performed with an initial step of 10 min
at 95 C followed by 35 cycles of 1 s at 95 C, 5 s at 58 C, 10 s at
72 C, and then melting program of 0 s at 95 C, and slowly heated
from 63 to 97 C at 0.1 C s1.
2.5. Preparation and treatment Aa elicitor
Spore suspensions (106 spores ml1) of O-94 were dropped in
a moist chamber and incubated at 25 C for 24 h. After incubation,
the spore germination fluids (SGF) were collectedand filtrated withWhatman No.50 filter paper, and then the filtrate was concentrated
20-fold of the original volume by lyophilization and used as the
elicitor. AF leaves were sprayed with the elicitor solution or DWand
incubated in moist chamber at 25 C for 6 h. After rinsing with DW,
the leaves were inoculated with As-27 spore suspensions
(106 spores ml1). AF leaves were also inoculated with As-27 spores
suspended in the elicitor solution. The lesion formation was
observed at 4 dpi.
2.6. Effect of SA or MeJA on Aa
AF plants were treated with SA (0.2 mM) or MeJA (100 mM)
solution by root feeding. After 24 h, AF plants were inoculated with
spore suspension (106 spores ml1) of As-27 using grass atomizer.Necrotic lesion formation was observed at 4 dpi. The leaves of 8-
week-old def1 and NahG plants were inoculated with spore
suspension of O-94 (106 spores ml1). After 4 days, inoculated
leaves were fixed and decolorized, and the infection behaviors of O-
94 were observed as described above.
2.7. SA determination
AF leaves were inoculated with spore suspension of O-94 or As-
27, or treated with elicitor. After 24 h, leaves (0.5 g) were ground in
liquid nitrogen, then SA and SA conjugates were extracted and
analyzed as described Enyedi et al. [50]. HPLC analysis was per-
formed using a Hitachi HPLC system equipped with a F-1050 fluo-
rescence spectrophotometer, L-6000 pump, L-5000 LC controller,
and D-2500 chromato-integrator (Hitachi, Tokyo, Japan). The
sample wasinjectedand chromatographed on an ODS-UG-5column
(4.6150 mm) using methanol/0.1%(v/v) phosphate (75:25, v/v) at
a flow rate of 0.7 ml/min. The excitation and emission wavelengths
were 295 nm and 400 nm, respectively.
2.8. Suppression subtractive hybridization (SSH)
For RNA preparation, AF plants were treated with spores of O-94
(106 spores 1ml) or DW. Tomato leaves were collected at 6, 12 and
24 h after inoculation and total RNA was extracted with the RNeasy
Plant Mini Kit (Qiagen). The mRNA was purified with the Poly-
ATtract mRNA isolation system (Promega, Tokyo, Japan) followingthe manufacturer’s instructions. SSH was performed with the
mRNA from DW-treated leaves as a driver and O-94-inoculated
leaves as a tester according to the protocol for the PCR-Select cDNA
subtraction kit (BD Biosciences Clonetech, Palo Alto, CA). After
cDNA amplification, PCR products were cloned into the pDrive
Cloning vector and transformed into Qiagen EZ Competent Cells
using the PCR Cloning kit (Qiagen) according to the supplier’s
protocol. In total, 262 randomly selected clones were one-pass
sequenced at the Dragon Genomics Center (Takara-Bio, Shiga,
Japan). The sequences of the clones were annotated using the NCBI
(National Center for Biotechnology Information) BlastN and BlastX
searches, and functional classification was performed using the
Arabidopsis thaliana Munich Information Center for Protein
Sequences database (MIPS, http://mips.gsf.de/projects/funcat).
Table 1
Oligonucleotide primers used in this study.
Primer pair Target genea Sequence (50/ 30)
94AF1A05-F AC215459 GTTCCCTTGGCTGTGGTTTC
94AF1A05-R TTAGTGACGCGCATGAATGG
94AF1G04-F AF512549 CCATTTGGTTTACGTAGCAG
94AF1G04-R CTCTCTAACCCTTGCTTCAC
94AF2C04-F BP910076 AGATGAAACAGTACAAGTGG
94AF2C04-R TGTCTTCTCTTTACTCTGTG
94AF2E09-F AK247674 ACGATGAGAGTAAGAACGCA94AF2E09-R GCCGATTATAACCCCTTCAC
94AF2E12-F BY999927 GCAAATTCCCACAAGGTTTC
94AF2E12-R TCTGTTTCACTGTAATGGCT
94AF2F12-F TC194085 GCCCCTGATGATCTGACCTT
94AF2F12-R TACGTGCAGCAAGAGTCTCA
94AF2H06-F BY999940 GGTTGCATATGTTGTTCGCT
94AF2H06-R TCAGTCAGAGAGCTATTGGG
94AF3A06-F BY999943 TCTTTATCCGCGTCTTGCTC
94AF3A06-R ATGGAACAGCCTCGTCTATG
94AF3F08-F L12051 GTTGGCATCACTAGGGTTGT
94AF 3F08-R CTCTGATGTGGGGTACTGTG
94AF 3F09-F BT013028 GACTTGTTTCTGGCACCTCA
94AF 3F09-R TGGCATAGCATCCTGGAAAG
94AF 4D02-F BY999978 CCCTTCCATTTCATTCCCAA
94AF 4D02-R GGAATGAGTGGATCTCCGAA
94AF 4E03-F TC206865 GGTGGTCTTTTCCTGCTATC
94AF 4E03-R TCCATTTGGAACTTAGCCTT
94AF 4G03-F TC206779 TGAGTGATCCGTACAAGACC
94AF 4G03-R CGGGTGATACTGAAGAGCAA
94AF4G11-F AK246682 ACTTGCAATTTGAGAACCTG
94AF4G11-R TGGGTAATCAGACTGCAAAA
94AF 4H04-F BY999995 GTTTGTATTGAAGATTGTGG
94AF 4H04-R ATCCAGAAAGGTATCATATC
94AF4H11-F BY999999 CTCCAAATCCCTAAACCTCT
94AF4H11-R AATGGTGATGATCTGTTGTG
94AF13-F AF230371 GAGCTTTTCGAAACCCTAGA
94AF13-R AAGACCGAGAGTTATCACAG
94AF35-F AF004165 GTGCCTATTACGCTCCTTGA
94AF35-R ATGTGCGGTGAATAGTCTGT
94AF36-F CJ999369 ACTGTAAGCATGATTGTCTC
94AF36-R CCAATCATGACATATCCACT
a Primer pairs were designed from SSH clones and corresponding genes of
tomatoes showing significant identities (more than 95%) by a BlastN search of NCBI
or the TIGR Gene Indices (http://compbio.dfci.harvard.edu/tgi/ ).
