© by author ESCMID eLibrary

Mechanisms of colistin resistance

Laurent Poirel

Emerging Antibiotic Resistance Unit, Medical and Molecular Microbiology, Department of Medicine, University of Fribourg, Fribourg, Switzerland

French INSERM European Unit, University of Fribourg (LEA-IAME), Switzerland

National Reference Center for Emerging Antibiotic Resistance (Switzerland) ESCMID eLibrary

©

by author

Colistin (Polymyxin E)

- Synthesis by Bacillus polymyxa spp colistinus- Discovered in the 1940’s- High rates of toxicity (mainly nephrotoxicity) : replacement by newer

antibiotics in 1980s- Renewed interest in mid-1990s to treat MDR Gram-negative

bacteria ESCMID eLibrary

©

by author

Colistin

Colistin is a cationic antibiotic that is composed of a cyclic heptapeptide covalently attached to a fatty acyl chain

+ -

Lipopolysacharide (LPS) of Gram-negative bacteria is composed by :- Lipid A- Core- Oligosaccharide O

Lipid A

Mechanism of action

ESCMID eLibrary

©

by author

Mechanism of action (2)

1. Fixation

2. Displacement of divalent cation (Ca2+ et Mg2+)

4. Penetration throughout the inner membrane and inhibition of the respiratory enzymes NDH2

3. Destabilisation of the outer membrane of Gram negatives

Falagas et al, Clin Infect Dis. 2005Deris et al, J Antibiot. 2013

ESCMID eLibrary

©

by author

Susceptible bacteria :

Pseudomonas aeruginosa, A. baumannii, E. coli, Klebsiella spp., Enterobacter spp.

H. influenza, Bordetella pertussis

Salmonella spp., Shigella spp.

Legionella, Stenotrophomonas maltophilia

Some Mycobacterium species, and in particular M. tuberculosis

Non-susceptible bacteria :

All gram positives

Gram neg cocci: N. gonorrhoeae, N. meningitidis

Proteus group, Serratia spp., Burkholderia spp., Brucella spp.

Anaerobes

Spectrum of activity

ESCMID eLibrary

©

by author

Capsule

LPS

Outer

membrane

Efflux

pump

Porin

Mechanisms of polymyxin resistance

ESCMID eLibrary

©

by author

Interaction between periplasmic proteins (YdeI and YgiW) and porins OmpD and OmpF, described in Salmonella enterica

Pilonieta et al, J Bacteriol. 2009

Role of porins in polymyxinresistance

ESCMID eLibrary

©

by author

Potassium antiport system, described in Yersinia pseudotuberculosis

Mutant acrAB significanty more susceptible to polymyxin B thanthe wild-type strain, described in K. pneumoniae

Bengoechea et al, Mol Microbiol. 2000

Padilla et al, AAC. 2010

Role of efflux in polymyxin resistance

Mutant KpnEF significanty more susceptible to colistin than the wild-type strain, described in K. pneumoniae

Srinivasan et al, AAC. 2010 ESCMID eLibrary

©

by author

Hyperproduction of CPS :

Upregulation of capsular biosynthesis genes reduce the interactions of polymyxins with its binding sites on the LPS,described in Klebsiella pneumoniae

Release of CPS :

Release of CPS is able to trap or bind to polymyxins reducingthe quantity of polymyxins that reaches the bacterial cellsurface, described in Klebsiella pneumoniae

Campos et al, Infect immun. 2004

Llobet et al, Microbiology. 2008

Role of capsule in polymyxin resistance

ESCMID eLibrary

©

by author

Role of LPS in polymyxin resistance

Loss of LPS :

Inactivation of lipid A biosynthesis genes (lpxA, lpxC and lpxD) cause loss of LPS and prevent the interactions of polymyxins withits binding sites on the LPS, described in A. baumannii

LPS modifications : the main mechanism of resistance to colistin :

Addition of 4-amino-4-deoxy-L-arabinose (LAra4N) and / or phosphoethanolamine (pEtN) to lipid A Increase of positive charges decreased affinity for LPS

Synthesis of L-Ara4N and pEtN mediated by PmrA / PmrB, PhoP / PhoQ, and mgrB gene

