10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting...

1

Revised manuscript EC00049-13 for Eukaryotic Cell 1

2

Pressure-induced endocytic degradation of the yeast low-affinity 3

tryptophan permease Tat1 is mediated by Rsp5 ubiquitin ligase and 4

functionally redundant PPxY-motif proteins 5

6

7

Asaha Suzuki1§, Takahiro Mochizuki1§, Satoshi Uemura1, Toshiki Hiraki2 8

and Fumiyoshi Abe1,2* 9

10

1Department of Chemistry and Biological Science, College of Science and Engineering, 11

Aoyama Gakuin University, Sagamihara, Japan; 2Institute of Biogeosciences, Japan Agency 12

for Marine-Earth Science and Technology (JAMSTEC), Yokosuka, Japan 13

14

Running title: High pressure triggers degradation of Tat1. 15

16

§These authors contributed equally. 17

*Corresponding author: 18

5-10-1 Fuchinobe, Chuo-ku, Sagamihara 252-5258, Japan 19

Phone: +81-42-759-6233 20

Fax: +81-42-759-6511 21

E-mail: [email protected] 22

23

Copyright © 2013, American Society for Microbiology. All Rights Reserved.Eukaryotic Cell doi:10.1128/EC.00049-13 EC Accepts, published online ahead of print on 10 May 2013

on January 3, 2021 by guesthttp://ec.asm

.org/D

ownloaded from

http://ec.asm.org/

2

ABSTRACT 24

Cells of Saccharomyces cerevisiae express the two tryptophan permeases Tat1 and Tat2, 25

which have different characteristics in terms of their affinity for tryptophan and intracellular 26

localization. Although the high-affinity permease Tat2 has been well documented in terms of 27

its ubiquitin-dependent degradation, the low-affinity permease Tat1 has not yet been fully 28

characterized. Here we show that high hydrostatic pressure of 25 MPa triggers the 29

degradation of Tat1 which depends on Rsp5 ubiquitin ligase and an EH-domain protein End3. 30

Tat1 was resistant to 3-h cycloheximide treatment, suggesting that it is highly stable under 31

normal growth conditions. The ubiquitination of Tat1 most likely occurs at the N-terminal 32

lysines 29 and 31. Simultaneous substitution of arginine for the two lysines prevented Tat1 33

degradation but either of them alone did not, indicating that the role of lysines 29 and 31 is 34

redundant. When cells were exposed to high pressure, Tat1-GFP was completely lost from the 35

plasma membrane, while substantial amounts of Tat1K29R-K31R-GFP remained. The HPG1-1 36

(Rsp5P514T) and rsp5-ww3 mutations stabilized Tat1 under high pressure but any one of the 37

rsp5-ww1, rsp5-ww2, bul1Δbul2Δ and single deletions for genes encoding arrestin-related 38

trafficking adaptors did not. However, simultaneous loss of 9 arrestins and Bul1/Bul2 39

prevented Tat1 degradation at 25 MPa. The results suggest that multiple PPxY-motif proteins 40

share some essential roles in regulating Tat1 ubiquitination in response to high hydrostatic 41

pressure. 42

43

INTRODUCTION 44

The genome of the yeast Saccharomyces cerevisiae encodes 24 amino acid permeases and 45

their homologous proteins. These permeases consist of 12 transmembrane domains (TMDs) 46

and cytoplasmic tails and have unique characteristics in their substrate specificity, affinity, 47

capacity, and posttranslational modification (1–3). Tryptophan is hydrophobic, bulky, and one 48

of the sparsest amino acids in nutrients and nature. This leads to the concept that the 49

tryptophan uptake machinery can be evolutionarily specialized in heterotrophic organisms. In 50


.org/D

ownloaded from

http://ec.asm.org/

3

S. cerevisiae, tryptophan is imported by facilitated diffusion through Tat1 and Tat2, which are 51

the low-affinity and high-affinity tryptophan permease, respectively. TAT1 and TAT2 were 52

originally identified as genes conferring resistance to the immunosuppressive agent 53

tacrolimus (FK506) (4, 5). Because tryptophan uptake is highly sensitive to diverse 54

environmental stresses, it becomes the limiting factor for cell growth in 55

tryptophan-auxotrophic strains. Of the two permeases, Tat2 has been relatively well 56

characterized in terms of ubiquitin-dependent degradation and intracellular trafficking. In 57

response to nutrient deprivation or rapamycin treatment, Tat2 undergoes ubiquitination in a 58

manner dependent on Rsp5 ubiquitin ligase, followed by vacuolar degradation (6). 59

Appropriate delivery of Tat2 to the cell surface requires ergosterol (7, 8) and 60

glycosylphosphatidylinositol-anchored proteins (9). 61

We reported that hydrostatic pressure at nonlethal levels of 15 to 25 MPa (~150 to 250 62

kg•cm–2) or low temperature of 15 °C compromised the uptake of tryptophan and thereby 63

inhibited growth of tryptophan-auxotrophic strains (10). Overexpression of TAT2 confers the 64

ability of growth under these conditions (10). When cells were incubated under high pressure 65

or low temperature, Tat1 and Tat2 undergo vacuolar degradation in a manner dependent on 66

Rsp5 ubiquitin ligase (11, 12). High hydrostatic pressure has a profound impact on lipid 67

membranes, primarily resulting in tighter packing and restriction of acyl-chain motion in a 68

manner analogous to decreasing temperature (13–15). With increasing pressure, the 69

gel-to-liquid crystalline coexistence region is shifted toward higher temperatures by 70

approximately 22°C/100 MPa (14). In this regard, tryptophan uptake is hypersensitive to 71

reduction in membrane fluidity caused by either increasing pressure or decreasing 72

temperature. Tryptophan uptake is also sensitive to some agents such as 4-phenylbutyrate (16), 73

isoflurane (17) and phytosphingosine (18) that potentially have disturbing effects on the 74

membrane, and overexpression of TAT2 confers resistance to the agents. Accordingly, 75

hydrostatic pressure in combination with temperature is a unique parameter to elucidate the 76

function and regulation of tryptophan permeases by altering the membrane structure and 77


.org/D

ownloaded from

http://ec.asm.org/

4

lipid–protein interactions without introducing any components into the system (19, 20). 78

Although Tat1 and Tat2 are homologous with a sequence identity of 39%, they are more 79

different than might first be surmised. In the presence of a normal or high concentration of 80

tryptophan (20–40 μg•ml–1 or 200 μg•ml–1, respectively), Tat1 predominantly localizes to the 81

plasma membrane, whereas Tat2 is more abundant in endosomes and multivesicular bodies (7, 82

11). Mutations rendering growth at 25 MPa in a tryptophan-auxotrophic strain have yielded 83

