1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one...
-
Upload
arthur-morris -
Category
Documents
-
view
217 -
download
0
Transcript of 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one...
![Page 1: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/1.jpg)
1
Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and washes it away. Several billion single molecule “spots” per slide.
http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx
Last updated 10/26/11
![Page 2: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/2.jpg)
2
![Page 3: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/3.jpg)
3
1 2 3 4 5 6 7
Helicos paired end sequencing
![Page 4: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/4.jpg)
4
Helicos virtual terminatorInhibits DNA Pol once incorporated (so 1 base at a time)Cleavable via the S-S bond (reduce it)
dUTP dU-3’P,5’P
Free 3’ OH never blocked
Fluorescent tag
![Page 5: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/5.jpg)
5
Quantification of the yeast transcriptome by single-molecule sequencingLipson et al. NATURE BIOTECHNOLOGY 27: 652, 2009
Make cDNA via oligo dT
Tail 3’ end with A via terminal transferase, adding dT to terminate
Hybridize to surface-linked oligo dTs
Add Cy5-labeled special nucleotide tri-Ps + DNA Pol.Wash. Record image.
Cleave dye from incorporated nt.Wash.
Add next Cy5-labeled special nucleotide triPs (A) + DNA Pol.Wash. Record image.
Note: no amplifications or ligations
![Page 6: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/6.jpg)
6
smsDGE = digital gene expression via Helicos sequencing and countingMA = microarray data
![Page 7: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/7.jpg)
7
QPCR = quantitative PCR, real time PCR
Exponential phase
CT value
Non-exponential plateauphase
Threshold line
Bio-rad
![Page 8: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/8.jpg)
8
QPCR (Quantitative PCR)Q-RT-PCR (Quantitative reverse transcription-PCR)
Run 96 samples simultaneously
![Page 9: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/9.jpg)
9
Some data produced: Distribution of yeast transcripts
TSS = transcription start sitet.p.m. = transcripts per million
Est. copies/cell: 0.5 5 50 500
mRNA
TSS position relative to ATG
![Page 10: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/10.jpg)
10
(DNA nanoballs)
AcuI: a type IIS restriction enzyme
Complete Genomics
RCR = rolling circle replication
![Page 11: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/11.jpg)
11Rolling circle DNA synthesis (Φ29 polymerase)
![Page 12: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/12.jpg)
12
Complete Genomics
![Page 13: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/13.jpg)
13
Probes degenerate at all but one position, colored for the base at that position.
5 probe sets for positions +1 to +5 relative to anchor end
Hybridize, wash, ligate, wash,image.
Second anchor set extends 5 nt(degenerate reach). Repeat10 nt sequenced.
Repeat with anchors on the other side of the adaptor.
Repeat for the other 3 adaptors.
Total 70 nts sequenced(theor. = 80)
Complete Genomics\”CPAL
![Page 14: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/14.jpg)
14
Complete Genomics
Est. 1 billion spots (reads) per slide Lower cost200 human genomes sequencedBusiness plan: sell sequencing service, not machines
![Page 15: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/15.jpg)
15
http://www.pacificbiosciences.com
![Page 16: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/16.jpg)
16
10 zl volume seen
(1 zeptoliter = 10-21 L.)
ZMW = zero mode waveguide
One DNA Pol molecule per
ZMW
Add template and special
phospho nucleotides.
![Page 17: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/17.jpg)
17
Phospho-linked fluorescently-labeled nucleoside triphosphates
Other technologies
Cleaved when incorporated
![Page 18: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/18.jpg)
18
Excitation Emission
![Page 19: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/19.jpg)
19
![Page 20: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/20.jpg)
20
Use a circular template to get redundant reads and so more accuracy.
![Page 21: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/21.jpg)
21
Pacific Biosciences
• 50,000 ZMWs (Aug., 2011), and density may climb
• Long reads (e.g., full molecule analysis for splicing isoform)
• Direct RNA sequecning possible.
• DNA methylation detectable
![Page 22: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/22.jpg)
22
DNA methylation detection by bisulfite conversion
![Page 23: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/23.jpg)
23
Agilent SureSelect RNA Target Enrichment
Capture a subgenomic region of interest for economy and speed of sequencing:
E.g.,
the entire exome (all exons w/o introns or intergeneic regions)
hundreds of cancer genes
a particular genomic locus
Alternative: hybridize to a custom microarray.