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 69
![Page 4: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/4.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 4/11
Fig. 1. Induced resistance to the tomato pathogens in tomato by pre-inoculation with nonpathogenic Aa. (a) The leaves of susceptible tomato AF were inoculated with
nonpathogenic Aa (O-94), the tomato pathotype of Aa (As-27) or C. cassiicola (LC93020). Tomato leaves pre-inoculated with O-94 were then inoculated with As-27 (Pre-O-94/ As-
27) or LC93020 (Pre-O-94/ LC93020). DW was treated as a control (DW). Lesion formation on the leaves was observed at 4 dpi. (b,c) Fungal biomass of the tomato pathogens in the
infected plants pre-inoculated with O-94 (Pre-O-94) or control (DW) was estimated by quantifying fungal DNA with real-time PCR using primers specific for the As-27 ALT1 gene (b)
and the LC93020 cyclic peptide synthetase gene (c). The results show relative values to control leaves for four independent experiments and error bars indicate standard error (SE).
An asterisk indicates a significant difference between pre-inoculated leaves and control (paired t -test, P < 0.05). RU; relative unit.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 70
![Page 5: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/5.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 5/11
3. Results
3.1. Induced resistance to the tomato pathotype in tomato
To assess the effects of pre-inoculation with the non-pathogen
against infection by toxin-dependent pathogens, we inoculated
leaves of the susceptible tomato AF with nonpathogenic Aa strain
O-94 and then the tomato pathotype Aa strain As-27. Necrotic
lesion formation was observed on the leaves inoculated with As-27
(Fig. 1a), while there was no visible lesion, even hypersensitive
response (HR)-like cell death, on the leaves inoculated with O-94
(Fig.1a). Microscopic observation indicated that spore germination
and appressorium formation of O-94 on AF leaves were normal,
whereas infection hypha formation was clearly inhibited (data not
shown). The combination of pathogenic Aa As-27 and resistance
cultivar Micro-Tom also resulted in no visible symptoms and
a suppression of infection hypha formation, as is the case with the
non-pathogen and cultivar AF [48]. The results indicate that
formation of the infection hypha is the most critical step for
successful infection by Aa pathogens. On the other hand, when AF
leaves were inoculated with As-27 following pre-inoculated with
O-94, lesion formation by the pathogen clearly decreased
compared with the control inoculation (Fig. 1a). Because O-94 and
As-27 are morphologically indistinguishable under the microscope,
it is difficult to observe the infection behaviors of the pathogen on
the leaves pre-inoculated with the non-pathogen. The amount of in
planta fungal DNA representing the biomass of As-27 in AF leaves
was quantified by real-time PCR using ALT1 specific primers. Fig. 1b
shows that the amount of fungal biomass of As-27 in AF leaves
inoculated with As-27 following O-94 was 2.1-times less than that
in control leaves (paired t -test, P < 0.05). These results imply that
infection by the pathogen was suppressed by pre-inoculation with
the nonpathogenic strain. The SGF prepared from the germinating
spores of O-94 was used as an elicitor. AF leaves were pretreated
with the elicitor, and after 6 h of incubation the leaves were inoc-
ulated with spores of As-27. Treatment of leaves with the elicitor
alone did not cause any visible change on the leaves (Fig. 2a),
suggesting that the elicitor does not induce HR-like cell death on
tomato leaves. Lesion formation by As-27 was inhibited by
pretreatment of the elicitor, as well as by pre-inoculation with O-94
(Fig. 2a). When AF leaves were inoculated with spores of As-27
suspended in the elicitor solution (i.e., the simultaneous treatment
with elicitor and pathogen), the development of symptoms on the
leaves was not suppressed (Fig. 2a). Infection behaviors of As-27
spores on the inoculated leaves were observed under the micro-
scope. The rates of spore germination and appressorium formation
Fig. 2. Induced resistance to the Aa tomato pathotype in tomato by pretreatment with elicitor. The elicitor was prepared from nonpathogenic Aa spore germination fluids. (a) Leaves
of AF were pretreated with elicitor and then inoculated with As-27 (Pre-elicitor/As-27). AF leaves were inoculated with As-27 with the elicitor simultaneously (Elicitor þAs-27).
Elicitor treatment (Elicitor) and As-27 inoculation (As-27) only were used as controls. Lesion formation was observed at 4 dpi. (b) Infection behaviors of As-27 were observed under
light microscopy 48 h post-inoculation. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent experi-
ments, and error bars indicate SE. Different letters indicate significant levels of difference (Duncan’s new multiple range test, P <
0.05).
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 71
![Page 6: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/6.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 6/11
were similar among all treatments and inoculations (Fig. 2b). On
the other hand, infection hypha formation was clearly inhibited by
pretreatment of the elicitor (Fig. 2b).
3.2. Induced resistance in tomato by nonpathogenic Aa to infection
with other necrotrophic pathogens
To evaluate the effectiveness of the induced resistance by
nonpathogenic Aa against infection with other necrotrophic path-
ogens, C. casiicola, a causal agent of target spot of tomato and
a host-specific CCT-toxin producer, was used for a challenge inoc-
ulation. Spore inoculation of a virulent strain LC93020 resulted in
the development of severe symptoms on the leaves (Fig. 1a), but
pre-inoculation with O-94 clearly decreased lesion formation by
LC93020 (Fig. 1a). Fungal biomass of C. casiicola in the infected
plants was estimated by quantifying fungal DNAs with real-time
PCR using primers specific for the pathogen. The amount of fungal
DNA in the leaves pre-inoculated with O-94 was 1.5-fold less than
that in the control leaves (paired t -test, P < 0.05) (Fig. 1c). This
result suggests that induced resistance by nonpathogenic Aa might
be efficient not only against the infection with pathogenic Aa but
also against other HST-producing necrotrophic pathogens.