HPG (high-pressure growth) 1, a semidominant allele of RSP5, occurring as a mutation in the 84

catalytic HECT (homologous to E6-AP C-terminus) domain (11). Bul1 and Bul2 are the 85

PPxY-motif proteins that bind to Rsp5 by interacting with the WW domain (21), (22). 86

Deletion of BUL1 and BUL2 causes marked stabilization of Tat2, although it has no effect on 87

Tat1 degradation (11). In the membrane flotation assay in which crude membrane extracts are 88

treated with cold Triton X-100, Tat2 is associated with detergent-soluble membranes (7, 11), 89

while Tat1 is associated with detergent-resistant membranes, so-called lipid rafts (11). Upon 90

the HPG1 mutation, Tat2 becomes associated with lipid rafts, while Tat1 remains in rafts. 91

When yeast cells are starved of nutrients, Tat2 degradation is initiated by covalent binding of 92

ubiquitin to lysine residues in the N-terminal domain (6). Substitution of arginines for the five 93

lysines prevents Tat2 from degradation. However, ubiquitin binding site of Tat1 is still 94

unknown. 95

It was shown that members of a family of arrestin-related trafficking adaptors (ARTs or 96

arrestins hereafter) mediate the ubiquitination and endocytosis of amino acid permeases such 97

as lysine permease Lyp1 (23), arginine permease Can1 (23, 24), methionine permease Mup1 98

(23), glutamate permease Dip5 (25) and Tat2 (26) in response to specific amino acids or 99

environmental stresses (see reviews: (27), (28)). The arrestins possess the PPxY motif and 100

mediate Rsp5-dependent ubiquitination of these amino acid permeases. In the case of Lyp1, 101

Art1 is required for lysine-induced endocytosis, while Art2 is required for 102

cycloheximide-induced endocytosis (23). Art3 is required for the endocytosis of Dip5 in 103

response to excess glutamate (25). Systematic analysis of 9 ART genes revealed that their 104


.org/D

ownloaded from

http://ec.asm.org/

5

simultaneous deletions block the endocytosis of Tat2 in response to excess tryptophan or 105

cycloheximide (26). While either ART1 or ART2 restores the tryptophan-induced endocytosis 106

of Tat2, ART1 does not restore cycloheximide-induced endocytosis (26). Accordingly, 107

arrestins are unlikely to be general regulators of the degradation of amino acid permeases but 108

rather participate in their signal-dependent endocytosis. 109

In this paper, we show that lysine residues 29 and 31 in the N-terminal domain are 110

required for Tat1 ubiquitination, which depends on Rsp5, and one of the two lysines is 111

sufficient for degradation in response to increased hydrostatic pressure. We also show that 112

pressure-induced Tat1 ubiquitination is mediated by functionally redundant multiple 113

PPxY-motif proteins including the arrestins and Bul1/Bul2. For simplicity, ‘ART’ is used as a 114

synonym for yeast arrestin genes except for ‘9-arrestin’ to note simultaneous deletions of 115

ART1, ART2, ART3, ART4, ART5, ART6, ART7, ART8 and ART10 (26). 116

117

MATERIALS AND METHODS 118

Yeast strains and culture conditions 119

Strains used in this study are listed in Table 1. Strains EN60 and EN67 are kind gifts from H. 120

R. B. Pelham of MRC laboratory of Molecular Biology (26). Cells were grown at 25 °C with 121

shaking in synthetic complete (SC) medium with slight modification (tryptophan 40 μg/mL; 122

leucine 90 μg/mL; valine was eliminated; Ref. 11). High-pressure cultivation of the cells was 123

carried out as described previously (10, 11). Other materials are laboratory stocks (29, 30). 124

125

Construction of plasmids 126

PCR-based site-directed mutagenesis was performed to create one or multiple 127

lysine-to-arginine (K>R) substitutions in the Tat1 N-terminal domain using a QuikChange II 128

site-directed mutagenesis kit (Agilent Technologies Inc., Santa Clara, CA, USA) or 129

PrimerSTAR mutagenesis basal kit (TaKaRa Bio Inc., Otsu, Shiga, Japan). Relevant primers 130

and p3HA-TAT1c (3HA-tagged TAT1 driven by its own promoter in YCplac33 (URA3 CEN4) 131


.org/D

ownloaded from

http://ec.asm.org/

6

as a template were used for PCR amplification (11). The appropriate base substitution was 132

confirmed by sequencing the entire region of the TAT1 open reading frame (ORF) using the 133

relevant sequence primers. 134

Plasmids containing TAT1-13c-Myc-GFP (simply denoted TAT1-GFP hereafter) and its 135

mutant forms driven by the TAT1 own promoter were constructed as follows. pSCU709 136

(GAL1 promoter-13c-Myc-GFP-CYC1 terminator, URA3, 2 μ, a kind gift from T. Ushimaru of 137

Shizuoka University) was used to generate a plasmid containing TAT1-13c-Myc-GFP (simply 138

denoted TAT1-GFP hereafter). pSCU709 was digested with SacI and BamHI to remove the 139

GAL1 promoter from the plasmid. The TAT1 ORF and its own promoter region were 140

amplified by PCR using pTAT1c as a template and 141

GGGAACAAAAGCTGGAGCTCCATCCTTGTTTAAGTAAACCATTTATGT and 142

TTAATTAACCCGGGGGATCCGCACCAGAAATTGGTCATCCTCTTAAAA as primers 143

(sequences complementary to the ends of the digested plasmid are underlined). The linearized 144

plasmid and the PCR product were introduced into strain YPH499 to generate 145

pSCU709-TAT1-GFP in cells based on homologous recombination. The plasmid was isolated, 146

and the entire TAT1 ORF was sequenced. The KpnI sites are located at the 313–318th position 147

of the TAT1 ORF and its 3' downstream region in YCplac33. pSCU709-TAT1-GFP was 148

digested with KpnI to obtain a fragment containing TAT1-GFP lacking the first 315 149

nucleotides of the ORF. It was fused to the longer fragment either from p3HA-TAT1c or 150

p3HA-TAT1-K29R-K31Rc digested with KpnI to give p3HA-TAT1-GFPc (3HA-tagged 151

TAT1-GFP driven by its own promoter, URA3 CEN4) or p3HA-TAT1-K29R-K31R-GFPc 152

(3HA-tagged TAT1-K29R-K31R-GFP driven by its own promoter, URA3, CEN4), 153

respectively. 154

155

Construction of mutant strains 156

PCR-based gene disruption was performed on the wild-type strain YPH499 to create the 157

end3Δ::URA� using primers 158


.org/D

ownloaded from

http://ec.asm.org/

7

5’-ATGCCCAAGTTGGAACAATTTGAAATAAAAAAATACTGGCAAATCTTCTCGGGT159

TTGAAAAATTCAATTCATCATTTTTT-3’ and 160

5’-TCAATTGATTTCTGCTTGTAATGCTTGCAATTCGTGTCTCTTATTGTTCAAGTAAT161

TCTCTGGATTAGTCTCATCCTTCA-3’ (sequences complementary to YEplac195 are 162

underlined) and YEplac195 as a template. It was also performed to create art1Δ::KanMX, 163

art2Δ::KanMX, art3Δ::KanMX, art4Δ::KanMX, art5Δ::KanMX, art6Δ::KanMX, 164

art7Δ::KanMX, and art8Δ::KanMX, using relevant primers (20-mer oligonucleotides 165

upstream and downstream of individual open reading frames) and the genome DNA from the 166

corresponding deletion strains of the EUROSCARF yeast deletion library (cat. no. 95400.H3, 167