Agilent
![Page 24: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/24.jpg)
24
Applications of “deep” sequencing
Also: definition and discovery of cis-acting regulatory motifs in DNA and RNA
![Page 25: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/25.jpg)
25
----CpG-- > ----CmpG--- > ----CmpG--- >< ---G p Cm---
Na bisulfiteHeat
cytosine
uracil
----UpG-- > ----CmpG--- >
Na bisulfiteHeat
PCR
----TpG-- ><--ApC---
----CpG-- ><--GpC---
All NON-methylated Cs changed to T
Detection of methylated C (~all in CpG dinucleotides)
DS DNA
![Page 26: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/26.jpg)
26
DEEP SEQUENCING (Next generation sequencing, High throughput sequencing, Massively parallel sequencing) applications:
Human genome re-sequencing (mutations, SNPs, haplotypes, disease associations, personalized medicine)
Tumor genome sequencing
Microbial flora sequencing (microbiome)Metagenomic sequencing (without cell culturing)
RNA sequencing (RNAseq; gene expression levels, miRNAs, lncRNAs, splicing isoforms)
Chromatin structure (ChIP-seq; histone modifications, nucleosome positioning)Epigenetic modifications (DNA CpG methylation and hydroxymethylation)
Transcription kinetics (GROseq; nascent RNA, pulse labeled RNA)
High throughput genetics (QUEPASA; cis-acting regulatory motif discovery)
Drug discovery (bar-coded organic molecule libraries)
![Page 27: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/27.jpg)
27
Ke et al, and Chasin, Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. 2011. 21: 1360-1374 ).
Order an equal mixture of all 4 bases at these 6 positions
![Page 28: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/28.jpg)
28
![Page 29: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/29.jpg)
29Rank 6-mer ESRseq score (~ -1 to +1)1 AGAAGA 1.0339 2 GAAGAT 0.9918 3 GACGTC 0.9836 4 GAAGAC 0.9642 5 TCGTCG 0.9517 6 TGAAGA 0.9434 7 CAAGAA 0.9219 8 CGTCGA 0.8853 : :4086 TAGATA -0.86094087 AGGTAG -0.87134088 CGTCGC 0.8850 4089 CTTAAA -0.87864090 CCTTTA -0.88124091 GCAAGA 0.89114092 TAGTTA -0.89334093 TCGCCG 0.91134094 CCAGCA -0.89424093 CTAGTA -0.92514094 TAGTAG -0.9383 4095 TAGGTA -0.9965 4096 CTTTTA -1.0610
Best exonic splicing enhancers
Worst exonic splicing enhancers,= best exonic splicing silencers
![Page 30: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/30.jpg)
30
Composite exon (from ~100,000)
Constitutive exons
Alternativexons
Pseudo exons
![Page 31: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/31.jpg)
3131
Experiment: 1 1 1 2 2 1+2 2 2 1 2
Sequence of 36 Quality codeCGCACTGTGCTGGAGCTCCCGGGGTTAACTCTAGAA abU^Vaa`a\aaa]aWaTNZ`aa`Q][TE[UaP_U]TACACTGTGCTGGAGCTCCCAACGGCAACTCTAGAA a`P^Wa`[`Wa^`X_X_XWVa^NSP]_]S^X_T\X^CGCACTGTGCTGGAGCTCCCATGGAGAACTCTAGAA aTa`^b``baaaa^aab^YaTQLOHIa`^a``TX]]TACACTGTGCTGGAGCTCCCCTCCCAAACTCTAGAA I_`aaaa`aaaaaaa_a_^[KZIGIGZ`U`\^P^^`CGCACTGTGCTGGAGCTCCCAATAGTAACTTTAGAA aY_\abb[T\abaaa`a`bZ[HXXIZa_`_LGMS[`TATACTGTGCTGGAGCTCCCGACGTAAACTCTAGAA aba]^aa_a]`aa]_]`XWSMFGGIPX[P]X`V_Y^TACACTGTGCTGGAGCTCCCTGGTAAAACTCTAGAA a_^a^aa`aYaaa_aY`Y_^[I]VY\`]V]R\W]VVTACACTGTGCTGGAGCTCCCAATAAAAACTCTAGAA XZababa`aZaaaaaYaYXX`baa``\\TaUa\aW`
2 nt barcode (TA or CG)
Constant regions(peculiar to our expt.)
Variable region
![Page 32: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/32.jpg)
32
Next generarion method:
Use custom oligo libraries to construct minigene libraries (40,000, up to 60 nt long):
E.g., for saturation mutagenesis to identify all exonic bases contributing to splicing (or transcription or polyadenylation, …..)
