Introduction:

Cytosolic phosphoglucose isomerase (PGICpgiC, E.C. 5.3.1.9) is an enzyme essential to

the glycolysis, a phase of cellular- respiration pathway known in almost all species of living

things. pgiCPGIC acts in uring the second stage step of glycolysis, converting Glucose-6-

Phosphate to its isomeric form, Fructose-6-Phosphate. Particular An array of regions within the

exons of pgiC have remained relatively conserved across kingdoms (Claes et al. 1994, Thomas et

al.1990), while other regions of the exons, and introns are highly variable (Thomas et al. 1993,

Kawabe et al. 2000, Koenemann et al. 2011). The variability Variation of in PGIC is known to

cause yield allozyme polymorphisms within in both flora and fauna (The butterfly Colias, Watt

1977; blue mussel Mytillus, Hall 1985; Arabidopsis thaliana, Kawabe et al. 2000; Wild Yam

Drioscorea tokoro, Terauchi 1997).

In certain cases it has been suggested that tThese polymorphisms have in some cases

been shown to be are acted upon by under natural selection (Gillespie 1991; Riddoch 1993).

Both

In some organisms dselection ifferences in PGIC alleles are selected for based on their

kinetic performance or and structural stability at different temperatures have been documented.

In the blue mussel, Mytilus edulis, two PGIC alleles are expressed atreplace one another across a

latitudinal clines in frequency;, and they differ in their efficiency when in the presence of at

physiologically higher temperatures (Hall 1985). The sierra willow leaf beetle, Chrysomela

aeneicollis, also has multiple pgiC alleles that vary along a thermal cline that follows latitude and

elevation (Dahlhoff and Rank 2000, Rank and Dahlhoff 2002). In C. aeneicollis specific pgiC

alleles can be associated with cold or warm habitats;, where these alleles differ in their thermal

stability as well as biochemical performance at different temperatures (Rank and Dahaloff 2002).

Directional selection of PGIC is observed along latitudinal clines in both C. aeneicollis and M.

edulis. Another example of temperature- based selection of PGIC is the heterozygotic

dominance of selection for heterozygous genotypes of PGIC frequently observed in the sulfur

butterflies, (Colias, (Watt 1977). The result of this heterozygoticheterozygote dominance is due

to ainferred to be the result long-term balancing selection fthat seems to favoravoring a group of

charge- changing nonsynonymous substitutions, which are believed to alter the function of the

pgiC protein enzyme (Wheat 2006). Together, these sets of findings suggest an important and

complex relationship between pgiC activity and environmental conditions, especially

temperature (Dahaloff et al 2000, Rank et al. 2002, Wheat et al. 2006, Wheat 2010). It is likely

that similar degrees of temperature- based selection can be found in species other than arthropods

and mollusks, due togiven the high level of conservation of PgiC across large major taxonomic

groupsevolutionary lineages.

It is well known that intraspeciesIntraspecific nucleotide variation inof pgiC occurs inhas

been reported for a number of angiosperms species, often the resulting ofresulting in amino acid

substitutions (Arabidopsis thaliana Kawabe et al. 2000, Dioscorea tokoro Terauchi et al. 1997,

and Leavenworthia stylosa Filatov and Charlesworth 1999). In some cases it is suggested that

natural selection is acting upon the different alleles of pgiC in these plants. In a study of wild

populations of A. thaliana, a low level of population-level DNA polymorphisms s and a high

level of non-synonymous nucleotide replacements is indicative suggests that the genetic

variation does not follow a neutral mutation theory and could possibly result from variants are

under natural selection (Kawabe et al. 2000). Variation of pgiC has also been studied in ferns,

focused on a small fragment of pgiC exons 14– -16 and their two respective included introns, has

been amplified in the fern ( Dryopteris nipponensis (Ishikawa et al., 2002) as well as in the

fiddlehead fern Matteuccia struthiopteris (Ishikawa et al., 2002, Koenemann 2011). In addition,

isozyme studies of Central American Polystichum species have indicated shown that there are y

host at least two five different PGIC alleles (including two intraspecific variants), within the

genus, that have differences in their electrical charge and thus variability within their implying

different amino acid sequences (Barrington 1990). Beyond this work, essentially nothing is

known about pgiC expression variation in ferns, despite the success of these plants in both cold

and warm especially in relation to habitats. However the variation and function of pgiC in

relation to environmental conditions is less well-studied

An excellent study system for exploring genetic diversity related to environmental

variables in pgiC is the genus Polystichum, which comprises approximately 260 380 species

worldwide (Barrington, 1995unpublished data). This genus includes a recently evolved lineage

endemic to the Andes ; the Andean lineage consists of comprising an array of species found at

diverse elevationsal and hence temperature regimes (McHenry and Barrington 2014). Recent

phylogenetic work in the Barrington lab has revealed that during the history of Andean

Polystichum, there have been at least three major elevational transitions, both up and down the

Andes (McHenry and Barrington 20142012). As pgiC is variable in allozyme polymorphisms in

Central American Polystichum species (Barrington 1990) and in arthropods (Dahaloff et al.