Invitrogen, Carlsbad, CA, USA) as templates. 168

The point mutations rsp5-ww1 (W257G) and rsp5-ww2 (W359G) were introduced into 169

the YPH499 genome as described previously for the rsp5-ww3 (W451G) mutant (31) by 170

replacing RSP5 in the genome with RSP5 containing the rsp5-ww1 or the rsp5-ww2 mutation. 171

Each GGG>CCC base substituion was created in plasmid pFA499c that contained RSP5 172

driven by its own promoter (11) using the QuikChange II site-directed mutagenesis kit and 173

primers for rsp5-ww1 (5'-CACAAGGACTACCACTGGGAAACGTCCAACGC-3' and 174

5'-GCGTTGGACGTTTCCCAGTGGTAGTCCTTGTG-3'; the mutation sites are underlined), 175

and rsp5-ww2 (5'-CTAGAACAACCACTGGGGTGGATCCAAGGAGAC-3' and 176

5'-GTCTCCTTGGATCCACCCCAGTGGTTGTTCTAG-3'; the mutation sites are 177

underlined). The resulting rsp5-ww1 or rsp5-ww2 DNA fragment was introduced into plasmid 178

YIplac211 (URA3) to transform strain YPH499. Multiple Ura3+ transformants were incubated 179

in YPD medium overnight, and the cells were spread on SD plates containing uracil and 0.1% 180

5-fluoroorotic acid. Multiple colonies were isolated, and the rsp5-ww1 and rsp5-ww2 181

mutations of the clones were confirmed by DNA sequencing of the genome locus using the 182

relevant primers. 183

184

Western blotting 185

Exponentially growing cells (1.0–1.5 × 107 cells•ml–1) were collected by centrifugation, and 186

whole-cell extracts were prepared for Western blotting as described previously (11). To avoid 187

the non-specific removal of ubiquitin from ubiquitinated Tat1, PR-619, a non-selective 188


.org/D

ownloaded from

http://ec.asm.org/

8

cell-permeable inhibitor of ubiquitin isopeptidases (LifeSensors, Malvern, PA, USA), was 189

added to the cells at 20 μM during the preparation of the whole cell extracts. The extracts 190

were subjected to centrifugation at 13,000 × g for 10 min to yield the P13 membranes. The 191

supernatants were subjected to centrifugation at 100,000 × g for 30 min to yield the P100 192

membranes. Antibodies were used for HA (16B12, BabCO, Richmond, CA, USA), Adh1 193

(Rockland antibodies and assays, Gilbersville, PA, USA), Pma1 (EnCor Biotechnology Inc., 194

Gainesville, FL, USA) and Dpm1 (5C5A7, Life Technologies Corp., Carlsbad, CA, USA). 195

Adh1 and Pma1 were used as loading controls for the whole cell extracts and the P13 196

membranes, respectively. Dpm1 was used as a loading control for both P13 and P100 197

membranes. The signals were detected in an ImageQuant LAS4000 mini (GE Healthcare Life 198

Sciences, Piscataway, NJ, USA). 199

200

Fluorescence microscopy 201

Cells expressing GFP-tagged Tat1 proteins were imaged on a fluorescence microscope model 202

IX70 (Olympus, Co. Ltd., Tokyo, Japan). 203

204

RESULTS 205

Tat1 undergoes endocytic degradation in response to high pressure 206

Our previous study showed that Tat1 undergoes Rsp5-dependent degradation in response to 207

high hydrostatic pressure (11). We first compared the Tat1 degradation between cells with 208

high-pressure treatment and cycloheximide treatment. Whole-cell extracts for Western 209

blotting were prepared from cells after exposure to pressure of 25 MPa or cycloheximide (100 210

μg/mL at 0.1 MPa) for 3 h. We found that Tat1 was highly stable without a significant 211

decrease in its level after 3-h cycloheximide treatment. In contrast, Tat1 was decreased 212

considerably after high-pressure treatment for 3 h. A control protein, Adh1, was not degraded 213

after the cycloheximide- or high-pressure treatment. The result suggests that high pressure 214

promotes the degradation of Tat1 (Fig. 1A). Some higher molecular-weight bands were 215


.org/D

ownloaded from

http://ec.asm.org/

9

detected above the main Tat1 band upon overexposure in signal detection (Fig. 1A, 216

arrowheads, see below). 217

To eliminate the possibility that the decrease in Tat1 under these conditions could be 218

attributed to any non-physiological causes, e.g., mechanical pinching off due to perturbation 219

of the membrane by high pressure, we examined whether Tat1 was maintained in the 220

endocytosis-deficient end3Δ mutant at 25 MPa. We also extended the analysis by 221

fractionating the membranes. As demonstrated previously, Tat1 was predominantly localized 222

in the P13 membranes in which the plasma membrane was enriched. Small amounts of Tat1 in 223

the P100 membranes are likely to be associated with endosomes. The end3Δ mutation reduced 224

Tat1 from the P100 membranes. When pressure of 25 MPa was applied to the end3Δ cells, 225

substantial amounts of Tat1 remained in the P13 membranes, while it was reduced from the 226

P13 membranes in the wild-type cells (Fig. 1B). A non-ubiquitinated control protein, Pma1, 227

remained unchanged in the wild-type and the end3Δ cells upon the high-pressure treatment. 228

These results suggest that high pressure enhances the ubiquitination and/or endocytosis of 229

Tat1. It is unlikely that high pressure generally promotes ubiquitination/endocytosis of 230

membrane proteins because the rate of Tat2 degradation is much more rapid with 231

cycloheximide treatment (~30 min) (31) than with high-pressure treatment (> 2 h) (11). It is 232

known that excess amounts of tryptophan in medium induces the degradation of Tat2 (7). 233

However, the Tat1 level remained almost unchanged when cells were cultured with various 234

concentrations of tryptophan (4–200 μg/mL) (our unpublished observation). Therefore, we 235

assume that the cells specifically respond to changes in hydrostatic pressure and downregulate 236

