© Cengage Learning 2015 Effects of Environmental Toxicants Reach Down Through Generations A...

© Cengage Learning 2015

Effects of Environmental Toxicants Reach Down Through Generations A Washington State University researcher has demonstrated that a variety of environmental toxicants can have negative effects on not just an exposed animal but the next three generations of its offspring.The animal's DNA sequence remains unchanged, but the compounds change the way genes turn on and off -- the epigenetic effect studied at length by WSU molecular biologist Michael Skinner and expanded on in the current issue of the online journal PLoS ONE.While Skinner's earlier research has shown similar effects from a pesticide and fungicide, this is the first to show a greater variety of toxicants -- including jet fuel, dioxin, plastics and the pesticides DEET and permethrin -- promoting epigenetic disease across generations."We didn't expect them all to have transgenerational effects, but all of them did," Skinner said. "I thought hydrocarbon would be negative but it was positive too."This tells researchers that the ability to promote transgenerational disease is "not simply a unique aspect for a unique compound" but a characteristic of many environmental compounds.Researchers tested a pesticide mixture (permethrin and insect repellant DEET), a plastic mixture (bisphenol A and phthalates), dioxin (TCDD) and a hydrocarbon mixture (jet fuel, JP8).The field opens new ground in the study of how diseases develop. While toxicologists generally focus on animals exposed to a compound, Skinner's work further demonstrates that diseases can also stem from older, ancestral exposures that are then mediated through epigenetic changes in sperm.The work also points the way to identify and diagnose exposures through the use of specific epigenetic molecular markers."In the future we might be able to use these epigenetic biomarkers to determine your ancestral and personal exposure early in life and to predict your susceptibility to get a disease later in life," Skinner said.The study was funded by the U.S. Army to study pollutants that troops might be exposed to. Skinner and his colleagues exposed pregnant female rats to relatively high but non-lethal amounts of the compounds and tracked changes in three generations of offspring.The researchers saw females reaching puberty earlier, increased rates in the decay and death of sperm cells and lower numbers of ovarian follicles that later become eggs. Future studies can use the molecular tools for risk assessment analysis.


BiologyConcepts and Applications | 9eStarr | Evers | Starr


Chapter 14 Chapter 14

Human InheritanceHuman Inheritance


14.1 How Do We Study Inheritance Patterns In Humans?

• Pea plants and fruit flies are perfect for genetic studies because:– They have few chromosomes

– They reproduce quickly

– They can survive in lab conditions

– There are few ethical problems with their use


How Do We Study Inheritance Patterns In Humans?

• Humans involve more issues– Geneticists often use historical records

– Make charts (pedigrees of genetic connections)

• Allows geneticists to determine the probability that a trait will recur in future generations



• Types of genetic mutations– Single genes that follow Mendelian

inheritance patterns govern more than 6,000 genetic abnormalities and disorders

– Most human traits are polygenic, or influenced by multiple genes

– Traits can be influenced by environmental factors

– Alleles that give rise to severe genetic disorders are rare



• Six main patterns of inheritance for genetic abnormalities and disorders:– Autosomal dominant inheritance pattern

– Autosomal recessive inheritance pattern

– X-linked recessive inheritance pattern

– X-linked dominant inheritance pattern

– Changes in chromosome number

– Changes in chromosome structure



A

B


How Do We Know When A Trait Is Affected By An Allele On An Autosome?

normalmother

affected father

meiosisand gameteformation

affected child

normal child

disorder-causingallele (dominant)


How Do We Know When A Trait Is Affected By An Allele On An Autosome?

carriermother

carrier father


affected child

carrier child

disorder-causingallele (recessive)

normal child


How Do We Know When A Trait Is Affected By An Allele On An X Chromosome?

• X-linked recessive pattern – X-linked recessive disorders tend to appear in

men more often than in women• Men (XY) have only one X chromosome

• Women have two X chromosomes (XX), so they can be heterozygous for a recessive allele

– Men can transmit an X-linked allele to daughters, but not to sons – only a woman can pass an X-linked allele to a son



(green-deficient color blind)

dystrophin (muscular dystrophy)

(anhidrotic ectodermal dysplasia)

IL2RG (SCID-X1)

XIST X chromosome inactivation control

(hemophilia B)

(hemophilia A)

(red-deficient color blind)X



carriermother

carrier father


normal daughter or son

carrier daughter

recessive alleleon X chromosome)

affected son



You may have one form of red–green color blindness if you seea 7 in this circle instead of a 29.

You may have another form of red–green color blindness if you see a3 instead of an 8 in this circle.