B. cinerea has been used as a typical necrotrophic pathogen inthe studies of disease resistance in some plants, including tomato
and Arabidopsis [12,18,51,52]. To determine whether the Aa-
induced resistance in tomato is effective against B. cinerea, Micro-
Tom plants were inoculated with O-94 and then challenged with B.
cinera. Necrotic lesions on the infected plants were indistinguish-
able in Aa pre-inoculated and control tomatoes (Fig. 3a and b). This
result indicates that induced resistance by O-94 was not efficacious
against B. cinerea infection.
3.3. SA- and JA-signaling pathways are not involved in the induced
resistance against infection by Aa in tomato
SA and JA have been shown to have a major role in plant defense
against pathogens in tomato, Arabidopsis and other plants [2,11–13,19]. To assess the involvement of SA and JA in the induced
resistance of tomato against HST-producing necrotrophic patho-
gens, AF plants were treated with 0.2 mM of SA or 100 mM of MeJA
solutions and then inoculated with the Aa tomato pathotype As-27.
Expression of the marker genes PR-1 and PI for SA- and JA-signaling
pathways, respectively, increased after treatment with SA and JA,
respectively, indicating that those signaling pathways were acti-
vated in the tomato plants (data not shown). Pretreatment of the
tomato plants with SA and MeJA did not influence lesion formation
on the leaves (Fig. 4a). Likewise, there were no differences in
infection behaviorsof the pathogen on the plants treated with SA or
MeJA (Fig. 4b). The SA levels in the leaves inoculated with
nonpathogenic Aa O-94 or the tomato pathotype As-27 were
quantified by HPLC. The concentration of SA in the leaves was notchanged after inoculation with O-94 or As-27 (Fig. 5).
3.4. Response of NahG and def1 tomatoes to infection with
nonpathogenic Aa
Previous studies have shown that mutants with a defect in SA-
or JA-signaling pathways exhibit increased susceptibility to path-
ogens since SA and JA are closely related to disease resistance in
many plants [12,14,15,21–23,26]. To further determine whether SA-
and JA-signaling pathways in tomato are involved in the resistance
to Aa infection, NahG and def1 mutant tomatoes were inoculated
with spores of a nonpathogenic Aa strain O-94. The NahG tomato is
unable to accumulate SA, due to the degradation of SA by nahG-
encoded SA hydoroxylase [20]. The def1 tomato does not
accumulate JA in response to wounding and pathogen infection,
and it is deficient in the activation of wound or JA-inducible defense
genes [24,25]. Inoculation of these mutant plants with O-94 did not
cause any visible lesions on the leaves of either plant (Fig. 6). Under
microscopic observation, although spore germination and appres-
sorium formation were observed on the mutant leaves, infection
hypha formation, which is the most critical step for establishing the
initial infection of Aa pathogens, was not induced, even on the
mutant tomato leaves (Table 2). The results indicate that the defect
in SA- and JA-signaling in tomatoes does not lead to the induction
of Aa infection. SA and JA may not be important compounds for
basal defense responses in tomato against infection by Aa.
3.5. Induced resistance by nonpathogenic Aa in the def1 tomato
Since def1 tomato and its WT strain of origin, Castlemart, are
susceptible to tomato pathotype Aa, it is possible to assess whether
JA signaling is involved in the resistance to tomato pathotype
induced by nonpathogenic Aa O-94. def1 leaves were pre-inocu-
lated with spores of O-94 and then challenged with virulent strain
Fig. 3. Effect of pre-inoculation with nonpathogenic Aa in tomato on infection by B.
cinera. (a) Micro-Tom tomato was pre-inoculated with nonpathogenic Aa (O-94) and
then inoculated with B. cinera. Pretreatment of DW was used as control (DW). Lesion
formation was observed at 3 dpi. (b) Comparison of necrotic areas between the leaves
pre-inoculated with O-94 (O-94) and control (DW). The proportion of lesion area on
the leaf was estimated. Results indicate relative value to control leaves in three
independent experiments and error bars indicate SE. RU; relative unit.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 72
![Page 7: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/7.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 7/11
As-27. After 4 days, necrotic lesions were found on both O-94-pre-
inoculated and control (DW) leaves (Fig. 7a). However, pathogen-
induced development of necrotic lesions on def1 leaves pre-inocu
lated with the non-pathogen significantly decreased compared to
that on control leaves (Fig. 7a). The amount of As-27 DNA in thepre-inoculated leaves estimated by real-time PCR was 6.0-fold less
than in the control leaves (Fig. 7b), indicating a suppression of
pathogen growth by pre-inoculation with nonpathogenic Aa. These
results suggest that the resistance against the tomato pathotype
induced in tomato by nonpathogenic Aa is still active in the absence
of JA-dependent signaling.
3.6. Suppression subtractive hybridization (SSH) identified putative
defense gene(s) associated with induced resistance by
nonpathogenic Aa in tomato
To identify tomato genes that are involved in the resistance to
infection by the tomato pathotype induced by nonpathogenic Aa,
SSH was performed using O-94-inoculated leaves as the tester and
DW-treated leaves as the driver. In total, 262 clones were randomly
picked up from a subtraction library and subsequently sequenced.