2000, Rank et al. 2002, Wheat et al. 2010), it is plausible to expect that the Andean Polystichum

species may exhibit PgiC variation across an elevation gradient due to environmentally induced

selection on alleles of this gene. Alternatively, PgiC variation is may be due to selectively

neutral, historically informative factorstransformations.

Understanding how the PgiC gene varies in Polystichum can help broaden our

understanding of how the protein functions in general. Just as the Andes have seen climatic

change during their uplift, different regions of the world are constantly undergoing ecological

changes. Given the abundant evidence for climate change, insights into the response of

temperature-dependent enzymes such as PgiC have immediate relevance to improving our

understanding of plants’ responses to global warming.

*Enzymatic variation PGIC, DNA variation pgiC.

MATERIALS AND METHODS

Taxonomic Sampling—A total of nine9 taxa Polystichum species were included in the study

group, comprising ofincluding eight species of Andean Polystichumrom the Andes. Species

were chosen to include closely related taxa from a range of elevations along the equatorial to

central regions of thein the central and northern Andes. Specifically accessions were collected

from Ecuador, Bolivia and a A single accession species (P. pallidum)—still from the same clade

— (P. pallidum) was collected from Brazil. The lowest accession sampled (P. pallidum) was

collected at 480 meters above sea level , while the highest accession (P. orbiculatum) was

collected at at 4650m . The collections for this analysis were largely made during the

investigation reported in McHenry and Barrington, 2014. A For a complete list of sampled taxa,

including accession numbers and voucher information, can be found in thesee the appendix.

DNA Isolation, Primer design,, Amplification, and Sequencing—Leaf material was stored in

silica desiccant gel at -80°C prior to extraction. Total genomic DNA was extracted from the

silica- dried frond material donated by collaborators. Leaf material was stored in silica

desiccant gel at -80°C prior to extraction. Total genomic DNA was extracted from pinnules

using a modified CTAB extraction protocol (Doyle and Doyle, 1987).

PgiC MarkersPrimers: Primer sets (Table 1) provided the basis for retrieving sequences

from aA total of six markers were used to amplify two large regionsrepresenting ##% (3200bp

of a estimated total of #### bp) of the pgiC gene in from Andean pPolystichums. The first four

markers, pgiC exons 3-7, 6-8, 7-10, and 9-13, were used to amplifyfrom the roughly 2000 base

pair region from pgiC exons 3-13. The remaining two markers, pgic exons 14-17, and 16-19,

were used to amplifyfrom the 1200 base pair region from pgiC exons 14-19. The connecting

region between exons 13 and 14, as well as exons 1-3 and 19-22, failed to amplify despite the

multiplenumerous attempts with a number of different primers, PCR reagents, and conditions.,

similar issues are why regions for exons 1-3 and 19-22

are also not included. InitialThe first pgiC primers (to amplify exons 14–16) for Polystichum

were designed by collaborators based off ofadapted from those used by Ishikawa et al. (2002) to

amplify Dryopteris. , and were successfully able to amplify pgiC exons 14 - 16 in Polystichum.

Additional pPrimer sets for pgiC exons 16–19 were designed by collaborators Barrington lab

members. My design of for exons 16 -19 were designed based off of a fragment of pgiC for

dryopteris, many other primers were designed in a similar manner for Polystichum pgiC with

minimal success. tThe remaining primers was considerably aided by the contribution were

designed based off of pgiC cDNA of pgiC for Polystichum achrostichoides by Carl Rothfels (see

Rothfels et al. 2013)., Tthis same cDNA was also used to modify previously designed primers in

order to improve amplification.

Amplification: Amplification by the polymerase chain reaction was performed in a TC-

3000, TC-3000X or a 3Prime thermal cycler (Techne, Burlington, New Jersey, USA) in 25 μL

aliquots with the following components: 150 ng of genomic template; 0.1 μM of each primer; 1

× Denville PCR Buffer (Denville Scientific Inc., South Plainfield, New Jersey, USA); 200 μM/L

of each dNTP; and 0.625 U ChoiceTaq DNA Polymerase (Denville Scientific Inc.). All

sequences were amplified as follows: (1) initial denaturation at 94 °C for 2 min; (2) followed by

35 cycles (94 °C for 30 s, 55-58 °C (annealing temperatures were adjusted for each marker set

see Table1) for 30 s, 72 °C for 1 min); and (3) a final extension at 72 °C for 10 min. PCR

products were purified using ExoSAP-IT (USB Corporation, Cleveland, Ohio, USA). Purified

PCR products were then further cleaned and labeled using ABI reagents (Applied

Biosystems/Life Technologies, Foster City, California, USA).

