Assessment: More than just grades Brian Couch University of Nebraska-Lincoln Kate Semsar University...
-
Upload
justin-boyd -
Category
Documents
-
view
213 -
download
0
Transcript of Assessment: More than just grades Brian Couch University of Nebraska-Lincoln Kate Semsar University...
Assessment:More than just grades
Brian CouchUniversity of Nebraska-Lincoln
Kate SemsarUniversity of Colorado-Boulder
Adapted in part from materials by Clarissa Dirks (Evergreen State College), Michelle Withers (West Virginia University), and Jenny Knight (University of Colorado-Boulder)
Assessment as a learning tool
“Ongoing assessment plays a key role – possibly the most important role – in shaping classroom standards and increasing learning gains.”
Black and Wiliam, 1998
Learning Objectives
You will be able to…
Distinguish between formative and summative assessment
Use Bloom’s Taxonomy to evaluate learning objectives and assessments
Use backward design to align learning outcomes with formative and summative assessments
Demonstrate the different possible uses of formative assessments
Discuss the uses of concept assessments
Think-Pair-Share
How do you know when you know something?
How do you know when your students know something?
How do your students know when they know something?
Assessment provides a means for gauging student understanding.
In your opinion, what is the role of assessment?
Share your ideas with your group. Write your ideas on whiteboards.
Individual
Purposes of assessment
Assessment provides meaningful information for instructors and students
Instructor: - communicates course expectations- can determine level of student mastery- can use information to inform teaching practices
Student: - clarifies course expectations- can determine own level of mastery- can identify areas for improvement
Different types of assessment
Summative assessment vs. Formative assessment
What’s the difference?
Assessment spectrum Assessment spectrum
Summative assessments: provide information about mastery
Exams, papers, presentations Typically occur at the end of teaching Usually part of grade for the class
Formative assessments: provide feedback to both the instructor and students during the learning process
In-class work, homework, pre-class online assignments
Can be for a grade or for participation
Different types of assessment
Assessment with a purpose
What shouldstudents know or be able to doby the end of your course?
How will you know if they
get there?
What will youdo to getthem there?
Learning goals Summative assessments
Learning activities(including formative
assessments)
Backward Design:Learning goals drive assessment and instruction
Alignment is key!
Learning Goal: Broad description of what students will understand and learn: not necessarily assessable with single question.
Example: Understand how chromosomes align and separate during the process of meiosis (the production of sperm/egg cells)
Learning Objective: specific, action-oriented description of what students will be able to do: assessable.
Example: Predict the probability of a certain phenotype among children of two individuals, one with a sex chromosomal abnormality
Terminology review
Review: Bloom’s Taxonomy
Order these from lowest to highest order; discuss with neighbors
(1) Knowledge, (2) Comprehension,
(3) Application, (4) Analysis,
(5) Evaluation, (6) Synthesis
1. Compare the mechanisms for regulating transcription in bacteria and eukaryotes.
2. Define transcription.
3. Design an experiment to determine whether all of an organism's mRNA sequences are encoded in its DNA.
4. Describe the process by which nucleotides are added to the RNA.
5. Predict the possible affects on protein function as a consequence of a specific mutation in the DNA
6. Diagram a DNA duplex in the process of transcription showing base-pairing and strand polarity for all polynucleotides.
The best order (from lowest order to highest order) is:a)4,2,1,3,5,6b)2,4,6,5,1,3c)6,2,4,5,3,1d)2,1,5,6,4,2e)2,4,1,6,5,3
Practice recognizing Bloom’s levels
Apply to your own course
Use Bloom’s Taxonomy to evaluate objectives and assessments
Use the principles of backward design to align learning outcomes with summative assessments
What is your level of experience with learning objectives?
A. I didn’t know what they were until I started reading “Scientific Teaching.”
B. I am familiar with them but have not used them in my courses.
C. I write learning objectives for my courses and use them only for myself.
D. I write learning objectives for my courses and share them with my students.
Activity: Learning objectives and assessments
PART I: Blooming your objectives
Find (or make up on the spot) one or more learning objective(s) for a topic you teach
“Bloom” the level of your objective (independently)
Now share with your neighbor. Do you agree with each other’s ratings? Group reflect: what kinds of problems arose in
your discussion?Use the Bloom’s table in your binder
Learning Goal Learning Objective(content + behavior)
Summative Assessment(exam question)
What will students learn?