Use bar codes to detect sequences missing from the selected molecules
E.g., Nat Biotechnol. 2009 27:1173-5. High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Patwardhan RP, Lee C, Litvin O, Young DL, Pe'er D, Shendure J.
Long (200-mer) synthetic oligo library
![Page 33: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/33.jpg)
3333OUTLINE OF NEXT LECTURE TOPICS
Expression and manipulation of transgenes in the laboratory
• In vitro mutagenesis to isolate variants of your protein/gene with desirable properties– Single base mutations– Deletions– Overlap extension PCR– Cassette mutagenesis
• To study the protein: Express your transgene – Usually in E. coli, for speed, economy– Expression in eukaryotic hosts– Drive it with a promoter/enhancer– Purify it via a protein tag– Cleave it to get the pure protein
• Explore protein-protein interaction• Co-immunoprecipitation (co-IP) from extracts• 2-hybrid formation• surface plasmon resonance• FRET (Fluorescence resonance energy transfer)• Complementation readout
![Page 34: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/34.jpg)
3434
PCR
fragment subsequent cloning in a plasmid
Cut with RE 1 and 2
Ligate into similarly cut vector
RS1 RS2
RS1 RS2
Site-directed mutagenesis by overlap extension PCR
1 2
![Page 35: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/35.jpg)
3535
Original sequence coding for, e.g., a transcripiton enhancer region
Cassette mutagenesis = random mutagenesis but in a limited region:
1) by error-prone PCR
------*--------*--*-**---------------*-----------*--*-------*------------------------*-*-*------------*------------*--
----------------------------------------------------------------------------------------------------------------------
Cut in primer sites and clone upstream of a reporter protein sequence.
Pick coloniesAnalyze phenotypes Sequence
PCR fragment with high Taqpolymerase and Mn+2 instead of Mg+2 errors
![Page 36: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/36.jpg)
3636
Original enhancer sequence
-*------------------------*-*-*------------*------------*--------*--------*--*-**---------------*-----------*--*------
----------------------------------------------------------------------------------------------------------------------
Buy 2 doped oligos; annealOK for up to ~80 nt.
Clone upstream of a reporter. Doping = e.g., 90% G, 3.3% A, 3.3% C, 3.3% Tat each position
Pick coloniesAnalyze phenotypes Sequence
Cassette mutagenesis = random mutagenesis but in a limited region:2) by “doped” synthesis Target = e.g., an enhancer element
![Page 37: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/37.jpg)
37
Got this far
![Page 38: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/38.jpg)
3838
E. coli as a host
• PROs:Easy, flexible, high tech, fast, cheap; but problems
• CONs• Folding (can misfold)• Sorting -> can form inclusion bodies• Purification -- endotoxins• Modification -- not done (glycosylation, phosphorylation, etc. )
• Modifications:• Glycoproteins • Acylation: acetylation, myristoylation• Methylation (arg, lys)• Phosphorylation (ser, thr, tyr)• Sulfation (tyr)• Prenylation (farnesyl, geranylgeranyl on cys)• Vitamin C-Dependent Modifications (hydroxylation of proline and lysine)• Vitamin K-Dependent Modifications (gamma carboxylation of glu)• Selenoproteins (seleno-cys tRNA at UGA stop)
![Page 39: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/39.jpg)
3939
Some alternative hosts
• Yeasts (Saccharomyces , Pichia)• Insect cells with baculovirus vectors• Mammalian cells in culture (later)• Whole organisms (mice, goats, corn)
(not discussed) • In vitro (cell-free), for analysis only
(good for radiolabeled proteins)
![Page 40: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/40.jpg)
4040Yeast Expression Vector (example)
2 micron plasmid
2 mu seq:yeast orioriE = bacterial oriAmpr = bacterial selectionLEU2, e.g. = Leu biosynthesisfor yeast selection
Saccharomyces cerevisiae(baker’s yeast)
oriE
Your favorite
gene(Yfg)
LEU2
Ampr
GAPDterm
GAPDprom
Complementation of an auxotrophy can be used instead of drug-resistance
Auxotrophy = state of a mutant in a biosynthetic pathway resulting in a requirement for a nutrient
GAPD = the enzyme glyceraldehyde-3 phosphate dehydrogenase
![Page 41: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/41.jpg)
41
Genomic DNA
HIS4 mutation-
Yeast - genomic integration via homologous recombination
HIS4
gfY
pt Vector DNA
FunctionalHIS4 gene
DefectiveHIS4 gene
Yfg
tp
Genomic DNA
![Page 42: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/42.jpg)
42
Double recombination Yeast (integration in Pichia pastoris)
AOX1 gene (~ 30% of total protein)
Genomic DNA
AOX1p
Yfg
AOX1t HIS4 3’AOX1
Genomic DNA
HIS4
Yfg
AOX1p
AOX1t
3’AOX1
Vector DNA
P. pastoris-tight control-methanol induced (AOX1)-large scale production (gram quantities)
Alcohol oxidase gene
![Page 43: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/43.jpg)
43
BD = (DNA) binding domain AD = activation domain
PROTEIN-PROTEIN INTERACTIONS
Yeast 2-hybrid system to discover proteins that interact with each otherOr to test for interaction based on a hypothesis for a specific protein.