Sequencing: Sequences were resolved on an ABI Prism 3730xl DNA analyzer (High

Throughput Genomics Center, Seattle, WA, USA). The raw chromatograms from each amplified

PCR products sequenced were aligned using both the forward and the reverse sequences, and

consensus sequences were assembled for each region of pgiC using Geneious Pro version 6.1.5 (

Drummond et al., 2007 ).

Phylogenetic Analysis—Bayesian Inference (BI) was carried out using Mr. Bayes v. 3.2

(Huelsenbeck and Ronquist 2001; Ronquist and Huelsenbeck 2003). The Bayesian-analysis

model selection was done using Modeltest v. 3.7 under the Akaike Information Criterion

(Posada and Crandall 1998; Posada and Buckley 2004; Posada 2006). A mixed-model Markov

Chain Monte Carlo analysis was performed with each marker allowed to evolve under its own

best-fit model, with eight independent Markhov chains for 10 million generations and trees

sampled every 1,000 generations. Stationarity was determined using the log-likelihood scores for

each run plotted against generation in the program Tracer (Rambault & Drummond, 2007). 10

% of the trees were discarded as the burn-in phase and a 50% majority rule consensus tree was

calculated for the remaining trees.

Results

Characteristics of the Dataset—The final aligned dataset contained an alignment oftotaled 3376

characters, of of these characters which 148 (4.38%) were variable and 56 (1.66%) were

informative. Of the 3376 characters 1134 (33.59%) of the total are exonic; and contain 25

(2.20% of the 1134) imply amino acid substitutions (2.20% of total exon characters) . Of these,

substitutions with 18 are synonymous substitutions (six of which are informative, three charge-

changing), and seven are nonsynonymous substitutions (five of which are informative). Of the

nonsynonymous substitution three resulted in charge changing amino acid substitutions. In the

introns there were 129 substitutions with 51 of these being informative, in addition The

remaining 2242 characters (66.41%) were intronic; they included 129 substitutions (51

informative). Tthe introns also includedre were 11 informative indels and 21 autapomorphic

indels varying in size from one base pair to 188 base pairs.

The amplification of pgiC in Andean Polystichum resulted in the sequences for two

central regions of the gene in nine accessions. One region spans 2113 base pairs and ranges from

the end of exon 3 to the beginning of exon 13. The second section is 1263 base pairs long

starting at the end of exon 14 and ends halfway through exon 19. Of the pgiC regions amplified

in Andean Polystichum both exon and intron lengths were found to be relatively variable. Exons

range from 43 base pairs (exon 7) to 156 base pairs (exon 5) with and average length of 79 base

pairs. Introns are even more variable, ranging from 67 base pairs (iIntron 9) to 533 base pairs

(iIntron 7).

Three introns in particular (7, 15, and 18) contain much more variability than in any of

the other introns. Well known for its variability, intron 15 is frequently used for phylogenetic

analysis in plants, including ferns (Ishikawa et al. 2002, Koenemann et al. 2011). In Andean

Polystichum, pgiC intron 15 ranges from 207 to 391 base pairs long and contains 14 variable

characters, five of which are informative. Intron 15 also contains eight autapomorphic indels and

four synapomorphic indels, one of which is 188 base pairs long and—it is the major cause source

for such the variability variation in the the size of this intron. Despite intron 15’s variable

qualities documented variation, the most variable region amplified I retrieved was in intron 7,

which contains 28 variable characters: 12 of these are informative. Intron 7 is also the largest

intron sequenced for Andean Polystichum pgiC; and it ranges from 503 to 533 base pairs in

length. Intron 7 also contains a number of different microsatellites that vary in size and sequence

and have resulted in several indels and single nucleotide substitutions. Another The third

significantly unusually variable region is intron 18, this regionwhich contains 13 variable

characters (eight of which are informative). A single autapomorphic indel occurring in intron 18

accounts for a variable length ranging from 138 to 183 base pairs. As a whole these three introns

contain 55 (42.64%) of the 129 variable characters and 25 (49.02%) of the 51 informative

characters found within the introns.

Phylogeny with All Characters—Bayesian inference analysis was used to construct a tree for all

amplified regions of Andean Polystichum pgiC (exons 3-13 and 14-19 and their respective

introns). All variable characters were mapped out to create a phylogenetic character state tree.

