1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is...

32
1 Dynamics of Dynamics of Genes in Genes in Populations Populations Dan Graur

Transcript of 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is...

Page 1: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

1

Dynamics of Dynamics of Genes in Genes in

PopulationsPopulationsDan Graur

Page 2: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

2

Page 3: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

3

A genomic location A genomic location is called a is called a locuslocus. . A locus is A locus is identified by:identified by:1. Position: e.g., the distal part of the long arm of chromosome 21.

2. Homology: e.g., the alcohol dehydrogenase locus.

Page 4: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

4

Alternative forms Alternative forms at a locus are at a locus are called called allelesalleles. .

Page 5: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

5

AACTTGGGTACTAAGGCATTCAAGTGTG

AACTTGGGTACTTTGGCATTCAAGTGTG

allele 1

allele 2

Page 6: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

6

Humans are Humans are didipploidloid organisms. organisms.

Each person has two Each person has two alleles at alleles at each autosomal each autosomal locuslocus..

A female has two alleles A female has two alleles at all lociat all loci..

The allelic makeup at a The allelic makeup at a locus is called the locus is called the

genotypegenotype..

Page 7: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

7

A A populationpopulation is a group of individuals among is a group of individuals among which which gene flow gene flow may occur, and whose may occur, and whose offspring have on average the same offspring have on average the same fitnessfitness as as their parents. their parents.

Page 8: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

8

In a population, In a population, more than one more than one allele may be allele may be present at a present at a locus. locus.

monomorphicmonomorphicpolymorphicpolymorphic

Page 9: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

9

Each allele may be Each allele may be defined by its defined by its frequencyfrequency. .

Page 10: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

10

Population size = 10, Ploidy = 2 Population size = 10, Ploidy = 2 Number of alleles = Population Number of alleles = Population size size Ploidy PloidyNumber of alleles = 10 Number of alleles = 10 2 = 20 2 = 20

Page 11: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

11

Number of black mice = 8 Number of black mice = 8 Number of white mice = 2Number of white mice = 2

Page 12: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

12

Number of homozygotes = Number of homozygotes = 6 6

Number of heterozygotes Number of heterozygotes = 4= 4

Page 13: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

13

allele frequency = number of alleles of type a

total number of alleles

white allele frequency = white allele frequency = 8/20 = 0.48/20 = 0.4

Page 14: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

14

The set of The set of all all allelesalleles existing existing in a population at in a population at all lociall loci is called is called the the gene poolgene pool. .

Page 15: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

15

Gene pool = Static description

True for 4/4/2004 at 12:45:56 PM

Page 16: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

16

Gene pool = Dynamic description

Add a time component, and the static description becomes a dynamic description.

Page 17: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

17

What is evolution?What is evolution?

Page 18: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

18

Evolution: A process of change in a certain directiondirection. A process of gradualgradual and peaceful advance. The historical development of a biological group. A theory that the various types of animals and plants have their origin in other preexisting types and that the distinguishable differences are due to modifications in successive generations.

Page 19: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

19

Evolution: A gradualgradual process in which something changes into a different and usually more complexmore complex or betterbetter form. Change in the genetic composition of a population as a result of natural natural selectionselection… and resulting in the developmentdevelopment of new new speciesspecies. The historical development of a related group of organisms

Page 20: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

20

EvolutionEvolution = A = A change in the change in the composition of composition of the gene pool. the gene pool.

evolution = gene pool + time

Page 21: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

21

Possible Possible Changes:Changes:

1. allele 1. allele frequencies frequencies 2. genotype 2. genotype frequenciesfrequencies

1.1.

2.2.

Page 22: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

22

Changes in allele fr

equencies are

Changes in allele fr

equencies are

importantimportant..

Changes in genotype

frequencies are

Changes in genotype

frequencies are not not

so importantso important..

1.1.

2.2.

Page 23: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

23

One of the aims of One of the aims of the molecular the molecular evolution discipline evolution discipline is to study the is to study the factorsfactors affecting affecting allele and genotype allele and genotype frequencies.frequencies.

Page 24: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

24

Or:Or: Define the Define the conditions under conditions under which which no channo changgee in allele or in allele or genotype genotype frequencies frequencies occur.occur.

Page 25: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

25

Punnett SquarePunnett Square

(1875-1967)

Page 26: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

26

Allele frequencies are the same in sperm and ova.

Page 27: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

27

The probability of a certain sperm fertilizing a certain ovum is equal for all sperms and ova.

Page 28: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

28

Godfrey Harold HardyWilhelm Weinberg

Hardy-Weinberg Equilibrium:

p2 + 2pq + q2 = 1

Page 29: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

(Bruno) De Finetti Triangle

equilibrium

disequilibrium

Page 30: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

30

Allele and genotype frequencies will remain stable if:

1. all mating is totally random 2. there is no migration3. there is no mutation4. there is no selection5. the population is infinitely large If these conditions are violated, a change in frequencies will occur.

Page 31: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

31

Page 32: 1 Dynamics of Genes in Populations Dan Graur 2 3 A genomic location is called a locus. A locus is identified by: 1. Position: e.g., the distal part.

32