The nucleotide sequences of 219 clones were determined. BlastN
analysis (<e5) showed 150 clones were unigenes (57 contigs and
135 singlets) corresponded to known genes, and 27 clones had nomatches in the databases. On the other hand, BlastX (<e5) analysis
indicated that 143 clones had significant homology to known
proteins and that 34 clones were not similar to any known proteins
(Supplemental Table). These clones were divided into functional
categories by the MIPS Functional Catalogue (MIPS, http://mips.gsf.
de/projects/funcat). To analyze the expression of genes in tomato
plants involved in signal transduction and defense or reported to be
included in the defense responses against biotic or abiotic stress in
plants inoculated with nonpathogenic Aa O-94, we randomly
selected nineteen clones that had been categorized as such.
Thirteen clones whose expression was increased from 6 to 24 h
after O-94 inoculation are listed in Table 3. These corresponding
proteins determined by the SSH were known to be involved in both
non-host resistance and host resistance [53–60].
Fig. 4. Effects of SA and MeJA on infection of the Aa tomato pathotype. (a) Leaves of AF were pretreated with 0.2 mM SA (pre-SA/ As-27) or 100 mM MeJA (pre-MeJA/ As-27) and
then inoculated with As-27. Pretreatment with DW was used as control (As-27). Lesion formation on the leaves was observed at 4 dpi. (b) Infection behaviors of As-27 were
observed under light microscopy at 4 dpi. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent
experiments and error bars indicate SE. There were no significant differences among pretreatment with SA (shaded bar), MeJA (filled bar) and DW (control; open bar).
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 73
![Page 8: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/8.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 8/11
4. Discussion
Lesion formation on tomato leaves by the Aa tomato pathotype
was reduced by pre-inoculation with nonpathogenic Aa. It is diffi-
cult to observe infection behaviors of the tomato pathotype on the
leaves that were pre-inoculated with nonpathogenic Aa, since there
is no morphological difference between nonpathogenic and path-
ogenic strains of Aa. Thus, fungal biomass of the pathogenic strain
in the infected plants was estimated by quantifying fungal DNA
with real-time PCR using primers specific for the ALT1 gene, which
is involved in toxin biosynthesis and in Aa tomato pathotype
pathogenicity. The amount of fungal pathogen DNA in the pre-
inoculated plants was decreased, indicating that in planta growth of
the Aa tomato pathotype was restricted by the inoculation with the
non-pathogen. Plants defend themselves from pathogens by basaldefenses and induced resistances including anti-fungal properties,
phytoalexins and PR-proteins [1–4]. Although tomato is known to
produce the anti-fungal compound, a-tomatine, Aa has ability to
detoxify it [61]. Until now there has been no report on anti-fungal
compounds effective against infection with Aa.
Pretreatment with the SGF of nonpathogenic Aa O-94 also
protected tomato against infection by the Aa tomato pathotype. The
SGF elicitor from Aa is a mannose-rich heteropolysaccharide with
a molecular weight of about 40,000 Daltons [29]. The resistance-
inducing activity of the SGF elicitor was found not only in tomato
but also in Japanese pear, apple and strawberry against other Aa
pathotypes [29]. This means that SGF from Aa is a non-specific and
general elicitor that induces the defense response in a wide range of
plant species. Moreover, pre-inoculation with O-94 induced resis-tance against infection with the tomato pathogen C. cassiicola that
causes Corynespora target spot. This result also indicates that the
Aa elicitor has resistance-inducing activity against a broad spec-
trum of pathogen species as a general elicitor.
Microscopic observation of infection behaviors of the Aa tomato
pathotype on tomato leaves revealed that reduction of lesion
formation depends on the restriction of infection hypha formation
of the pathogen. An incompatible interaction between Aa and
resistant cultivars does not depend on a specific R-gene and Avr
gene interaction; rather it has been regarded as non-host, general
or basal resistance. Two types of non-host resistance have been
reported. Type I has no visible reaction on the non-host plant, and
type II is accompanied with HR cell death [6,62]. In type II resis-
tance, non-pathogens are restricted in cell death after penetration
in one ora few plant cells,whereas in typeI resistance, invasion andpenetration in plant cell tissues by non-pathogens are not
observed. The interaction between Aa and resistant plants should
be considered to be type I non-host resistance, because neither
visible symptoms nor cell death were detected on the infected
tomato leaves. In the interactions between nonpathogenic Aa and
its potential host, or between Aa pathotypesand a resistant cultivar,
spore germination and appressorium formation are observed as
between the pathogenic Aa and the susceptible cultivar. However,
infection hypha formation is obvious only in the interaction
between pathogenic Aa and the susceptible cultivar. Infection
hypha formation strictly depends on the susceptibility of plants to
HSTs [28]. The formation of infection hypha is the most critical step
for the initial establishment of infection by the Aa pathogens. It was
reported that the infection-inhibiting factor (IIF) that inhibits only
Fig. 5. Accumulation of SA in tomato following pathogen inoculation and elicitor
treatment. Leaves of AF tomato were inoculated with nonpathogenic Aa (O-94), the
tomato pathotype of Aa (As-27), or treated with elicitor. Leaves were collected after
24 h and total SA (conjugated with glucose) and free SA were extracted. Amounts of SA
were quantified by HPLC. Data represent the mean of two independent experiments
and error bars indicate SE.
Fig. 6. Response of SA and JA signaling in mutant tomato plants infected with
nonpathogenic Aa. The leaves of NahG, derived from Moneymaker, and of def1, derived
from Castlemart, were inoculated with O-94. Inoculated leaves were observed at 4 dpi.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 74
![Page 9: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/9.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 9/11
infection hypha formation of the Japanese pear pathotypeof Aa was
identified from pear leaves inoculated with nonpathogenic Aa [63].
However, such a compound has not been found in tomato plants
inoculated with nonpathogenic Aa.
There are some reports that MAMPs play an important role in
non-host resistance [1,2,5,6]. MAMPs from filamentous fungidinc
luding oligosaccharides, P-glucan and chitin, which are compo-
nents of fungal cell wallsdhave been characterized [9,10]. Although
the critical structure of the SGF elicitor of Aa is unknown, MAMPs-
like factors might be involved in induced resistance based on non-
host or general resistance of tomato plants against Aa infection.