Four monophyletic groups were resolved in the bayesian inference analysis of andean Pgic. The

first group contains comprises a singles species, of P. stuebellii, a mid- elevational pre-montane

species found in pre-montane forests along the western slopes of the Andean Equatorial Region

of the Andes. The particular accession of P. stuebelii stubellii used in this analysis was collected

at 2400 meters. As group one contains the most ancestralearliest-divergent species in cpDNA

analyses (McHenry and Barrington 2014), P. stuebelii wasis chosen to rooted as the

outgroupphylogeny. The remaining three groups are unresolved from one another and form a

polytomy of three branches. The largest group clade in this phylogeny, group 2, consists of P.

orbiculatum, P. gelidum, P. pallidum, and P. polyphyllum. P. olystichum orbiculatum is a

widespread species (Mexico to Bolivia) found at upper elevations and is prominent in the páramo

(collected at 4650 and 4669m). P.olystichum gelidum is present found throughout the northern

to and central Andes and is found at upper elevations in subpáramo and Polylepis (Rosaceae)

forests (collected at 3200m). P. pallidum is found only in southeastern Brazil at low elevations

in wet-premontane forests (collected at 480m). P. polyphyllum is an somewhat rare alpine

species found growing in the páramo at high elevations in the northern to central Andes

(collected at 3870m). Group 3 contains P. platyphyllum and the hybrid species P. platyphyllum

XX P. bulbiferum both species are found on premontane to montane forested slopes (collected at

1729m and 1321m respectively). Lastly Finally, group four contains comprises the single

species P. dubium, a relatively widespread species (Costa Rica to Bolivia) found in wet-montane

forests along stream banks (collected at 2655m).

The chloroplast- based phylogenetic tree constructed for Andean Polystichum contains

three major clades, clade one contains P. stuebellii, clade two contains P. polyphyllum, P.

orbiculatum, and P. gelidum, and clade three contains P, bulbiferum, P. platyphyllum, P.

pallidum, and P. dubium(McHenry & Barrington 2014). Phylogenetic analysis of Andean pgiC

does not perfectly match is congruent in part with the chloroplast phylogeny. Some

commonalities however are apparent, for instance wWith the exception of P. pallidum, group 2

contains the same species as clade two in the chloroplast phylogeny. However the relationships

between these species are relatively different as in the chloroplast tree P. polyphyllum is sister to

P. orbiculatum but in the pgiC tree P. gelidum is sister to P. orbiculatum. In addition 16

characters, including 3 nonsynonymous substitutions, unite P. gelidum and P. orbiculatum,

whereas only a single character (2972) unites P. polyphyllum with P. gelidum and P.

orbiculatum. In addition Polystichum. pallidum’s inclusion in is only tied to group two is

supported by two characters (2972 and 2297), i.e. giving it a relatively weak relationship

supportto this group. Polystichum. pallidum’s weak relationship to group two is not unexpected

seeing how given that it is nested within clade three of the chloroplast tree. With the exception

of the union of P. platyphyllum and P. platyphyllum platy X bulbiferum, clade three of the

chloroplast tree is poorly resolved in pgiC.

A number of synonymous and nonsynonymous substitutions are charted throughout the

phylogeny. Four of the seven nonsynonymous substitutions are found in group two, none occur

in P. polyphyllum and only one is found in P. pallidum (Character 2297) while all four are found

in P. gelidum and both species of P. orbiculatum. Three of the substitutions change between two

nonpolar amino acids (character 95 valine to alanine, character 541 valine to isoleucine, and

character 2297 phenylalanine to leucine). The fourth nonsynonymous substitution that occurs in

this group results in a change in charge resulting in an amino acid substitution of proline to

glutamine, a nonpolar to a polar amino acid (character 3339) occurring in P. gelidum and P.

orbiculatum. The only remaining nonsynonymous substitution that is informative is character

2756, a non-charge changing substitution that occurs in both species of group 3. The two

remaining nonsynonymous are autapomorphic occurring only in P. dubium, both of which result

in a charge changing substitution. The first amino acid substitution in P. dubium is character 118

and results in an amino acid substitution of acidic glutamic acid to basic lysine. The other

substitution is character 416 and results in the substitution of polar alanine to nonpolar threonine.

Fragments of pgiC were also sequenced for an additional accession of P. dubium (not included in

this analysis due to incomplete data), interestingly this accession only shares the substitution at

character 416 and does not share the character 118 substitution. However this additional P.

dubium has a different nonsynonymous substitution that lies seven base pairs downstream from

character 118 occurring within the same exon, and results in a non-charge changing substitution

of glutamic acid for aspartic acid.

Of the 18 synonymous substitutions occurring in the exons of Andean Polystichum seven

are informative. Four of the informative synonymous substitutions are found uniting group 3

while the other three are found uniting taxa in group two, at various nodes. Nine of the 11

autapomorphic nonsynonymous substitutions can be found in P. stubellii (four), P. polyphyllum

(two), and P. dubium (three), the remaining two substitutions are found in P. pallidum and P.

platyphyllum with one each. All remaining substitutions are intronic occurring outside of the

coding region, of these there are 51 synapomorphic characters and 78 autapomorphic characters.