Tat1 in a manner dependent on Rsp5-mediated ubiquitination and endocytosis. 237

238

Lysine residues 29 and 31 are targets of Tat1 ubiquitination 239

We next determined the target lysine(s) for ubiquitination of Tat1 in its N-terminal domain. 240

According to HMMTOP (http://www.enzim.hu/hmmtop/), a program for transmembrane helix 241

prediction (32, 33), the cytoplasmic N-terminal domain of Tat1 is composed of 99 amino 242


.org/D

ownloaded from

http://ec.asm.org/

10

acids in which 11 lysine residues are located. We created K>R substitutions with various 243

combinations in the N-terminal domain to determine lysine residues prerequisite for 244

degradation of Tat1. In the process of substituting arginines for all of the 11 lysines, we first 245

obtained 16 plasmids expressing the Tat1 K>R variants (Table 2, p3HA-TAT1-AS1c to 246

AS16c). Whole-cell extracts were prepared from the plasmid-bearing cells for Western blot 247

analysis. The quantity of variant Tat1 proteins was almost the same as the wild-type Tat1 (Fig. 248

2A). We found that at least two higher molecular-weight bands with additional masses of 8 249

and 16 kDa appeared above the main wild-type Tat1 band (Fig. 2A, arrowheads). They 250

probably correspond to mono- and diubiquitinated forms of Tat1, respectively. These two 251

higher molecular-weight bands were much weaker in cells harboring the variant TAT1 252

plasmids AS5, AS6, AS7, AS8, AS9, AS10, and AS11 (Fig. 2A). Accordingly, two lysines 253

among those at positions 10, 29, 31, 39, 56, and 71 can be the ubiquitination targets. We next 254

created single and double K>R variants to determine ubiquitin acceptors in the N-terminal 255

domain. Simultaneous K29R and K31R substitution (K29R-K31R) and 11K>R substitution 256

resulted in the complete loss of the higher molecular-weight bands, but that of K39R and 257

K56R (K39R-K56R) did not (Fig. 2B). In our preliminary experiment, we confirmed the 258

ubiquitin conjugation at these two lysines by performing immunoprecipitation of Tat1 and its 259

mutant forms in cells co-expressing c-Myc-tagged ubiquitin, followed by the detection of 260

covalently bound ubiquitin molecules with c-Myc antibody. c-Myc ubiquitin was detected in 261

Tat1 but not in Tat1K29R-K31R and Tat111K>R (data not shown). These results suggest that K29 262

and K31 are target lysines for Rsp5-dependent ubiquitination. In the process of this analysis, 263

we noticed that the appearance of the higher molecular-weight bands in the single K>R 264

substitutions, K10R, K29R, K31R, K39R, and K56R, varied with experiments. This implies 265

that ubiquitination of Tat1 potentially occurs on lysines other than K29 and K31. However, 266

we show below that K29 and K31 are crucial for pressure-induced degradation of Tat1. 267

268

Ubiquitination of either lysine 29 or 31 is sufficient for pressure-induced degradation of 269


.org/D

ownloaded from

http://ec.asm.org/

11

Tat1 270

We next examined whether K29 and K31 were required for pressure-induced Tat1 degradation. 271

While substantial decrease was observed in wild-type Tat1, Tat1K10R, Tat1K29R, Tat1K31R, 272

Tat1K39R, Tat1K56R, and Tat1K39R-K56R, the amount of Tat1K29R-K31R, Tat1K10R-K29R-K31R and 273

Tat111K>R remained almost unchanged after the cells were exposed to high pressure for 3 h 274

(Fig. 2C). The result indicates that either K29 or K31 is required for pressure-induced Tat1 275

degradation. 276

To examine whether the K29R-K31R substitution altered the intracellular localization of 277

Tat1, GFP-tagged Tat1 was expressed in the cell. Tat1-GFP predominantly localized to the 278

plasma membrane (Fig. 3). There was no marked difference in the plasma membrane 279

localization between Tat1-GFP and Tat1K29R-K31R-GFP at 0.1 MPa (Fig. 3). When cells were 280

exposed to pressure of 25 MPa for 3 h, Tat1-GFP was completely lost from the plasma 281

membrane and transported to the vacuole for degradation. In contrast, substantial amounts of 282

Tat1K29R-K31R-GFP remained in the plasma membrane under the same condition (Fig. 3). 283

Interestingly, the vacuoles were also GFP positive in cells expressing Tat1K29R-K31R-GFP. This 284

result suggests that high hydrostatic pressure enhances the vacuolar sorting of newly 285

synthesized Tat1 from the Golgi apparatus to the vacuole in a manner independent of K29- 286

and K31-linked ubiquitination as well as sorting of Tat1 that preexists in the plasma 287

membrane in a manner dependent on K29 and K31. 288

289

Pressure-induced endocytic degradation of Tat1 redundantly depends on PPxY-motif 290

proteins 291

Pressure-induced Tat1 degradation is prevented by the HPG1 mutation (e.g., HPG1-1, 292

Rsp5P514T) but not by bul1Δbul2Δ (Fig. 4A, Ref. 11). The dispensability of Bul1 and Bul2 is 293

in sharp contrast to Tat2 degradation in which Bul1 is strictly required (7, 11). This implies 294

that PPxY proteins other than Bul1 and Bul2 mediate Rsp5-dependent ubiquitination of Tat1. 295

We first analyzed the effect of rsp5-ww mutations on pressure-induced Tat1 degradation. The 296


.org/D

ownloaded from

http://ec.asm.org/

12

base substitutions were introduced in the genome of strain YPH499 to create the rsp5-ww1 297

(W257G), rsp5-ww2 (W359G) and rsp5-ww3 (W451G) mutations. We found that Tat1 was 298

similarly degraded in the rsp5-ww1 and rsp5-ww2 mutants as in the wild-type strain, although 299

certain amounts remained in the rsp5-ww3 mutant (Fig. 4A). This suggests that other PPxY 300

proteins mediate Tat1 ubiquitination through the interaction with the Rsp5 WW3 domain but 301

probably partially redundant with other Rsp5 WW domains in response to high pressure. This 302

prompted us to screen for the yeast arrestins. 303

Next, we created single deletions of ART1 to ART8 in the YPH499 genome. ART9 304

deletion was not performed because Art9 does not have the canonical PPxY motif. ART10 305

deletion in the YPH499 genome has not been successful for unknown reasons. We found that 306

none of the single deletions of ART genes prevented Tat1 degradation at 25 MPa, suggesting 307

that the role of the arrestins is redundant (Fig. 4B). Simultaneous deletions of ART1, ART2, 308

ART3, ART4, ART5, ART6, ART7, ART8 and ART10 (9-arrestin; Ref. 26) slightly prevented 309