Moffatt et al, AAC. 2010-2011

ESCMID eLibrary

©

by author

Target of colistin : LPS

Mg2+ and Ca2+

displacement

Detergent effect ESCMID eLibrary

©

by author

Modification of the chemical structure of the LPS

Modifications :

- Addition of phosphoethanolamine(pEtN)

- Addition of 4-amino-4-deoxyl-L-arabinose (Ara4N)

Adaptation against hostile environment

Lower affinity for cationic moleculessuch as colistin :

polymyxin resistance ESCMID eLibrary

©

by author

LPS modification

Gunn et al, Trends Microbiol. 2008

LAra4N

pEtN ESCMID eLibrary

©

by author

Interplay of resistance mechanisms in Klebsiella pneumoniae

Poirel et al., Clin Microbiol Reviews 2017

ESCMID eLibrary

©

by author

phoP

Acquired resistance to colistin in K. pneumoniae

ESCMID eLibrary

©

by author

phoP

Heteroresistance to colistin in K. pneumoniae

Colistin-resistant subpopulation

NETCSΔ25ntAsp191Tyr CS RCS S CS S

CS HeteroR ESCMID eLibrary

©

by author

Plasmid-mediated resistance

MCR : Mobilizable Colistin Resistance Phosphoethanolamine transferase (permanent modification of the lipid A)

ESCMID eLibrary

©

by author

The MCR-1 protein; a phosphoethanolamine transferase

- A 16-fold increase in MIC of polymyxins (colistin and polymyxin B)

- From 0.5 µg/ml (recipient E. coli) to 8 µg/ml (transconjugant) ESCMID eLibrary

©

by author

Emergence of plasmid-mediated carbapenem and colistin resistance in

E. coli in Europe

- Patient hospitalized in Switzerland, December 2015

- No history of travel abroad

- No colistin-based treatment

- Urinary tract infection

- E. coli isolate being resistant to carbapenems, fluoroquinolones, aminoglycosides (except amikacin), chloramphenicol, trimethoprim-sulfamethoxazole, and colistin (MIC of 4 µg/ml)

- Metallo-ß-lactamase VIM-1 + phosphoethanolamine transferase MCR-1

Poirel, Kieffer, Liassine, Thanh, Nordmann, Lancet Infect Dis 2016

ESCMID eLibrary

©

by author

- 7 clonally-unrelated colistin-resistant E. coli isolates recovered from clinical samples in South Africa

- All mcr-1 positive

- Different plasmids were described- Two different plasmids fully sequenced and

assembled ESCMID eLibrary

©

by author

MCR-1-producing isolates

ESCMID eLibrary

©

by author

Comparative analysis of sequenced plamids

ESCMID eLibrary

©

by author

mcr-1 is located on different plasmid backbones

An identical 2,600 bp DNA sequence was systematically identified onto the different plasmid backbones, comprising mcr-1

Insertion sequence ISApl1 was located uptsream of the mcr-1 gene, but not systematically

Comparative analysis of sequenced plamids

IncX4

IncI2

IncI2

IncP

ESCMID eLibrary

©

by author

Identification of the mcr-1 promoter

Identification of the +1 of transcription by 5’RACE-PCR

The promoter of mcr-1 was deduced in sillico

ESCMID eLibrary

©

by author

Identification of the +1 of transcription by 5’RACE-PCR

The promoter of mcr-1 was deduced in sillico

Identification of the mcr-1 promoter

ESCMID eLibrary

©

by author

Where do MCR enzymes come from ?