All of these synapomorphic characters are found uniting closely related taxa such as the 30

characters that unit P. platyphyllum and P. platyphyllum X bulbiferum. The two species of P.

orbiculatum are united by 10 of these intron based synapomorphies and the remaining 11

characters unit P. orbiculatum and P. gelidum.

As is a nuclear gene, pgiC can give great insights on the hybridity of species. Direct

sequencing of a hybrid species often results in double peaks in the chromatogram due to

differences between the copies of pgiC, resulting in heterozygous nucleotides (?). A number of

these nucleotides are found in the sequences for P. platyphyllum X bulbiferum and it’s very clear

that P. platyphyllum is indeed a progenitor of this hybrid species as three of the heterozygous

nucleotides are the results of single nucleotide polymorphisms occurring in P. platyphyllum. The

tetraploid P. gelidum hybrid included in this study also contains a number of heterozygous

nucleotides and while a single substitution in P. orbiculatum and a single substitution in P.

polyphyllum match some of these nucleotides, there are still three other sites that are not

accounted for by any of the species included in this study.

Fragments of pgiC were sequenced for a number of different accessions of P.

orbiculatum during the early stages of this project. Due to difficulty in sequencing several of

these accessions were not used for the final dataset. Sequence data from these accessions

suggest that there are both diploid and tetraploid varieties of P. orbiculatum and that P.

polyphyllum is one of the progenitors of the tetraploid P. orbiculatum. Previous work on

Polystichum hybrids has determined that P. orbiculatum and P. talamancanum (another

tetraploid hybrid found in Central America) share a progenitor that is noted by a 200 base pair

deletion in intron 15. As P. polyphyllum also shares the 200 bases pair deletion as well as

several nucleotide polymorphisms it is likely the previously unknown progenitor of P.

talamancanum as well.

Comparison of Exon and Intron Trees—Intronic and exonic based trees are relatively similar

with only a few exceptions. Both and intron and exon trees retain groups one, three and four as

described for the character state tree for all regions of pgiC making the structure of group the

major difference. In both trees P. polyphyllum has lost resolution to group two, which is likely

due to a lack of support as it was only united to this group based on a single synonymous

substitution( character 2972). In addition to this the intron trees has also lost the resolution of P.

pallidum. In addition the clade containing both species of P. orbiculatum has collapsed resulting

in a polytomy of three branches, this also indicates a high level of similarity in the exonic

sequences of P. orbiculatum and P. gelidum. Other than a loss of resolution there are no

significant structural differences between the intron and exon trees.

Discussion

Variation of pgiC in Andean Polystichum—Of all of the regions sequenced for Andean

Polystichum pgiC single nucleotide polymorphisms are found occurring more frequently in the

introns opposed to the exons, indicating a greater level of conservation of the coding region.

Conservation of the exons is often a consistent theme of many nuclear genes involved in critical

regulatory processes such as glycolysis.  Of the substitutions that did occur in the exons the

majority were synonymous and therefore did not result in any type of amino acid change.  In

addition of the seven amino acid substitutions that did occur only three resulted in amino acid

substitutions that changed charge, two of which occurred in a single accession.  Therefore the

majority of the coding region of pgiC remains relatively conserved across a number Andean

polystichum accessions.

More than half of the nucleotide polymorphisms that were observed in Andean

Polystichum pgiC resulted in autapomorphic characters, and a number of the informative

characters occurred in many closely related taxa.  Very few informative characters showing

relationships between more distantly related lineages were present in either the exons or introns

of the pgiC regions sequenced in this study.  The lack of more ancestral characters led to a loss

of resolution and the formation of a three branch polytomy in the phylogeny constructed with all

regions of pgiC.  The fact that many of the characters are more recently derived gives strong

evidence that pgiC is rapidly evolving in Andean Polystichum.              

Elevational variation of pgiC in Andean Polystichum—Major similarities were found between

the chloroplast based phylogeny of Andean Polystichum and both the pgiC intron and exon

phylogenies.   These similarities indicate that the variation in both the introns and exons of pgiC

are likely the result of a phylogenetic history, rather than temperature based selection of pgiC.

The only major dissimilarities that arose were the relationships of P. pallidum and P.

polyphyllum, the remaining differences are mostly polytomies that can be attributed to a lack of

informative ancestral characters.  P. pallidum’s placement in the exon based phylogeny is

particularly strange.  First it’s placement within the chloroplast tree is in clade three where it is

sister to P. platyphyllum and P. platyphyllum X bulbiferum yet in the exon tree is very closely

related to P. orbiculatum and P. gelidum, taxa that belong to clade 2 of the chloroplast tree.  In

the exon phylogeny P. pallidum is linked with accession from very high elevations (P.

orbiculatum, P. gelidum, and P. polyphyllum), all of which were collected above 3000 meters,

while P. pallidum was collected at 480 meters.  Therefore it is likely that the two exonic

characters linking P. pallidum to these high elevations accessions are homoplastic characters that

evolved separately of one another.  P. polyphyllum is species that is sister to P. orbiculatum in

the chloroplast phylogeny, yet P. polyphyllum is unresolved in both intron and exon phylogenies.