Tat1 degradation, and combined 9-arrestin and bul1Δbul2Δ substantially but not fully 310

stabilized Tat1 at 25 MPa (Fig. 4C). This in turn suggests that 9 arrestins and Bul1/Bul2, and 311

possibly other proteins, share some essential functions in regulating Tat1 ubiquitination 312

through the interaction with Rsp5. However, we cannot rule out the possibility that the 313

simultaneous loss of the 11 PPxY proteins indirectly causes the stabilization of Tat1 by 314

exerting effects on any downstream proteins involved in the endocytic degradation of Tat1. 315

Analysis of the 9-arrestin bul1Δbul2Δ mutant with BUL1 or BUL2 on the plasmid would 316

clarify which alternative is responsible for pressure-induced Tat1 degradation when Art 317

proteins are absent. Unlike the observation by Nikko and Pelham (26), the 9-arrestin 318

bul1Δbul2Δ mutant did not exhibit slow growth under normal culture conditions when using 319

our modified SC medium (see Materials and Methods). 320

321

DISCUSSION 322

Endocytic degradation of Tat1 in response to high pressure 323


.org/D

ownloaded from

http://ec.asm.org/

13

The present study demonstrated that high hydrostatic pressure triggers the degradation of Tat1 324

in a manner dependent on ubiquitination and subsequent endocytosis. Under normal growth 325

conditions, the low-affinity tryptophan permease Tat1 is highly stable with a half-life much 326

longer than the doubling time of proliferating cells (>> 3 h), as opposed to the rapid turnover 327

of the high-affinity tryptophan permease Tat2 (~ 30 min) (31). Tat1 is insensitive to 328

cycloheximide or varied concentrations of tryptophan in culture medium (our unpublished 329

observation), while Tat2 undergoes rapid degradation in response to excess tryptophan and 330

cycloheximide (7, 26). Therefore, the ubiquitination machinery may specifically perform 331

quality control of Tat1 when cells are exposed to non-lethal levels of hydrostatic pressure. 332

Pressure-induced Tat1 degradation requires one of the N-terminal lysine residues 29 and 31, 333

and simultaneous K29R-K31R substitution results in the marked stabilization of Tat1. 334

According to the protein mobility on SDS-PAGE, the two higher molecular-weight bands 335

appeared to be attributed to the mono- and double monoubiquitinated forms of Tat1 at 336

positions 29 and/or 31. 337

338

Regulation of Tat1 degradation mediated by multiple PPxY-motif proteins 339

We showed that the WW3 domain of Rsp5 was important but probably redundant with other 340

WW domains for pressure-induced degradation of Tat1. In fact, many proteins can bind two 341

of three WW domain of Rsp5 (34). In contrast to the requirement for specific arrestins for the 342

degradation of Can1, Lyp1, Itr1, Dip5 or Jen1, 9 arrestins and Bul1/Bul2 redundantly regulate 343

Tat1 degradation. Furthermore, the fact that Tat1 was not fully stabilized in the 9-arrestin 344

bul1Δbu2Δ mutant at high pressure suggests the presence of additional PPxY-motif proteins 345

that play a role in Tat1 degradation in response to high pressure. This is similar to the uracil 346

permease Fur4 with respect to the redundancy of 9 arrestins and Bul1 for vacuolar 347

degradation after the addition of uracil or cycloheximide (26). It was reported that Art1 and 348

Art2 effectively complement the 9-arrestin bul1Δ strain in Fur4 degradation, although Art8 349

showed weaker activity (26). The degradation of Tat2 is also blocked in the rsp5-ww3 mutant 350


.org/D

ownloaded from

http://ec.asm.org/

14

and the bul1Δ strain. Art1 and Art2 restore Tat2 degradation in the 9-arrestin mutant with 351

excess tryptophan, whereas Art8 partially restores it with cycloheximide treatment (26). 352

Nikko and Pelham mentioned a scheme of transporter regulation in which specificity is 353

provided by arrestin interactions that promote endocytosis, and this is followed by further, 354

relatively non-specific ubiquitination in endosomes (26). It is still unclear how the 355

functionally redundant PPxY-motif proteins recognize Tat1 specifically after cells are exposed 356

to high pressure. One possible explanation is that high pressure may perturb the structure of 357

the raft domain, leading to the release of Tat1 from the rafts to non-rafts and thus enhancing 358

the endocytosis of Tat1 for degradation. In the case of Can1, the addition of arginine releases 359

Can1 from the raft domain, followed by endocytic degradation (35). In this regard, the 360

structural instability of Tat1 within the unfavorable non-raft environments could provide an 361

opportunity to expose the hydrophobic TMD peptides of Tat1 to the cytoplasm, and thereby a 362

broad range of arrestins might become capable of interacting with the hypothetically 363

denatured forms of Tat1 through hydrophobic interactions. In this sense, the ubiquitin system 364

would differentiate dysfunctional membrane proteins from intact ones through the function of 365

arrestins. It would be worthwhile elucidating whether high pressure disrupts the raft structure 366

mechanically or blocks delivery of raft components such ergosterol and sphingolipids to the 367

plasma membrane, and whether Tat1 can be released from the rafts. 368

A recent key finding on the nutrient-sensing pathway is that TORC1 controls nutrient 369

uptake by targeting the ubiquitin-mediated endocytosis of specific amino acid permeases. 370

Endocytic downregulation of Can1 is promoted by cycloheximide, and this effect is abrogated 371

by treatment of the cells with rapamycin, a TORC1 inhibitor (24). Cycloheximide also 372

triggers the endocytosis of Mup1, and rapamycin abrogates the effect. However, rapamaycin 373

does not affect the methionine-induced endocytosis of Mup1. Thus, TORC1 signaling 374

promotes the endocytosis of multiple cell surface proteins as a general mechanism to limit 375

protein abundance at the plasma membrane. In the presence of nutrients, TORC1 kinase 376

inactivates a downstream kinase Npr1 by phosphorylation. In this situation, the Rsp5-Art1 377


.org/D

ownloaded from

http://ec.asm.org/

15

complex is translocated to the plasma membrane to ubiquitinate Can1 (24). Starvation or 378

rapamycin treatment inhibits TORC1, which in turn activates Npr1 by dephosphorylation. The 379

activated Npr1 is translocated to the plasma membrane and phosphorylates Art1. Then, 380

Rsp5-Art1 is dissociated from the plasma membrane, and hence Can1 ubiquitination does not 381

occur (24). 382

TORC1 also controls nitrogen-induced Gap endocytosis in a manner dependent on Npr1 383

and the 14-3-3 proteins (36). Under nitrogen-poor conditions, Bul1 and Bul2 are 384

phosphorylated in an Npr1-dependent manner and bind to the 14-3-3 proteins, which inhibit 385

the capacity of Bul proteins to induce Gap1 ubiquitination. Upon the addition of ammonium 386

ions, Bul proteins are dephosphorylated, concomitantly dissociated from the 14-3-3 proteins, 387

and then ubiquitinated by Rsp5 (36). The PPxY and arrestin motif of Bul proteins are required 388

for ammonium-induced ubiquitination of Gap1. The role of Bul proteins in Gap1 389

ubiquitination is in sharp contrast to their dispensability in pressure-induced Tat1 degradation. 390