?
http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html
(bait)
(prey)
Y = e.g., a candidate protein being tested for possible interaction with X
Or: Y = e.g., a cDNA library used to discover a protein that interacts with X
?
![Page 44: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/44.jpg)
44
Y = e.g., a cDNA library used to discover a protein that interacts with X
Recover the Y sequence from reporter+ colonies by PCR to idenify protein Y
No interaction between X and Y: no reporter expression
Yes, interaction between X and Y: reporter protein is expressed:
![Page 45: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/45.jpg)
45
Fusion library
Two different assays help, as there are often many false positives.
http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html
=“prey”
Bait protein is the known target proteinfor whom partners are sought
BD= DNA binding domain; TA = transactiavting domain
and/or
![Page 46: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/46.jpg)
46
3-HYBRID: select for proteins domains that bind a particular RNA sequence
Bait
Prey
Prey could be proteins from a cDNA library
![Page 47: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/47.jpg)
47
Yeast one-hybrid:
Insert a DNA sequence upstream of the selectable or reporter
Transform with candidate DNA-binding proteins (e.g., cDNA library)fused to an activator domain.
Each T = one copy of a DNA target sequence
![Page 48: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/48.jpg)
48
Directed Evolution of a Glycosynthase via Chemical ComplementationHening Lin,† Haiyan Tao, and Virginia W. Cornish J. AM. CHEM. SOC. 2004, 126, 15051-15059
Turning a glycosidase into a glyco-synthase
Glycosidase: Glucose-Glucose (e.g., maltose) + H2O 2 Glucose
Indirect selection using a yeast 3-hybrid system:a more efficient glycosynthase enzyme
![Page 49: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/49.jpg)
49
Indirect selection using the yeast 3-hybrid system(one of the hybrid moelcules here is a small molecule)
e.g., from a mutated library of enzyme glycosynthase genes
glucose
DHFR = dihydrofolate reductase GR = glucocorticoid receptor (trancription factor )MTX = methotrexate (enzyme inhibitor of DHFR)DEX = dexamethasone, a glucocorticoid agonist, binds to GRAD = activation domain, DBD = DNA binding domain
Leu2 geneLeu2 gene
Transform a yeast leucine auxotroph. Provide synthetic chimeric substrate molecules. Select in leucine-free medium.
![Page 50: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/50.jpg)
50
URA-3 (toxic)
Library of cellulase mutant genes(one per cell)
x x x x
cellulase
Survivors are enriched for cellulase genes that will cleave cellulose with greater efficiency (kcat / Km)
Yeast cell
Directed Evolution of Cellulases via Chemical Complementation. P. Peralta-Yahya, B. T. Carter, H. Lin, H. Tao. V.W. Cornish.JACS 2008, 130, 17446–17452
Selection of improved cellulases via the yeast 2-hybrid system
Cellobiose(disaccharide)
![Page 51: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/51.jpg)
51
Substrate
![Page 52: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/52.jpg)
52Pathway to pyrimidine nucleotides:
URA-3 = gene for orotidine phosphate (OMP) decarboxylase
5-fluoroorotic acid
5-Fluoro-OMP
5-Fluoro-UMP
RNA
URA-3 decarboxylation (pyr-4)
Thymidylate SynthetaseinhibitionDeath
How does the URA-3 system work?
Exogenousuridine
Uridine kinase
analog
Ura3+ is FOA sensitive; ura3- is FOA resistant
![Page 53: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/53.jpg)
53
Measuring protein-protein interactions in vitroX=one protein Y= another protein
Pull-downs:
Binding between defined purified proteins, at least one being purified.Tag each protein differently.