It is revealed in the character state tree that P. polyphyllum is linked to P. orbiculatum and P.

gelidum  by a single character (character 2972, fig. 2).  However in the chloroplast tree P.

orbiculatum is sister to P. polyphyllum yet they only share a single synonymous substitution in

pgiC, yet P. orbiculatum and P. gelidum share four nonsynonymous substitutions as well as a

number of characters in the introns.  While this difference in relationships is odd it is not likely

that it is not due to elevational differences as all accessions for these species were collected

above 3000 meters.        

While it is possible that the divergence of pgiC follows a pathway similar to the

phylogenetic history of Andean Polystichum, patterns of amino acid substitution may give

insight on the adaptation of these plants to higher elevations.  Six of the seven amino acid

substitutions that occur in Andean Polystichum pgiC can be localized to two regions within the

phylogeny, a portion of group two(P. gelidum and P. orbiculatum) and group four (P. dubium).

Four of the amino acid substitutions occur in P. gelidum and both accessions of P. orbiculatum,

three of these substitutions result in no change in charge.  The remaining substitution results in

change from the nonpolar amino acid proline to the polar amino acid glutamine.  It is possible

that these substitutions particularly the charge changing substitution, in some way alter the

structure of pgiC in this group of plants allowing for a more robust performance of glycolysis at

higher elevations and thus lower temperatures.  However P. polyphyllum, an additional upper

elevation species that is included in this study, does not share any of the four substitutions as P.

orbiculatum and P. gelidum.  As P. polyphyllum is a rare species and P. gelidum and P.

orbiculatum are more prominent and widespread, it is possible that these species simply

outperform P. polyphyllum as P. polyphyllum has and inferior pgiC allozyme.  In P. dubium two

amino acid substitutions occur solely in the single accession included in this study, both of which

result in charge changing amino acid substitutions.  However it is known that intraspecies

variation resulting in differences in amino acid substitution occurs in P. dubium.  As P. dubium

is a widespread species it is likely that varying pgiC allozymes exist between and potentially

among different populations of P. dubium.  While limited the amino acid variation that is found

in the exons of Andean Polystich pgiC could potentially give insight on the adaptation of andean

polystichum to new elevations and environmental presures.          

Future Focuses—While variation of pgiC in this subset of Andean Polystichum would seem to

indicate that elevation and thus temperature does not play a role in allozyme formation this does

necessarily mean that it is not selected for.  A number of Andean Polystichum species were not

included in this study, these species may give further insight into the role of pgiC and how it is or

is not affected by temperature in ferns.  It would be beneficial to continue this study with a

greater sample size including more species as well as accessions.  In addition it would be

beneficial to look at pgiC in a single species of Polystichum that ranges across the Andes, P.

dubium would be a good potential candidate for this study as it is already known to have at least

two pgiC allozymes.  

While pgiC is used in a number of phylogenetic analyses, it may not always be the best

nuclear marker.  It is clear that pgiC is very rapidly evolving in Andean Polystichum, particularly

by the large number of autapomorphic characters and lack of ancestral synapomorphic

characters. In some cases, such as Andean Polystichum, it may be difficult to resolve the lineages

of particular species due to pgiC’s rapid evolution.  However, in other cases it is the rapid

evolution of pgiC that would make it an ideal marker for resolving the identity of very closely

related or recently divergent species.  In addition microsatellites found in intron 7 would make

excellent markers for molecular based studies of Polystichum (or other closely related groups)

populations. In addition the variability of pgiC makes it a good marker for resolving hybridity in

ferns.

References

Barrington, D. 1990. Hybridization and Allopolyploidy in Central American Polystichum:

Cytological and Isozyme Documentation. Annals of Missouri Botanical Garden,

77:297-305.

Barrington, D. 1995. Polystichum. In G. Davidse, M. Sousa S., and S. Knapp [eds.], Flora

Mesoamericana, vol. 1, 218–225. Universidad Nacional Auto´noma de Me´xico, Mexico

City, Mexico.

Claes, V. Kettmann, R. and Burny, A. 1994.  Structure of the gene encoding pig

phosphoglucose isomerase. Gene, 150: 235-241.

Cullings, K. W. 1992. Design and testing of plant-specific PCR primer for ecological and

evolutionary studies.  Molecular Ecology, 1:233-240.

Dahaloff, E.P. and Rank, N. E. 2000. Functional and Physiological Consequences of genetic

Variation at Phosphoglucose Isomerase: Heat Shock Protein Expression is related to

Enzyme Genotype in a Montane Beetle. PNAS, 97:10056-10061.