There have been many reports indicating that SA- and JA-
signaling pathways play important roles in plant defense systems
[2,11–13,19]. However, little is known about the involvement of these signaling pathways in interactions between plants and Aa
pathogens. Pretreatment of host plants with SA or MeJA has been
shown to enhance resistance against infection with A. brassicicola,
B. cinerea, Peronospora parasitica, P. syringae and P. infestans,
Table 2
Infection behaviors of nonpathogenic A. alternata on signaling mutant tomatoes.
Tomato cv.a Infection behavior (%)b
Spore germination Appressorium formation Infection hypha formation
Moneymaker 89.44.6 29.62.5 0
NahG 82.4 4.6 30.31.6 0
Castlemart 83.4 2.3 30.41.4 0
def1 70.6 5.3 28.14.2 0
a Mutant tomato NahG was derived from cv. Moneymaker, and def1 derived from cv. Castlemart. Tomato leaves were inoculated with nonpathogenic Aa O-94. Leaves were
fixed and decolorized for microscopic observation at 3 dpi.b Rates of spore germination, appressorium formation and infection hypha formation were indicated as percentages. Data represent the mean of four independent
experiment and SE. There were no significant differences on infection behaviors among these tomatoes.
Fig. 7. Induced resistance in the tomato JA signaling mutant def1 to the Aa tomato
pathotype pre-inoculated with nonpathogenic Aa. (a) The leaves of def1 were inocu-
lated with the tomato pathotype of Aa (As-27). Tomato leaves pre-inoculated with O-
94 were then inoculated with As-27 (Pre-O-94/ As-27) and lesion formation on the
leaves was observed at 4 dpi. (b) Comparison of As-27 growth in def1 plants pre-
inoculated with O-94 and inoculated with As-27 at 4 dpi. Fungal biomass in the
infected plants was estimated by quantifying fungal DNA with real-time PCR using
primers specific for the As-27 ALT1 gene. Results shows values relative to control leaves
for three independent experiments and error bars indicate SE. An asterisk indicates
a significant difference between pre-inoculation with O-94 and the control (paired t -
test, P <
0.05). RU; relative unit.
Table 3
Functional categorization of SSH clones and their expression profile.
Clone
ID
Accession
No.
Blast
hitaCorresponding protein
(Organism)aEST
length
E-
valueaMIPS
fanction
categoryb
94AF2E09 CJ999324 CAO23453 Unnamed protein
product (Vitis vinifera)
260 3.00E-
25
99
94AF2E12 BY999927 CAE45567 SUMO E2 conjugating
enzyme SCE1(Nicotiana
benthamiana)
403 2.00E-
68
14
94AF2H06 BY999940 AAM13899 Putative 4-coumarate
CoA ligase
( Arabidopsis thaliana)
335 2.00E-
39
1
94AF3A06 BY999943 CAO68296 Putative
metallophosphatase
(Lupinus luteus)
378 1.00E-
54
99
94AF3F08 BY999959 P52884 GTP-binding protein
SAR2 (Solanum
lycopersicum)
324 3.00E-
54
20,30
94AF3F09 BY999960 No hit No hit 338 No hit No hit
94AF4D02 BY999978 AAU00066 Pathogenesis-related
protein 10
(Solanum virginianum)
501 3.00E-
07
32
94AF4E03 BY999983 AAD17230 FtsH-like protein
(Nicotiana tabacum)
317 1.00E-
33
70
94AF4G03 CJ999351 ABC69274 Putative DnaJ protein
(Camellia sinensis)
199 1.00E-
24
32
94AF4G11 BY999994 ABD28590 C2 (Medicago
truncatula)
420 8.00E-
20
99
94AF4H04 BY999995 CAB51914 Profilin Hev b 8
(Hevea brasiliensis)
383 4.00E-
16
40,42,43
94AF13 CJ999355 AAF67141 Allene oxide synthase
(Solanum
lycopersicum)
284 1.00E-
46
99
94AF35 CJ999368 O04973 2-isopropylmalate
synthase A (Solanum
pennellii)
311 3.00E-
34
99
a Corresponding proteins are predicted from BlastX (<e-5) searches.b Functional categorization was performed according to the MPIS catalogue. 1;
metabolism, 14; protein fate, 20; cellular transport, 30; signal transduction, 32; cell
rescue, 40; cell fate, 42; biogenesis of cellular components, 43; cell type differenti-
ation, 70; subcellular localization, 99; unclassified proteins.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 75
![Page 10: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/10.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 10/11
[14,15,17,18]. However, pretreatment of SA or MeJA did not reduce
lesion formation in tomato leaves by the tomato pathotype of Aa. In
particular, JA signaling has been known to be involved in resistance
against necrotrophic pathogens [11–13,18,19], while MeJA treat-
ment did not decrease lesion development by the necrotrophic
pathogen Aa tomato pathotype whose infection depends on the
host-specific AAL-toxin [28,34,35]. In addition to JA signaling, ET is
also involved in plant defense systems against necrotorophic
pathogens [52,64]. However, in tomato- Aa tomato pathotype and
AAL-toxin interactions, ET has been shown to promote cell death by
the AAL-toxin [65,66]. Therefore, ET signaling in tomato may
facilitate infection by the tomato pathotype, rather than induce
resistance against the pathogen.