Examples:
His6-X + HA-Y; Bind to nickel ion column, elute (his), Western with HA Ab
GST-X + HA-Y; Bind to glutathione ion column, elute (glutathione), Western with HA Ab
His6-X + 35S-Y (made in vitro); Bind Ni column, elute (his), gel + autoradiography. No antibody needed.
(HA = influenza virus flu hemagglutinin)
glutathione = Gamma-glutamyl-cysteinyl-glycine.
![Page 54: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/54.jpg)
54
Example of a result of a pull-down experiment
Antibody used in Western
Total protein: no antibody or Western(stained with Coomassie blue or silver stain)
Compare pulled down fraction (eluted)with loaded
Also identfy by MW (or mass spec)
![Page 55: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/55.jpg)
55
Western blotting
To detect the antibody use a secondary antibody against the primary antibody.
The secondary antibody is fusion protein with an enzyme activity (e.g., alkaline phosphatase).
The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound.
http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html
![Page 56: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/56.jpg)
56
Y YNon-luminescent substrate-PO4
=
Luminescent product + PO4=
Protein band on membrane
Alkaline phosphatase fusion
Secondary antibody-enzyme fusion(e.g., goat anti-rabbit IgG)
Antibody to protein on membrane
Detect by exposing to film
Detection of antibody binding in western blots
![Page 57: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/57.jpg)
57Far western blotting to detect specific protein-protein interactions. Use a specific purified protein as a probe instead of the primary antibody
To detect the protein probe use an antibody against it.
Then a secondary antibody, a fusion protein with an enzyme activity.
The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound.
http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html
protein protein
![Page 58: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/58.jpg)
58
Expression via in vitro transcription followed by in vitro translation
cDNA
T7 RNA polymerasebinding site (17-21 nt)
….ACCATGG…..
VECTOR
2. Add to translation system: rabbit reticulocyte lysate or wheat germ lysate
Or:
E. coli lysate (combined transcription + translation)
All commerically available as kitsAdd ATP, GTP, tRNAs, amino acids, label (35S-met), May need to add RNase (Ca++-dependent) to remove endogenous mRNA In lysate
1. Transcription to mRNA via the T7 promoter + T7 polymerase
Radioactively labeled protein
NOTE: Protein is NOT at all pure (100s of lysate proteins present), just “radio-pure”
![Page 59: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/59.jpg)
59Co-immunoprecipitation
• Most times not true precipitation, which requires about equivalent concentrations of antigen and antibody• Use protein A immobilized on beads (e.g., agarose beads)• Protein A is from Staphylococcus aureus: binds tightly to Immunoglobulin G (IgG) from many species.
A
A
A
A
A
A
X
YD
Y
X
C
B
X
Y
+
D
Y
X
C
B
incubate+ anti-X IgG
A
A
A
A
A
A
X
Y
+
D
Y
X C
B
+ Protein A
A
A
A
A
A
A
YXX
Y
Wash by centrifugation (or magnet)Elute with SDSDetect X, Y in eluate by Western blotting
Or cell extract
Does X interact with Y in the cell or in vitro?
![Page 60: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/60.jpg)
60Surface plasmon resonance (SPR)
The binding events are monitored in real-time and it is not necessary to label the interacting biomolecules.
http://home.hccnet.nl/ja.marquart/BasicSPR/BasicSpr01.htm
glass plate
![Page 61: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/61.jpg)
61Expression in mammalian cellsLab examples:HEK293 Human embyonic kidney (high transfection efficiency)HeLa Human cervical carcinoma (historical, low RNase)CHO Chinese hamster ovary (hardy, diploid DNA content, mutants)Cos Monkey cells with SV40 replication proteins (-> high transgene copies)3T3 Mouse or human exhibiting ~regulated (normal-like) growth+ various others, many differentiated to different degrees, e.g.:BHK Baby hamster kidey HepG2 Human hepatomaGH3 Rat pituitary cellsPC12 Mouse neuronal-like tumor cellsMCF7 Human breast cancerHT1080 Human with near diploid karyotypeIPS induced pluripotent stem cells and:Primary cells cultured with a limited lifetime. E.g., MEF = mouse embryonic fibroblasts, HDF = Human diploid fibroblasts
Common in industry:NS1 Mabs Mouse plasma cell tumor cellsVero vaccines African greem monkey cellsCHO Mabs, other therapeutic proteins Chinese hamster ovary cellsPER6 Mabs, other therapeutic proteins Human retinal cells
![Page 62: 1 Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and.](https://reader035.fdocuments.net/reader035/viewer/2022081515/56649eef5503460f94bff6a1/html5/thumbnails/62.jpg)
62