It is known that the 14-3-3 proteins and Rod1/Art4 coordinately regulate ubiquitination of 391

lactate transporter Jen1 (37). Whether the pressure-induced Tat1 degradation also involves 392

phosphorylation/dephosphorylation of any arrestins is unknown. 393

It is evident that there are considerable differences in the way plasma membrane 394

transporters are regulated through the functions of PPxY-motif proteins and Rsp5 in response 395

to a broad range of environmental cues. A specific distinction that sets hydrostatic pressure 396

apart from other cues, such as nutrients, salt, urea, or organic solvents, is that pressure merely 397

changes the equilibria among preexisting components depending on the magnitude of volume 398

changes (38, 39). Thus, hydrostatic pressure can bring minor elements out of the background 399

noise and into the foreground for direct observation and study. In this sense, ubiquitination 400

and/or endocytosis of Tat1 occur at an extremely slow rate under normal growth conditions at 401

atmospheric pressure but it becomes possible to analyze them at high hydrostatic pressures, 402

probably because the rate-limiting step in the degradation of Tat1 is accompanied by a large 403

negative volume change. 404


.org/D

ownloaded from

http://ec.asm.org/

16

405

ACKNOWLEDGEMENTS 406

We thank Hugh R. B. Pelham for providing yeast strains; Takashi Ushimaru for GFP 407

plasmids; Yoichi Noda for valuable suggestions; Hiroki Deguchi and Mai Nagata for technical 408

assistances. This work was supported by a grant from the Japan Society for the Promotion of 409

Science (No. 22658031 to F. Abe). 410

411

REFERENCES 412

413

1. Nelissen B, De Wachter R, Goffeau A. 1997. Classification of all putative permeases and 414

other membrane plurispanners of the major facilitator superfamily encoded by the 415

complete genome of Saccharomyces cerevisiae. FEMS Microbiol. Rev. 21: 113-134. 416

2. Sophianopoulou V, Diallinas G. 1995. Amino acid transporters of lower eukaryotes: 417

Regulation, structure and topogenesis. FEMS Microbiol. Rev. 16: 53-75. 418

3. Lauwers E, Erpapazoglou Z, Haguenauer-Tsapis R, Andre B. 2010. The ubiquitin code 419

of yeast permease trafficking. Trends Cell Biol. 20: 196-204. 420

4. Heitman J, Koller A, Kunz J, Henriquez R, Schmidt A, Movva NR, Hall MN. 1993. 421

The immunosuppressant FK506 inhibits amino acid import in Saccharomyces cerevisiae.. 422

Mol. Cell. Biol.13: 5010-5019. 423

5. Schmidt A, Beck T, Koller A, Kunz J, Hall MN. 1998. The TOR nutrient signalling 424

pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease. EMBO J. 425

17: 6924-6931. 426

6. Beck T, Schmidt A, Hall MN. 1999. Starvation induces vacuolar targeting and degradation 427

of the tryptophan permease in yeast. J. Cell Biol. 146: 1227-1238. 428

7. Umebayashi K, Nakano A. 2003. Ergosterol is required for targeting of tryptophan 429

permease to the yeast plasma membrane. J. Cell Biol.161: 1117-1131. 430

8. Daicho K, Makino N, Hiraki T, Ueno M, Uritani M, Abe F, Ushimaru T. 2009. Sorting 431

defects of the tryptophan permease Tat2 in an erg2 yeast mutant. FEMS Microbiol. Lett. 432

298: 218-227. 433

9. Okamoto M, Yoko-o T, Umemura M, Nakayama K, Jigami Y. 2006. 434

Glycosylphosphatidylinositol-anchored proteins are required for the transport of 435

detergent-resistant microdomain-associated membrane proteins Tat2p and Fur4p. J. Biol. 436


.org/D

ownloaded from

http://ec.asm.org/

17

Chem. 281: 4013-4023. 437

10. Abe F, Horikoshi K. 2000. Tryptophan permease gene TAT2 confers high-pressure 438

growth in Saccharomyces cerevisiae.. Mol. Cell. Biol. 20: 8093-8102. 439

11. Abe F, Iida H. 2003. Pressure-induced differential regulation of the two tryptophan 440

permeases Tat1 and Tat2 by ubiquitin ligase Rsp5 and its binding proteins, Bul1 and Bul2. 441

Mol. Cell. Biol. 23: 7566-7584. 442

12. Nagayama A, Kato C, Abe F. 2004. The N- and C-terminal mutations in tryptophan 443

permease Tat2 confer cell growth in Saccharomyces cerevisiae. under high-pressure and 444

low-temperature conditions. Extremophiles 8: 143-149. 445

13. Winter R. 2002. Synchrotron X-ray and neutron small-angle scattering of lyotropic lipid 446

mesophases, model biomembranes and proteins in solution at high pressure. Biochim. 447

Biophys. Acta 1595: 160-184. 448

14. Winter R, Dzwolak W. 2005. Exploring the temperature-pressure configurational 449

landscape of biomolecules: From lipid membranes to proteins. Philos. Transact A. Math. 450

Phys. Eng. Sci. 363: 537-62; discussion 562-563. 451

15. Matsuki H, Goto M, Tada K, Tamai N. 2013. Thermotropic and barotropic phase 452

behavior of phosphatidylcholine bilayers. Int. J. Mol. Sci. 14: 2282-2302. 453

16. Liu M, Brusilow WS, Needleman R. 2004. Activity of the yeast Tat2p tryptophan 454

permease is sensitive to the anti-tumor agent 4-phenylbutyrate. Curr. Genet. 46: 256-268. 455

17. Palmer LK, Wolfe D, Keeley JL, Keil RL. 2002. Volatile anesthetics affect nutrient 456

availability in yeast. Genetics 161: 563-574. 457

18. Skrzypek MS, Nagiec MM, Lester RL, Dickson RC. 1998. Inhibition of amino acid 458

transport by sphingoid long chain bases in Saccharomyces cerevisiae. J. Biol. Chem. 273: 459

2829-2834. 460

19. Abe F. 2004. Piezophysiology of yeast: Occurrence and significance. Cell. Mol. Biol. 461

(Noisy-le-grand) 50: 437-445. 462

20. Abe F. 2007. Exploration of the effects of high hydrostatic pressure on microbial growth, 463

physiology and survival: Perspectives from piezophysiology. Biosci. Biotechnol. 464

Biochem.71: 2347-2357. 465

21. Yashiroda H, Oguchi T, Yasuda Y, Toh-E A, Kikuchi Y. 1996. Bul1, a new protein that 466

binds to the Rsp5 ubiquitin ligase in Saccharomyces cerevisiae. Mol. Cell. Biol.16: 467