ESCMID eLibrary

©

by author

MCR-1

MCR-2

Campylobacter jejuni EptA

Acinetobacter baumannii EptA

Pseudomonas aeruginosa EptA

Vibrio cholerae EptA

Enterobacter cloacae EptA

Klebsiella pneumoniae EptA

Kluyvera ascorbata EptA

Escherichia coli EptA

Pasteurella multocida EptA

Neisseria gonorrhoeae LptA

Neisseria meningitidis LptA

Moraxella osloensis MCR-OSL

Enhydrobacter aerosaccus EptA

Moraxella porci MCR-POR

Moraxella lincolnii MCR-LIN

Moraxella catarrhalis MCR-CAT

Morganella morganii EptA

Enterobacter cloacae EptB

Moraxella species as sources of MCR-like determinants

Kieffer, Nordmann and Poirel, Antimicrob Agents Chemother; in press

ESCMID eLibrary

©

by author

Moraxella species as sources of MCR-like determinants

MCR-1 MCR-2 MCR-POR MCR-OSL MCR-LIN

MCR-2 81%

MCR-POR 63% 62%

MCR-OSL 63% 64% 62%

MCR-LIN 59% 60% 59% 59%

MCR-CAT 59% 60% 59% 59% 99%

Kieffer, Nordmann and Poirel, Antimicrob Agents Chemother; in press

ESCMID eLibrary

©

by author

How is the mcr-1 gene acquired ?

ESCMID eLibrary

©

by author

ISApl1 mcr-1 ISApl1orf

ESCMID eLibrary

©

by author

ISApl1 blaTEM-1 ISApl1orf

BamHIEcoRISacI

NheI


ESCMID eLibrary

©

by author


ISApl1 blaTEM-1 ISApl1orf

BamHIEcoRISacI

NheI

ISApl1 orf


blaTEM-1

blaTEM-1 ESCMID eLibrary

©

by author

ISApl1 ISApl1orf

GCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAG

CTACCGGCGCGATG

CTACCGGCGCGATG

TTTATTCCGCTAAAAAACTGGTATAAGAATGGAAAAATTTGAAATCCGCGTTTAAAAAGGACTAATAACA

CTGAAAATACATTTTCAAAACTGATTTTTGATGATATTAAAATAATTTTGGAGTTTTTATCTGATTATTG

IRL IRRDR DR

Tn6330.2

blaTEM-1

mcr-1 is mobilized through a composite transposon

Poirel, Kieffer, & Nordmann, Antimicrob Agents Chemother; in press

ESCMID eLibrary

©

by author

Contribution of MCR-1 in resistance to colistin

Jayol et al., Submitted for publication

p41331; plasmid carrying the mcr-1 gene

ESCMID eLibrary

©

by author

Bacterial colonies on the SuperPolymyxin medium

EMB medium :

- distinguish lactose fermenters (colored colonies) of lactose non-fermenters (colorless or light lavender colonies)

- lactose positive E. coli : characteristic metallic green sheen

Polymyxin-resistant K. pneumoniae.

Polymyxin-resistant lactose-positive E. coli.

Polymyxin-resistant lactose-negative E. coli.

Mix of a heavy inoculum of P. mirabilis anda low inoculum of polymyxin-resistant K. pneumoniae.

ESCMID eLibrary

©

by author

Strains tested

Gram negative strainsN=88

Colistin-susceptible(CS MICs ranging from

0.12 to 2 mg/l)N=36

Colistin-resistant(CS MICs ranging from

4 to > 128 mg/l)N=52

Intrinsic resistance(Proteus, Morganella, Providencia,

Serratia, Burkolderia)N=7

Acquired resistance(various mechanisms of resistance)

(E. coli, Klebsiella, Enterobacter, Hafnia,Acinetobacter, Pseudomonas, Stenotrophomonas)

N=45 ESCMID eLibrary

©

by author

Results

Polymyxin-resistant strains grow on the SuperPolymyxin mediumin 24h, except P. aeruginosa, S. maltophilia and Burkolderia spp.that grow in 24 to 48h.

Lowest limit of detection of the tested strains :

- below the cut-off value of 103 CFU/ml for all the polymyxin-resistant strains

- higher than 106 CFU/ml for all the polymyxin-susceptible strains

Sensitivity and specificity of the SuperPolymyxin medium : 100%,regardless of the nature of the polymyxin resistance mechanism(intrinsic, chromosomally or plasmid-encoded) and of its level(high or moderate). ESCMID eLibrary

©

by author

SuperPolymyxin medium = screening medium aimed to detect anypolymyxin-resistant Gram negative bacteria regardless of itsresistance mechanism and of its level.

May be used in :

- human medicine for detecting carriers (stools, rectal swabs)

- in veterinary medicine for epidemiological surveys

- May be used for isolated bacteria, but also clinical samplesincluding tools

Will be commercialized soon (ELITech company, France)

Might help to contain outbreaks due to polymyxin-resistantisolates and thus at least in part preserve the efficacy ofpolymyxins as last resort antibiotics.