Many studies have shown that SA- and JA-signaling mutants
exhibit increased susceptibility against pathogens or non-patho-
gens [12,14,15,21–23,26]. However, neither of the SA- and JA-
signaling mutant tomatoes, NahG and def1, displayed increased
susceptibility to nonpathogenic Aa. On the other hand, pre-inocu-
lation of JA-related mutant def1 with O-94 induced resistance
against the Aa tomato pathotype, indicating that the defense
response by nonpathogenic Aa is induced in tomato independently
of SA and JA signaling. It has also been reported that Arabidopsis
SA-, JA- and ET-related signaling mutants retain the full induced-resistance responsibility mediated by MAMPs against a bacterial
pathogen [67]. These results suggest that SA- and JA-associated
signal transduction might not be involved in the induced resistance
of tomatoes against infection by Aa. In addition, tomato plants pre-
inoculated with nonpathogenic Aa O-94 did not exhibit induced
resistance against B. cinerea, and SA- and JA-signaling pathways
have been shown to play an important role in plant resistance
against B. cinerea [51,52,12,18]. Taken together, these findings
indicate that induced resistance in tomato against infection with
the tomato pathotype elicited by nonpathogenic Aa might result
from activation of an alternative pathway that is independent of
SA- and JA-signaling. Thuerig et al. [68] also reported that a fungal
elicitor-induced resistance in Arabidopsis independently of the SA-
and JA/ET signaling pathways.To gain insight into factors involved in the resistance induced by
nonpathogenic Aa, the expression of tomato genes induced by
infection with the non-pathogen were profiled using SSH. In our
study, some defense-related PR-protein genes were identified, for
example, PR-1 (94AF2C10, 94AF3C05; GenBank accession nos.
BY999919, CJ999333), PR-5 (94AF1A09, 94AF2A03, 94AF51; Gen-
Bank accession nos. BY999894, CJ999319, CJ999375) and PR-10
(94AF4D02; GenBank accession no. BY999978).2 PR-proteins are
well documented as being involved in defense responses, and some
of them were known as marker genes of SA- or JA-signaling path-
ways [4]. Regulation of tradeoffs between SA- and JA-signaling has
been reported in Arabidopsis inoculated with necrotrophic and
biotrophic pathogens [69]. In this study, however, SSH clones
involved in both SA- and JA-signaling pathways have been, indi-cating that the induced resistance against Aa might not strictly
depend on those signaling pathways. In the MAMP-associated
resistance, although signaling mutants exhibit induced resistance
against bacterial pathogens [67], expression of SA-dependent genes
was induced by MAMPs [70]. The data suggest that although basal,
general or non-host resistance partially depends on SA- and JA-
related pathways, SA- and JA-related defense genes may not be
critical for induced resistance by nonpathogenic Aa in tomato
plants. To further elucidate the role of these candidate genes in the
induced resistance of tomato against infection with Aa, functional
analysis of the defense-related genes identified by SSH will be
required.
In summary, the results indicate that SA- and JA-dependent
defense responses in tomato are not involved in induced resistance
by nonpathogenic Aa against infection with the toxigenic and
necrotrophic pathogen, the tomato pathotype of Aa. This finding
suggests that an alternative and unknown signaling pathway that is
independent of SA and JA signaling may modulate the induced
resistance by nonpathogenic Aa based on basal, non-host or general
resistance in tomato. However, some SA- and JA-dependent genes
were expressed during the induced resistance response, suggesting
the existence of SA- and JA-independent signaling pathways in this
induced defense pathway in tomato. The expression profiling and
functional analysis of SSH clones should reveal the details of the
induced resistance against toxin-dependent necrotrophic
pathogens.
Acknowledgements
We gratefully acknowledge G. A. Howe for providing the seeds
of the def1 tomato line and J. Jones for providing the seeds of the
NahG transgenic tomato mutant. This work was supported by
a Grant-in-Aid for Scientific Research from the Japanese Society for
Promotion of Sciences.
Appendix. Supplementary data
Supplementary data associated with this article can be found in
the online version at doi:10.1016/j.pmpp.2009.02.001.
References
[1] Jones JDG, Dangl JL. The plant immune system. Nature 2006;444:323–9.[2] Nurnberger T, Lipka V. Non-host resistance in plants: new insights into an old
phenomenon. Mol Plant Pathol 2005;6:335–45.
[3] Thordal-Christensen H. Fresh insights into processes of nonhost resistance.Curr Opin Plant Biol 2003;6:351–7.
[4] Van Loon LC, Rep M, Pieterse CMJ. Significance of inducible defense-relatedproteins in infected plants. Annu Rev Phytopathol 2006;44:135–62.
[5] Bent AF, Mackey D. Elicitors, effectors, and R genes: the new paradigm anda lifetime supply of questions. Annu Rev Phytopathol 2007;45:399–436.
[6] Mysore KS, Ryu C- M. Nonhost resistance: how much do we know? TrendsPlant Sci 2004;9:97–104.
[7] Felix G, Duran JD, Volko S, Boller T. Plants have a sensitive perception systemfor the most conserved domain of bacterial flagellin. Plant J 1999;18:265–76.
[8] Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T, Felix G. The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.Plant Cell 2004;16:3496–507.
[9] Jurgen E. Oligoglucoside elicitor-mediated activation of plant defense.Bioessays 1998;20:569–76.
[10] Shibuya N, Minami E. Oligosaccharide signalling for defence responses inplant. Physol Mol Plant Pathol 2001;59:223–33.
[11] Glazebrook J. Contrasting mechanisms of defense against biotrophic andnecrotrophic pathogens. Annu Rev Phytopathol 20 05;43:205–27.
[12] Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-Mani B, Vogelsang R,Cammue BPA, et al. Separate jasmonate-dependent and salicylate-dependentdefense-response pathways in Arabidopsis are essential for resistance todistinct microbial pathogens. Proc Natl Acad Sci USA 1998;95:15107–11.
[13] Ton J, Van Pelt JA, Van Loon LC, Pieterse CMJ. Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistancein Arabidopsis. Mol Plant Microbe Interact 2002;15:27–34.
[14] Cao H, Bowling SA, Gordon AS, Dong X. Characterization of an Arabidopsismutant that is nonresponsive to inducers of systemic acquired resistance.Plant Cell 1994;6:1583–92.
[15] Delaney TP, Friedrich L, Ryals JA. Arabidopsis signal transduction mutantdefective in chemically and biologically induced disease resistance. Proc NatlAcad Sci USA 1995;92:6602–6.
[16] Friedrich L, Lawton K, Ruess W, Masner P, Specker N, Rella MG, et al. A ben-zothiadiazole derivative induces systemic aquired resistance in tobacco. Plant J1996;10:61–70.