• Hemophilia A– X-linked recessive disorder

– Interferes with blood clotting

– Involves factor VIII

– In the 19th century, it was relatively common in royal families of Europe and Russia


14.4 How Does Chromosome Structure Change?

• Mutations are small-scale changes in DNA sequence

• Chromosome mutations– Include duplications, deletions, inversions,

and translocations

– Have been evolutionarily important

– Tend to result in genetic disorders


How Does Chromosome Structure Change?

• Chromosome changes in evolution– Most major alterations are harmful or lethal in

humans

– Many major structural changes have accumulated in chromosomes of all species over evolutionary time

– Speciation occurs by large-scale changes in chromosomes


What Are The Effects of Chromosome Number Changes in Humans?

– Trisomy 21 (Down syndrome)• A normal gamete (n) fuses with an n+1 gamete

• New individual is trisomic (2n+1), having three of one type of chromosome and two of every other type

• Effects: Mild to moderate mental impairment; health problems such as heart disease; flattened facial profile; fold of skin on inner corner of eye; low muscle tone

• Occurs 1/700 births

• Risk increases with maternal age


What Are The Effects of Chromosome Number Changes in Humans?

Disorder Main SymptomsDown syndrome Mental impairment; heart defects

Turner syndrome (XO) Sterility; abnormal ovaries and sexual traits

Klinefelter syndrome XXY Sterility; mild mental impairment

XXX syndrome Minimal abnormalities

XYY condition Mild mental impairment or no effect


14.6 How Do We Use What We Know About Human Inheritance?

• Genetic screening– Can estimate probability that a child will

inherit a genetic disorder

– Pedigrees and genotype are analyzed by a genetic counselor

– Some disorders can be detected early enough to start countermeasures before symptoms develop

– More than 30 conditions detectable prenatally


How Do We Use What We Know About Human Inheritance?

• Newborn screening for phenylketonuria (PKU)– Newborns screened for mutations in the gene

phenylalanine hydroxylase, a defect that can cause phenylalanine to accumulate to high levels

– Results in imbalance that inhibits protein synthesis in the brain

– Causes severe neurological symptoms characteristic of (PKU)


How Do We Use What We Know About Human Inheritance?

• Prenatal diagnosis– Testing of an embryo or fetus can reveal

genetic abnormalities or disorders before birth• Obstetric sonography

• Fetoscopy

• Amniocentesis

• Chorionic villus sampling (CVS)

– Invasive procedure that can carry a risk to the fetus


BiologyConcepts and Applications | 9eStarr | Evers | Starr


Chapter 15 Chapter 15

BiotechnologyBiotechnology


What is DNA Cloning?

• Restriction enzymes– Cuts DNA wherever a specific nucleotide

sequence occurs

– Allows researchers to cut DNA into manageable chunks

– Allows for combining DNA fragments from other organisms

– Leave single-stranded tails

– Complementary tails will base-pair together


Restriction Enzyme• Cuts DNA at specific sites—depending on

enzyme.

• EcoR1 cuts DNA GAATTC

• PovII cuts DNA CAGCTG

• SmaI cuts DNA CCCGGG

• StuI cuts DNA AGGCCT

• Alul cuts DNA AGCT


ATCGTCGAACTGGGATCCGGTAAAGCTTTAAGGCCTTACGTTCCGGGAAGGTTCCGGATTAAGGCCTTAAGGTTTCCGATCGATCGATTCGATCCGGATATCGGTAATTCGAATTCGTGTCATCGTTACGCTTGCCGGAATTTCCGTATCGCCGGTTAATCTGAGACTACGGAGCATCGTAGTC


Use Enzyme Fournier1 which cuts CCGG

ATCGTCGAACTGGGATCCGGTAAAGCTTTAAGGCCTTACGTTCCGGGAAGGTTCCGGATTAAGGCCTTAAGGTTTCCGATCGATCGATTCGATCCGGATATCGGTAATTCGAATTCGTGTCATCGTTACGCTTGCCGGAATTTCCGTATCGCCGGTTAATCTGAGACTACGGAGCATCGTAGTC

Segments are 18, 26, 11, 40, 41, 17 and 31.

So, in order, you get banding at:

11, 17, 18, 26, 31, 40, 41



• DNA cloning mass produces specific DNA fragments – Fragments to be copied are inserted into

plasmids or other cloning vectors and inserted into host cells such as bacteria

• Host cells divide and make identical copies (clones) of the foreign DNA

• A huge population of clones can be grown



cutplasmid

recombinant plasmidplasmid

cloning vector

fragments of Chromosomal DNA

chromosomal DNA

A B C


15.2 How Do Researchers Study One Gene In The Context of Many?

• Genome– The entire set of genetic material of an

organism

– Consists of thousands of genes


DNA Sequencing

• Gel Electrophoresis – Separates fragments by length into bands

– Electric field pulls DNA fragments through semisolid gel

– Fragments of different sizes move at different rates

– Shorter fragments slip through the tangled molecules of the gel faster than longer fragments


Mixture of DNAfragments ofdifferent sizes

Powersource

Gel

Completed gel

Band oflongest(slowest)fragments

Band ofshortest(fastest)fragments

Figure 12.17-3


DNA Sequencing

• The Human Genome Project– Human genome consists of about three billion

nucleotide bases

– Celera Genomics invented faster methods of sequencing genomic DNA

– Human genome sequence completed in 2003, but could not be patented

– 50 years after discovery of DNA structure, human genome was complete


How Do We Use What Researchers Discover About Genomes?