Doyle, J.J. and Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh

leaf tissue. Phytochemical Bulletin, 19: 11-15.

DRUMMOND, A., B. ASHTON, S. BUXTON, M. CHEUNG, A. COOPER, C. DURAN, M.

FIELD, ET AL. 2007. Geneious version 5. 4. Website http://www.geneious.com/.

[Accessed 3 March 2014].

Filatov, D. A., & Charlesworth, D. (1999). DNA polymorphism, haplotype structure and

balancing selection in the Leavenworthia PgiC locus. Genetics,153(3), 1423-1434.

Gillespie, J. F., 1991 The Causes of Molecular Evolution. Oxford University Press, New York.

Hall, J. G. 1985. Temperature-Related Kinetic Differentiation of Glucosephosphate Isomerase

Alleloenzymes Isolated from the Blue Mussel, Mytilus edulis.  Biochemical Genetics,

Vol. 23:705-727

Huelsenbeck, J. P., and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogenetic

trees. Bioinformatics, 17: 754-755

Ishikawa, H., Y. Watano, K. Kano, M. Ito, and S. Kurita. 2002. Development of primer sets for

PCR amplification of the PgiC gene in ferns. Journal of Plant Research, 115:65—70

Ishikawa, H., M. Ito, Y. Watano, and S. Kurita. 2003. Electrophoretic evidence for

homoeologous chromosome pairing in the apogamous fern species Dryopteris

nipponensis (Dryopteridaceae). Journal of Plant Research, 116: 165–167

Kawabe, A. Yamane, K. and Miyashita, N. T. 2000. DNA Polymorphism at the Cytosolic

Phosphoglucose Isomerase (PgiC) Locus of the Wild Plant Arabidopsis thaliana.

Genetics, 156:1339-1347

Koenemann, D. M. Maisonpierre, J. A. Barrington, D. S. 2011. Broad-Scale Integrity and Local

Divergence in the Fiddlehead Fern Matteuccia struthiopteris (L.) Todaro (Onocleaceae).

American Fern Journal, 101(4):0-0

McHenry, M. A. 2012. Systematics and Biogeography of Andean Ferns in the Genus

Polystichum Roth (Dryopteridaceae). Unpublished Dissertation. University of Vermont.

McHenry, M. A., & Barrington, D. S. (2014). Phylogeny and biogeography of exindusiate

Andean Polystichum (Dryopteridaceae). American journal of botany, 101(2), 365-375.

Rank, N. E. and Dahlhoff, E. P. 2002. Allele Frequency Shifts in Response to Climate Change

and Physiological Consequences of Allozyme Variation in a Montane Insect. Evolution,

56(11):2278-2289

Miller, M.A., Pfeiffer, W., and Schwartz, T. 2010. "Creating the CIPRES Science Gateway for

inference of large phylogenetic trees" in Proceedings of the Gateway Computing

Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp 1 - 8.

RIDDOCH, B. (1993). The adaptive significance of electrophoretic mobility in phosphoglucose

isomerase (PGI). Biological Journal of the Linnean Society, 50(1), 1-17.

Ronquist, F., and J P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under

mixed models. Bioinformatics, 19:1572–1574.

Rothfels, C. J., Larsson, A., Li, F. W., Sigel, E. M., Huiet, L., Burge, D. O., & Pryer, K. M.

(2013). Transcriptome-mining for single-copy nuclear markers in ferns. PloS one, 8(10),

e76957.

Terauchi, R., Terachi, T., & Miyashita, N. T. (1997). DNA polymorphism at the Pgi locus of a

wild yam, Dioscorea tokoro. Genetics, 147(4), 1899-1914.

Thomas, B. R., Laudencia-Chingcuanco, D., & Gottlieb, L. D. (1992). Molecular analysis of the

plant gene encoding cytosolic phosphoglucose isomerase. Plant molecular biology,

19(5), 745-757.

Thomas, B. R. Ford, V. S. Pichersky, E. and Gottlieb, L.D. 1993. Molecular Characterization of

Duplicate Cystolic Phosphpglucose Isomerase Genes in Clarkia and Comparison to the

Single gene in Arabidopsis. Genetics, 135: 895-905.

Watt, W. B. (1977). Adaptation at specific loci. I. Natural selection on phosphoglucose

isomerase of Colias butterflies: biochemical and population aspects. Genetics, 87(1),

177-194.

Wheat, C. W., Watt, W. B., Pollock, D. D., & Schulte, P. M. (2006). From DNA to fitness

differences: sequences and structures of adaptive variants of Colias phosphoglucose

isomerase (PGI). Molecular biology and evolution, 23(3), 499-512.

Wheat, C. W. Haag, C. H. Marden, J. H. Hanski, I. and Frilander, M. J. 2010. Nucleotide

Polymorphism at a Gene (Pgi) under Balancing Selection in a Butterfly Metapopulation.