[17] Cohen Y, Gisi U, Niderman T. Local and systemic protection against Phytoph-thora infestans induced in potato and tomato plants by jasmonic acid and
jasmonic methyl ester. Phytopathology 1993;83:1054–62.
2 The nucleotide sequence data reported are available in the DDBJ/EMBL/Gen-
Bank database under the accession numbers BY999892–BY999999 and CJ999310–
CJ999378.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 76
![Page 11: 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata](https://reader030.fdocuments.net/reader030/viewer/2022021323/577cd4251a28ab9e7897c9f5/html5/thumbnails/11.jpg)
8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata
http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 11/11
[18] Thomma BPHJ, Eggermont K, Broekaert WF, Cammue BPA. Disease develop-ment of several fungi on Arabidopsis can be reduced by treatment with methyl
jasmonate. Plant Physiol Biochem 2000;38:421–7.[19] Thomma BPHJ, Tierens KFM, Penninckx IAMA, Mauch-Mani B, Broekaert WF,
Cammue BPA. Different micro-organisms differentially induce Arabidopsisdisease response pathways. Plant Physiol Biochem 2001;39:673–80.
[20] Brading PA, Hammond-Kosack KE, Parr A, Jones JDG. Salicylic acid is notrequired for Cf-2- and Cf-9-dependent resistance of tomato to Cladosporium
fulvum. Plant J 2000;23:305–18.[21] Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, et al. Three
unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J 2000;24:205–18.
[22] Mellersh DG, Heath MC. An investigation into the involvement of defensesignaling pathways in components of the nonhost resistance of Arabidopsisthaliana to rust fungi also reveals a model system for studying rust fungalcompatibility. Mol Plant Microbe Interact 2003;16:398–404.
[23] Zimmerli L, Stein M, Lipla V, Schulze-Lefert P, Somerville S. Host and non-hostpathogens elicit different jasmonate/ethylene responses in Arabidopsis. Plant J2004;40:633–46.
[24] Lightner J, Pearce G, Ryan CA, Browse J. Isolation of signaling mutants of tomato (Lycopersicon esculentum). Mol Gen Genet 1993;241:595–601.
[25] Howe GA, Lightner J, Browse J, Ryan CA. An octadecanoid pathway mutant(JL5) of tomato is compromised in signaling for defense against insect attack.Plant Cell 1996;8:2067–77.
[26] Thaler J, Owen B, Higgins VJ. The role of the jasmonate response in plantsusceptibility to diverse pathogens with a range of lifestyles. Plant Physiol2004;135:530–8.
[27] Feys BJF, Benedetti CE, Penfold CN, Turner JG. Arabidopsis mutants selected forresistance to the phytotoxin coronatine are male sterile, insensitive to Methyl
jasmonate, and resistant to a bacterial pathogen. Plant Cell 1994;6:751–9.[28] Nishimura S, Kohmoto K. Host-specific toxins and chemical structures from
Alternaria species. Annu Rev Phytopathol 1983;21:87–116.[29] Otani H, Kohmoto K, Kodama M, Nishimura S. Role of host-specific toxins in
the pathogenesis of Alternaria alternata. In: Patil SS, Ouchi S, Mills D, Vance C,editors. Molecular strategies of pathogens and host plants. New York:Springer-Verlag; 1991. p. 139–49.
[30] Kohmoto K, Otani H. Host-recognition by toxigenic plant pathogens. Experi-entia 1991;47:755–64.
[31] Otani H, Kohmoto K, Kodama M. Alternaria toxins and their effects on hostplants. Can J Bot 1995;73:S453–8.
[32] Friesen TL, Faris JD, Solomon PS, Oliver RP. Host-specific toxins: effectors of necrotrophic pathogenicity. Cell Microbiol 20 08;10:1421–8.
[33] Gilchrist DG, Grogan RG. Production and nature of a host-specific toxin from Alternaria alternata f. sp. lycopersici. Phytopathology 1976;66:165–71.
[34] Yamagishi D, Akamatsu H, Otani H, Kodama M. Pathological evaluation of host-specific AAL-toxins and fumonisin mycotoxins produced by Alternariaand Fusarium species. J Gen Plant Pathol 2006;72:323–7.
[35] Akamatsu H, Itoh Y, Kodama M, Otani H, Kohmoto K. AAL-toxin-deficientmutants of Alternaria alternata tomato pathotype by restriction enzyme-mediated integration. Phytopathology 1997;87:967–72.
[36] Bottini AT, Bowen JR, Gilchrist DG. Phytotoxins. II. Characterization of a phytotoxic fraction from Alternaria alternata f. sp. lycopersici. TetrahedronLett 1981;22:2723–6.
[37] Bottini AT, Gilchrist DG. Phytotoxins. I. A 1-aminodimethylheptadecapentolfrom Alternaria alternata f. sp. lycopersici. Tetrahedron Lett 1981;22:2719–22.
[38] Gilchrist DG, Wang H, Bostock RM. Sphingosine-related mycotoxins in plantand animal disease. Can J Bot 1995;73:S459–67.
[39] Wang H, Jones C, Ciacci-Zanella J, Holt T, Gilchrist DG, Dickman MB. Fumo-nisins and Alternaria alternata lycopersici toxins: sphinganine analog myco-toxins induce apoptosis in monkey kidney cells. Proc Natl Acad Sci USA1996;93:3461–5.
[40] Spassieva SD, Markham JE, Hille J. The plant disease resistance gene Asc-1prevents disruption of sphingolipid metabolism during AAL-toxin-inducedprogrammed cell death. Plant J 2002;32:561–72.
[41] Brandwagt BF, Mesbah LA, Takken FLW, Laurent PL, Kneppers TJA, Hille J, et al.A longevity assurance gene homolog of tomato mediates resistance to Alter-
naria alternata f. sp. lycopersici toxins and fumonisin B1. Proc Natl Acad Sci USA2000;97:4961–6.