• DNA profiling– Identifies a person by their DNA

• 99% of DNA is same among all humans

• A base pair variation >1% of population is called a single-nucleotide polymorphism (SNP)

– Examples include determining an individual’s array of SNPs on microscopic arrays


Selective Breeding


15.5 What is Genetic Engineering?

• Genetic engineering – Process by which an individual’s genome is

deliberately modified

– Produces a genetically modified organism (GMO)

• A gene may be altered and reinserted into an individual of the same species

• A gene from one species may be transferred to another to produce an organism that is transgenic

• Most common GMOs are bacteria


What is Genetic Engineering?

A

B

C



• Engineered microorganisms– GM bacteria:

• Produce medically important proteins such as insulin

• Produce enzymes used in food manufacturing, such as chymotrypsin

• Are used to improve taste of beer and fruit juice and slow bread from staling



• Genetically modified animals– Mice: used for medical research

– Goats: have proteins that treat cystic fibrosis, heart attacks, nerve gas exposure, etc.

– Rabbits: make interleukin-2

– Pigs: modified for heart-healthy fat and lower phosphate feces

– Trout and salmon: bigger versions

– Farm animals: produce more meat or milk



• Designer plants– Genetically engineered crop plants are

widespread in the U.S.

– Genes introduced by a tumor-inducing (Ti) plasmid from bacteria

• Transfers foreign or modified genes into food crop plants such as soybeans, squash, and potatoes

– May be resistant to diseases, offer improved yields, or make a protein (Bt) that is toxic to some insect larvae


A resistant gene from Bacteria was used.

In 1996, genetically modified soybeans were made commercially available. Current glyphosate-resistant crops include soy, corn, sorghum, canola, alfalfa, and cotton, with wheat still under development.

Genetically modified crops have become the norm in the United States. For example, in 2010, 70% of all the corn that was planted was herbicide-resistant; 78% of cotton, and 93% of all soybeans.



• GMO crops– Engineered for drought tolerance and nutrition

• Example: rice plants engineered to make β-carotene, a precursor of vitamin A, in their seeds

– Most widely planted GMO crops include: • Corn, sorghum, cotton, soy, canola, and alfalfa



• Concerns with GMOs– Transgenes can (and do) escape into the

environment

– Many people are opposed to any GMO crops or “Frankenfoods”

– Controversy raised by GMO use invites you to read the research and form your own opinions


15.6 Can We Genetically Modify People?

• Gene therapy– Gene is transferred into body cells to correct a

genetic defect or treat a disease

– Tested as a treatment for heart attack, sickle-cell anemia, cystic fibrosis, hemophilia A, Parkinson’s and Alzheimer’s diseases, several cancers, and inherited diseases

• Weigh potential benefits of genetically modifying humans against potential risks


Can We Genetically Modify People?

• Gene therapy – SCID-X1

• A severe X-linked disorder of the IL2RG gene, which codes for an immune-system receptor protein

• Affected children can’t fight infections, and only survive in germ-free isolation tents



• Gene therapy and SCID-X1 – In the 1990s, 20 boys with SCID-X1 were

treated with gene therapy• Researchers used a genetically engineered virus

to insert unmutated copies of IL2RG into cells taken from their bone marrow

– 18 were cured; five treated with gene therapy for SCID-X1 developed leukemia, and one died

– Is this OK? Acceptable?



• Eugenics– Idea of deliberately improving the genetic

qualities of the human race

– Uses methods to select the most desirable human traits

– Raises ethical issues• Engineer cuter babies, or “superhumans”?

• Prevent of obesity, aggressiveness, or homosexuality?


15.7 Personal Genetic Testing


Personal Genetic Testing

• Do you want to know your SNP profile?– Companies can extract DNA from saliva and

analyze it using a SNP-chip

– Results indicate estimated risks of developing certain diseases

– Personalized genetic testing is revolutionizing medicine

• Can cause people to make beneficial lifestyle changes

© Cengage Learning 2015 Effects of Environmental Toxicants Reach Down Through Generations A...

Documents

Transcript of © Cengage Learning 2015 Effects of Environmental Toxicants Reach Down Through Generations A...