Molecular biology and evolution, 27(2):267-287.

Figure 1: Gene structure for the regions of pgiC amplified for Andean Polystichum. Solid black boxes represent fully sequenced exons, rectangles with outlined in red indicate missing or partially sequenced exons. Black lines represent fully sequenced introns, the redline joining exons 13 and 14 represents intron 13 which we were unable to amplify. Exon and Intron numbers are based off of an alignment of Polystichum acrostichoides pgiC CDNA with Arabidopsis thaliani pgiC, therefore we are assuming that Polystichum pgiC introns 1, 2, 13, 19, 20, and 21 exist. We are also assuming that exons 1, 2, 3, 13, 14, 19, 20, 21 and 22 are not joined or further divided from one another.

Figure 2: Phylogeny of Andean Polystichum for all amplified regions of pgiC (exons 3-13 and 14-19 as well as their respective introns). Each number represents a variable character and its position in the final alignment. Green numbers represent homoplastic characters while black numbers represent single change characters. Characters that are highlighted are those that occur within the exons blue represents synonymous substitutions and red represents nonsynonymous changes. All nonsynonymous substitutions are marked by black letters and arrows representing the specific amino acid substitutions that occur at these sites, those that are highlighted in orange represent amino acids substitutions that result in a change in charge while those that are not retain the same charge. Letters are based off of the 1-letter IUPAC amino acid code. Characters that are not highlighted occur in the introns. Numbers next to taxa represent the meters above

sea level that each taxa was sampled from.

Figure 3: Phylogeny of pgiC exonic regions. Bayesian percent probabilities are located above branches, support was given when values were greater 50%. The scale bar represents 0.05 expected substitutions per site.

Figure 4: Phylogeny of pgiC intronic regions. Bayesian percent probabilities are located above branches, support was given when values were greater 50%. The scale bar represents 0.003 expected substitutions per site.

Figure 5: Trimmed chloroplast tree of Andean Polystichum (McHenry and Barrington 2014)

Primer Name Primer Sequence Annealing Temp (°C)

3F AGTGACAGCAGAAATCATGGAA 55

7R AAGCCGACGTCCTTTACAAG 55

6F AACTGGGAAACCATTGACTGATG 58

8R TCAATAGGATCCACATTTGCCA 58

7F TTGTAAAGGACGTCGGCTTC 57

10R ACGGCATCTGGACTGCAAAT 57

9F TGGATCACATCAGTCCTTGG 55

13R GGAGCTGTTTTGAAATGGTTGT 55

14F GGGTCTTTTGAGTGTTTGG 55

17RCCAATGAAATCACATGGAATAACAC

G 55

16F CTTAGTATGGAAAGCAATGGAAAGG 55

19R TTATGGGGCACCAAATGTTCC 55

Table 1: Primers developed in this study for the amplification of pgiC exons 3 - 13 and 14-19.

Exon Length (base pairs)Variable Characters

Informative characters

Nonsynonymous Substitutions

Synonymous Substitutions

3* 16* 0 0 0 0

4 77 2 1 2 0

5 156 2 1 1 1

6 97 3 1 1 2

7 43 1 0 0 1

8 68 0 0 0 0

9 85 3 2 0 3

10 49 3 1 0 3

11 73 1 0 0 1

12 61 2 1 0 2

13* 22* 0 0 0 0

14* 35* 0 0 0 0

15 54 2 1 1 1

16 129 2 1 1 1

17 64 2 1 0 2

18 74 1 0 0 1

19* 31* 1 1 1 0

Total 1134 25 10 7 18

Table 2: Exon size and nucleotide variation occurring in the pgiC gene in Andean Polystichum.

IntronLength (base pairs)

Variable characters

Informative Characters

3 77 10 4

4 113-124 10 0

5 86 7 1

6 84-85 6 3

7 503-533 28 12

8 92-96 7 2

9 67-68 5 2

10 134-146 3 2

11 88 4 1

12 91-92 5 2

14 92 3 2

15 207-391 14 5

16 80 5 0

17 78 3 2

18 138-183 13 8

Total 1930-2219 123 46

Table 3: Intron size and nucleotide variation occurring in the pgiC gene in Andean Polystichum.

Accession 41 2386 2391 2523 3077 210 1140 2065 2709 2769

M1076 orbiculatum G C T A C G A T A T

M1075 orbiculatum ? C T A C ? A T A T

M1087 gelidum G C T A C K R W D Y

M1051 polyphyllum G C T - C G G T A C

M1055 platyphyllum A T G A C G G T A T

M1037 platyXbulb R Y K W Y G G T A T

M1123 dubium G C T A C G G T A T

JC662 pallidum G C T A C G G T A T

M1117 stuebelii G C T - C G G T A T

Table 4: Heterozygotic nucleotides occurring in accessions of Andean Polystichum in the gene pgiC.