[42] Gomi K, Itoh N, Yamamoto H, Akimitsu K. Characterization and functionalanalysisof class I and II acidic chitinase cDNA from rough lemon. J Gen PlantPathol 2002;68:191–9.
[43] Gomi K, Yamamoto H, Akimitsu K. Characterization of a lipoxygenase gene inroughlemon induced by Alternaria alternata. J GenPlant Pathol 2002;68:21–30.
[44] Gotoh Y, Nalumpang S, Isshiki A, Utsumi T, Gomi K, Yamamoto H, et al. A cDNAencoding polygalacturonase-inhibiting protein induced in citrus leaves bypolygaracturonase of Alternaria citri. J Gen Plant Pathol 2002;68:57–61.
[45] Johnson RD, Johnson L, Itoh Y, Kodama M, Otani H, Kohmoto K. Cloning andcharacterization of a cyclic peptide synthetase gene from Alternaria alternataapple pathotype whose product is involved in AM-toxin synthesis and path-ogenicity. Mol Plant Microbe Interact 2000;13:742–53.
[46] Blazquez CH. Target spot. In: Jones JB, Jones JP, Stall RE, Zitter TA, editors.Compendium of tomato diseases. St. Paul, Minnesota: APS Press; 1991. p. 23.
[47] Wei CT. Notes on Corynespora. Mycol Papers 1950;34:1–10.
[48] Takahashi H, Shimizu A, Arie T, Rosmalawati S, Fukushima S, Kikuchi M, et al.Catalog of Micro-Tom tomato responses to common fungal, bacterial, and viralpathogens. J Gen Plant Pathol 2005;71:8–22.
[49] Akamatsu H, Otani H, Kodama M. Characterization of a gene cluster for host-specific AAL-toxin biosynthesis in the tomato pathotype of Alternaria alter-nata. Abstracts of the 22nd Fungal Genetics Conference, Asilomar, California;2003. p. 121.
[50] Enyedi AJ, Yalpani N, Silverman P, Raskin I. Localization, conjugation, andfunction of salicylic acid in tobacco during the hypersensitive reaction totobacco mosaic virus. Proc Natl Acad Sci USA 1992;89:2480–4.
[51] Audenaert K, De Meyer GB, Hofte MM. Abscisic acid determines basalsusceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol 2002;128:491–501.
[52] Diaz J, Ten Have A, Van Kan JAL. The role of ethylene and wound signaling inresistance of tomato to Botrytis cinerea. Plant Physiol 2002;129:1341–51.
[53] Wasternack C. Jasmonates: an update on biosynthesis, signal transduction andaction in plant stress responses, growth and development. Ann Bot2007;100:681–97.
[54] Lamb CJ, Lawton MA, Dron M, Dixon RA. Signals and transduction mecha-nisms for activation of plant defenses against microbial attack. Cell1989;56:215–24.
[55] Kobayashi I, Hakuno H. Actin-related defense mechanism to reject penetrationattempt by a non-pathogen is maintained in tobacco BY-2 cells. Planta2003;217:340–5.
[56] McCurdy DW, Kovar DR, Staiger CJ. Actin and actin-binding proteins in higherplants. Protoplasma 2001;215:89–104.
[57] Schutz I, Gus-Mayer S, Schmelzer E. Profilin and Rop GTPases are localized atinfection sites of plant cells. Protoplasma 2006;227:229–35.
[58] Shen G, Adam Z, Zhang H. The E3 ligase AtCHIP ubiquitylates FtsH1,a component of the chloroplast FtsH protease, and affects protein degradationin chloroplasts. Plant J 2007;52:309–21.
[59] Innes R. New effects of type III effectors. Mol Microbiol 2003;50:363–5.[60] Kim CY, Koo YD, Jin JB, Moon BC, Kang CH, Kim ST, et al. Rice C2-domain
proteins are induced and translocated to the plasma membrane in response toa fungal elicitor. Biochemistry 2003;42:11625–33.
[61] Sandrock RW, VanEtten HD. Fungal sensitivity to and enzymatic degradationof the phytoanticipin a-tomatine. Phytopathology 1998;88:137–43.
[62] Oh S-K, Lee S, Chung E, Park JM, Yu SH, Ryu C-M, et al. Insight into Types I andII nonhost resistance using expression patterns of defense-related genes intobacco. Planta 2006;223(1):101–7.
[63] Kodama M, Wada H, Otani H, Kohmoto K, Kimura Y. 3,5-DI-O-caffeoylquinicacid, an infection-inhibiting factor from Pyrus pyrifolia induced by infectionwith Alternaria alternata. Phytochemistry 1998;47:371–3.
[64] Van Loon LC, Geraats BPJ, Linthorst HJM. Ethylene as a modulator of diseaseresistance in plants. Trends Plant Sci 2006;11:184–91.
[65] Moore T, Martineau B, Bostock RM, Lincoln JE, Gilchrist DG. Molecular andgenetic characterization of ethylene involvement in mycotoxin-induced plantcell death. Physiol Mol Plant Pathol 1999;54:73–85.
[66] Moussatos VV, Yang SF, Ward B, Gilchrist DG. AAL-toxin induced physiologicalchanges in Lycopersicon esculentum Mill:role for ethylene and pyrimidineintermediates in necrosis. Physiol Mol Plant Pathol 1994;44:455–68.
[67] Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, et al. Bacterialdisease resistance in Arabidopsis through flagellin perception. Nature2004;428:764–7.
[68] Thuerig B, Felix G, Binder A, Boller T, Tamm L. An extract of Penicilliumchrysogenum elicits early defense-related responses and induces resistance in
Arabidopsis thaliana independently of known signalling pathways. Physiol MolPlant Pathol 2006;67:180–93.
[69] Spoel SH, Johnson JS, Dong X. Regulation of tradeoffs between plant defensesagainst pathogens with different lifestyles. Proc Natl Acad Sci USA2007;104:18842–7.
[70] Gomez-Gomez L, Felix G, Boller T. A single locus determines sensitivity tobacterial flagellin in Arabidopsis thaliana. Plant J 1999;18:277–84.
M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 77