3255-3263. 468

22. Yashiroda H, Kaida D, Toh-e A, Kikuchi Y. 1998. The PY-motif of Bul1 protein is 469


.org/D

ownloaded from

http://ec.asm.org/

18

essential for growth of Saccharomyces cerevisiae under various stress conditions. Gene 470

225: 39-46. 471

23. Lin CH, MacGurn JA, Chu T, Stefan CJ, Emr SD. 2008. Arrestin-related 472

ubiquitin-ligase adaptors regulate endocytosis and protein turnover at the cell surface. Cell 473

135: 714-725. 474

24. MacGurn JA, Hsu PC, Smolka MB, Emr SD. 2011. TORC1 regulates endocytosis via 475

Npr1-mediated phosphoinhibition of a ubiquitin ligase adaptor. Cell 147: 1104-1117. 476

25. Hatakeyama R, Kamiya M, Takahara T, Maeda T. 2010. Endocytosis of the aspartic 477

acid/glutamic acid transporter Dip5 is triggered by substrate-dependent recruitment of the 478

Rsp5 ubiquitin ligase via the arrestin-like protein Aly2. Mol. Cell. Biol. 30: 5598-5607. 479

26. Nikko E, Pelham HR. 2009. Arrestin-mediated endocytosis of yeast plasma membrane 480

transporters. Traffic 10: 1856-1867. 481

27. Leon S, Haguenauer-Tsapis R. 2009. Ubiquitin ligase adaptors: Regulators of 482

ubiquitylation and endocytosis of plasma membrane proteins. Exp. Cell Res. 315: 483

1574-1583. 484

28. Becuwe M, Herrador A, Haguenauer-Tsapis R, Vincent O, Leon S. 2012. 485

Ubiquitin-mediated regulation of endocytosis by proteins of the arrestin family. Biochem. 486

Res. Int. 2012: 242764. 487

29. Sikorski RS, Hieter P. 1989. A system of shuttle vectors and yeast host strains designed 488

for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27. 489

30. Gietz RD, Sugino A. 1988. New yeast-escherichia coli shuttle vectors constructed with in 490

vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74: 527-534. 491

31. Hiraki T, Abe F. 2010. Overexpression of Sna3 stabilizes tryptophan permease Tat2, 492

potentially competing for the WW domain of Rsp5 ubiquitin ligase with its binding protein 493

Bul1. FEBS Lett. 584: 55-60. 494

32. Tusnady GE, Simon I. 1998. Principles governing amino acid composition of integral 495

membrane proteins: Application to topology prediction. J. Mol. Biol. 283: 489-506. 496

33. Tusnady GE, Simon I. 2001. The HMMTOP transmembrane topology prediction server. 497

Bioinformatics 17: 849-850. 498

34. Hesselberth JR, Miller JP, Golob A, Stajich JE, Michaud GA, Fields S. 2006. 499

Comparative analysis of Saccharomyces cerevisiae WW domains and their interacting 500

proteins. Genome Biol.7: R30. 501

35. Grossmann G, Malinsky J, Stahlschmidt W, Loibl M, Weig-Meckl I, Frommer WB, 502


.org/D

ownloaded from

http://ec.asm.org/

19

Opekarova M, Tanner W. 2008. Plasma membrane microdomains regulate turnover of 503

transport proteins in yeast. J. Cell Biol. 183: 1075-1088. 504

36. Merhi A, Andre B. 2012. Internal amino acids promote Gap1 permease ubiquitylation via 505

TORC1/Npr1/14-3-3-dependent control of the bul arrestin-like adaptors. Mol. Cell. 506

Biol.32: 4510-4522. 507

37. Becuwe M, Vieira N, Lara D, Gomes-Rezende J, Soares-Cunha C, Casal M, 508

Haguenauer-Tsapis R, Vincent O, Paiva S, Leon S. 2012. A molecular switch on an 509

arrestin-like protein relays glucose signaling to transporter endocytosis. J. Cell Biol. 196: 510

247-259. 511

38. Balny C, Masson P, Heremans K. 2002. High pressure effects on biological 512

macromolecules: From structural changes to alteration of cellular processes. Biochim. 513

Biophys. Acta 1595: 3-10. 514

39. Lassalle MW, Akasaka K. 2007. The use of high-pressure nuclear magnetic resonance to 515

study protein folding. Methods Mol. Biol. 350: 21-38. 516

517

518


.org/D

ownloaded from

http://ec.asm.org/

20

FIGURE LEGENDS 519

FIG. 1. Endocytotic degradation of Tat1 in response to high pressure. (A) The wild-type 520

cells were exposed to cycloheximide (CHX, 100 μg/mL) or pressure of 25 MPa (HP) for 3 h. 521

The whole cell extracts were prepared for Western blotting analysis using anti-HA antibody to 522

detect the 3HA-Tat1 proteins. Relative amounts of 3HA-Tat1 to Adh1 were calculated from 523

the signals detected in an ImageQuant LAS4000 mini. Arrowheads denote the higher 524

molecular-weight bands of 3HA-Tat1. (B) The wild-type and the end3Δ cells were exposed to 525

pressure of 25 MPa for 3 h. The P13 and P100 membranes were collected from the whole cell 526

extracts (W) by differential centrifugation. Adh1 and Pma1 were used as loading controls for 527

the whole cell extracts and the P13 membranes, respectively. Dpm1 was used as a loading 528

control for both P13 and P100 membranes. 529

530

FIG. 2. Determination of lysine residues required for ubiquitin-dependent Tat1 degradation. 531

The 3HA-Tat1 proteins with multiple (A) or single or double (B) K>R substitutions were 532

visualized by Western blotting analysis using anti-HA antibody. The AS numbers are listed in 533

Table 2. Asterisks denote plasmids containing either the K29R or K31R substitution (*) or 534

both K29R and K31R substitutions (**). Arrowheads denote the higher molecular-weight 535

bands of 3HA-Tat1. (C) The wild-type cells expressing the 3HA-Tat1 proteins with single or 536

multiple K>R substitutions were exposed to pressure of 25 MPa for 3 h. The whole cell 537

extracts were prepared for Western blotting analysis to detect the variant 3HA-Tat1 proteins. 538

Adh1 was used as a loading control. 539

540

FIG. 3. Intracellular localization of Tat1 and Tat1K29R-K31R under atmospheric pressure or high 541

pressure. The wild-type cells were transformed with the centromeric plamsmid 542

p3HA-TAT1-GFPc or p3HA-TAT1-K29R-K31R-GFPc. The GFP-tagged Tat1 proteins were 543

visualized under fluorescence microscopy after the cells were incubated at 0.1 MPa or 25 544