Nordmann P, Jayol, Poirel L. A universal culture medium for screening polymyxin-resistant gram negatives. J Clin Microbiol. 2016

ESCMID eLibrary

©

by author

Need for a rapid test that maycategorize (even before MIC

determination) or confirm (in case of growth onto the SuperPolymyxin

medium) the occurrence of polymyxin resistance

ESCMID eLibrary

©

by author

• This test is based on the detection of the glucosemetabolization related to bacterial growth in presence of adefined concentration of colistin.

• Formation of acid metabolites consecutive to the glucosemetabolization was evidenced by a color change (orange toyellow) of a pH indicator (red phenol).

• In the Polymyxin NP solution with colistin :

- Strains susceptible to colistin are dead : test

- Strains resistant to colistin are alive : test

Test principle

neg

pos ESCMID eLibrary

©

by author

Lecture and interpretation

NaCl alone

CS S bacterial

suspension (control -)

CS R bacterial

suspension (control +)

Bacterial suspension

to test

Colistin-free solution

Colistin-containing solution

The strain tested is colistin resistant

• Visual inspection of the tray every hour during 2 hours.

ESCMID eLibrary

©

by author

Strains tested

Enterobacterial strainsN=200

Colistin-susceptible(CS MICs ranging from

0.12 to 2 mg/l)N=65

Colistin-resistant(CS MICs ranging from

4 to > 128 mg/l)N=135

Intrinsic resistance(Proteus, Morganella, Providencia, Serratia)

N=5

Acquired resistance(E. coli, Klebsiella, Enterobacter)

N=130

Chromosomally-encoded(pmrAB, phoPQ, mgrB alterations)

N=23

Plasmid-mediatedmcr1-gene

N=7

Unknown mechanismN=22 ESCMID eLibrary

©

by author

Results

• Isolates intrinsically resistant to colistin :

Positive results.

• Isolates with acquired resistance to colistin :

Positive results, except a single colistin-resistant E. coli isolate withCS MIC at 8 mg/l and an unknown mechanism of resistance.

• Isolates susceptible to colistin :

Negative results, except for 3 isolates with CS MICs of 1 to 2 mg/l.

• Results within 2 hours.

• High correlation between colistin resistance and positivity ofthese Rapid Polymyxin NP and conversely, colistin susceptibilityand negativity of the test :

Sensitivity = 99.3 % and Specificity = 92.3 %, compared to Brothmicrodilution method.

ESCMID eLibrary

©

by author

Rapid Polymyxin NP test directly from blood cultures

T = 4h

Positive blood culture

PROTOCOL:

- Ten-fold dilution of the positive

blood culture in NaCl 0.9%

- Polymyxin NP test

NEGATIVE

T = 4h

Colistin-susceptible strain Non enterobacterial strain

GRAM: Gram negative rods

In 450 µl of

NaCl 0.9 %

50 µl of

blood culture

Aerobic or

anaerobic

vial

50 µl of

ten-fold dilution

UNINTERPRETABLE

T = 2-4h

Colistin-resistant strain

POSITIVE

ESCMID eLibrary

©

by author

Conclusion

Multiple advantages of the Rapid Polymyxin NP test :

• Reliable

• Detects colistin-resistant enterobacterial strains from any speciesregardless the molecular mechanism of resistance to polymyxins(intrinsic, chromosomic and/or plasmid-mediated).

• Easy to perform

• Rapid (within 2 hours from bacterial colonies and within 4 hoursfrom blood cultures)

• Now available as an industrial product (ELITech MICROBIO,France)

Nordmann P, Jayol, Poirel L. Rapid detection of polymyxin resistance in ENterobacteriaceae. Emerg Infect Dis. 2016.

ESCMID eLibrary

©

by author

General conclusion

- Multiplicity of resistance mechanims

- Plasmid-mediated resistance to polymyxins represents the main threat nowadays

- Monitoring the resistance rates to colistin is crucial

- This must be done for human but also animal isolates

- Adequate breakpoints must be defined accurately

- Available screening media and detection techniques must beimplemented ESCMID eLibrary

©

by author

© by author ESCMID eLibrary

Documents

Transcript of © by author ESCMID eLibrary