MPa for 3 h. 545


.org/D

ownloaded from

http://ec.asm.org/

21

546

FIG. 4. The role of the Rsp5 WW domain and the multiple PPxY proteins in Tat1 degradation 547

responding to high pressure. (A) Cells of the wild-type, HPG1-1, rsp5-ww1, rsp5-ww2, 548

rsp5-ww3 and bul1Δbul2Δ strains were exposed to pressure of 25 MPa for 3 h. (B) Cells of 549

the wild-type and art single deletion mutants were exposed to pressure of 25 MPa for 3 h. (C) 550

Left, Cells of the wild-type (BY4742), 9-arrestin (EN60), and 9-arrestin bul1Δbul2Δ (EN67) 551

strains were exposed to pressure of 25 MPa for 3 h. The whole cell extracts were prepared for 552

Western blotting analysis to detect the variant 3HA-Tat1 proteins. Adh1 was used as a loading 553

control. Right, Relative amounts of 3HA-Tat1 to Adh1 were calculated from the signals 554

detected in an ImageQuant LAS4000 mini. Data are shown as mean ± standard deviation 555

from three independent experiments. 556

557


.org/D

ownloaded from

http://ec.asm.org/

Table 1. Strains used in this study

Strain Genotype Source or reference

YPH499 (Wild type) MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 29

FAM1 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 end3Δ::URA3 This study

FAY18A MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 HPG1-1 (Rsp5P514T) 11

FAJ75 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 bul1Δ::HIS3 bul2Δ::LEU2 11

FAS626 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww1 (Rsp5W257G) This study

FAS630 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww2 (Rsp5W359G) This study

FAS634 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 rsp5-ww3 (Rsp5W451G) 31

FAS510 MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 art1Δ::KanMX This study








BY4742 (Wild type) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 EUROSCARF

EN60 (9-arrestin) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8Δ art10Δ 26

EN67 (9-arrestin bul1bul2) MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8Δ art10Δ bul1Δ bul2Δ 26


.org/D

ownloaded from

http://ec.asm.org/

Table 2. Plasmids used in this study

Plasmid Description Source or reference

YCplac33 URA3 CEN4 30

YCplac111 LEU2 CEN4 30

p3HA-TAT1c 3HA-TAT1 driven by TAT1 promoter in YCplac33 11

p3HA-TAT1c-LEU 3HA-TAT1 driven by TAT1 promoter in YCplac111 This study

p3HA-TAT1-AS1c 3HA-TAT1-K10, 39R in p3HA-TAT1c This study

p3HA-TAT1-AS2c 3HA-TAT1-K10, 39, 71R in p3HA-TAT1c This study

p3HA-TAT1-AS3c 3HA-TAT1-K10, 39, 56, 71R in p3HA-TAT1c This study

p3HA-TAT1-AS4c 3HA-TAT1-K10, 39, 56, 71, 87R in p3HA-TAT1c This study

p3HA-TAT1-AS5c 3HA-TAT1-K10, 29, 31, 39, 56, 71R in p3HA-TAT1c This study

p3HA-TAT1-AS6c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87R in p3HA-TAT1c This study

p3HA-TAT1-AS7c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87, 95R in p3HA-TAT1c This study

p3HA-TAT1-AS8c 3HA-TAT1-K10, 29, 31, 39 ,56, 62, 64, 71, 87R in p3HA-TAT1c This study

p3HA-TAT1-AS9c 3HA-TAT1-K10, 29, 31, 39, 56, 71, 87, 92, 95R in p3HA-TAT1c This study

p3HA-TAT1-AS10c 3HA-TAT1-K10, 29, 31, 39, 56, 64, 71, 87, 92, 95R in p3HA-TAT1c This study

p3HA-TAT1-AS11c 3HA-TAT1-K10, 29, 31, 39, 56, 62, 64, 71, 87, 92, 95R (11K>R) in p3HA-TAT1c This study

p3HA-TAT1-AS12c 3HA-TAT1-K10R in p3HA-TAT1c This study





p3HA-TAT1-AS17c 3HA-TAT1-K39R-K56R in p3HA-TAT1c This study

p3HA-TAT1-AS18c 3HA-TAT1-K29R-K31R in p3HA-TAT1c This study

p3HA-TAT1-AS19c 3HA-TAT1-K10R-K29R-K31R in p3HA-TAT1c This study

pSCU709 13c-Myc-GFP (URA3 2 μ) Provided by T. Ushimaru

p3HA-TAT1-GFPc 3HA-TAT1-13c-Myc-GFP driven by TAT1 promoterin YCplac33 This study

p3HA-TAT1-K29R-K31R-GFPc 3HA-TAT1-K29R-K31R-13c-Myc-GFP driven by TAT1 promoter in YCplac33 This study


.org/D

ownloaded from

http://ec.asm.org/

A CHX HPA CHX HP

0 3 0 3

Tat1

Time (h)

Adh1

Tat1(over

exposure)

WT end3ΔB

(%)100 83 100 27Tat1/Adh1

W P13 P100 W P13 P100 W P13 P100 W P13 P100

0.1 MPa 25 MPa 0.1 MPa 25 MPa

WT end3ΔB

Tat1

Pma1Pma1

Dpm1

Fig. 1. Suzuki et al.


.org/D

ownloaded from

http://ec.asm.org/

ATat1(over

exposure)

Adh1

BB

Tat1(over

exposure)

Adh1

WT K10R K29R K31R K39R K56R K31R K56R K31R 11K>RK29R- K39- K29R-C K10R-

0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 Pressure(MPa)

WT K10R K29R K31R K39R K56R K31R K56R K31R 11K>R

Tat1

Adh1



.org/D

ownloaded from

http://ec.asm.org/

Tat1-GFP Tat1K29R-K31R-GFPDICGFP DICGFP

0.1 MPa

GFP DICGFP

25 MPa

DIC



.org/D

ownloaded from

http://ec.asm.org/

A HPG1-1 ww1 ww2 ww3rsp5

bul1Δbul2ΔWTP

0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25

Tat1

Pressure(MPa)

WT art1Δ art2Δ art3Δ art4Δ art5Δ art6Δ art7Δ art8ΔB

Adh1

0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25 0.1 25

T t1

Pressure(MPa)

Tat1

Adh1

WT 9-arrestin

0.1 25 0.1 25 0.1 25

9-arrestinbul1Δbul2Δ

Pressure(MPa)

C

ou

nt

(%)

Tat1

Adh1

Rel

ativ

e am

o


0.1 25 0.1 25 0.1 25

WT 9-arrestin 9-arrestinbul1Δbul2Δ

Pressure(MPa)


.org/D

ownloaded from

http://ec.asm.org/

10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting...

Documents

Transcript of 10...2013/05/08 · Bul1 and Bul2 are the 86 PPxY-motif proteins that bind to Rsp5 by interacting...