If they have learned it, what will students know and be able to do?
How will students demonstrate they know it or are able to do it?
Students will understand the transfer of information from DNA to proteins
Deva has cystic fibrosis. By looking at this section of her DNA sequence and comparing it to her mother’s DNA sequence, find her mutation, and predict the amino acid sequence that will result. Suggest a different DNA mutation in the same codon that would NOT have resulted in cystic fibrosis
Predict changes in amino acid sequences caused by mutations
Alignment Table
PART II: Aligning objectives/outcomes with assessments
Find an exam question that you think addresses the objective you were just discussing.
Share the question with your neighbor. Is your question aligned with your learning objective?
How can you tell?
If your neighbor and you disagree on the alignment, why?
Bloom’s in practice
Return to the exam questions that you just aligned with objectives
Modify your original learning objective and exam question so that they are both at a higher level than they were before. If they were already at a the highest level, practice rewriting them to a lower level.
What were some key strategies you used to level-up or level-down?
Alignment of exams with concept maps
How helpful for your learning were the concept maps?
1
2
3
4
Course
Alignment of exams with concept maps
“The concept maps were very helpful for exam 3 and 2 because the test questions were more congruent with the use of the concept maps. The first test was more matching, and the concept maps did not really help with that as much.”
“I did not find them useful most of time but thought they were a form of busy work.”
How helpful for your learning were the concept maps?
1
2
3
4
Course
Alignment of exams with concept maps
“The concept maps were very helpful for exam 3 and 2 because the test questions were more congruent with the use of the concept maps. The first test was more matching, and the concept maps did not really help with that as much.”
“I did not find them useful most of time but thought they were a form of busy work.”
How helpful for your learning were the concept maps?
1
2
3
4
Course
What kinds of questions do you usually use on exams/final assessments?
A. Multiple choice
B. Free response (short, drawing)
C. Long essays
D. A mixture of the above
E. Papers, or other
Add formative assessment to your aligned objective and exam question
Learning Goal
Learning Objective
Summative Assessmen
t
(Learning Activity)
Formative Assessment
What will students learn?
If they have learned it, what will students know and be able to do?
How will students demonstrate they know it or are able to do it?
What will students do to learn it?
Assessments can be used throughout an instructional unit.
Time
pre-class
in-class worksheet
unit examhomework
assignment
clickerquestions
practicequestions
in-class worksheetpre-class
homeworkassignment
Assessment throughout the learning cycle
What are concepts or skills that your students need to know when they enter your course in order to be successful?
To what degree are you confident that students have an adequate level of mastery of these concepts and skills?
Individual: Pre-Assessment
What are some ways that we can collect information about incoming student knowledge?
List a few ideas on whiteboards
Group: Pre-Assessment
Assessments allow opportunities for “deliberate practice”
The information obtained from assessments can help students know where they are at and figure out where they need to go
K. Anders Ericsson
EnGaugements
When you ask a student to do something, they are simultaneously engaged in learning and can gauge their progress by whether or how well they can perform.
– Handelsman et al.Scientific Teaching.
Assessment helps determine whether instruction is at the appropriate level
It is very important to learn about traxoline. Traxoline is a new form of zionter. It is montilled in Ceristanna. The Ceristannians found that they could gristerlate large amounts of fervon and then bracter it to quasel traxoline. This new, more efficient bracterillation process has the potential to make traxoline one of the most useful products within the molecular family of lukizes snezlaus.
QUIZ:
1. What is traxoline?
2. Where is it montilled?
3. How is traxoline quaseled?
4. Why is traxoline important?
The Montillation of Traxoline
Assessment also communicates course expectations.
AND/ORthink they know something but don’t!
Incorrect Conceptions Private Universe Minds of our Own Tiny World
People often don’t know what they know
What are some of the incorrect ideas that people expressed?
Assessments help students distinguish what they know and don’t know
Example method: Group brainstorm
3’CGTTTTACCAAACCGAGTACTGAG
5’GCAAAATGGTTTGGCTCATGACTC
TRP-PHE-GLY-SER
As a group, write down what you know about DNA and proteins on one side of the white board. On the other side, write what else you need to know to be able to answer this question.
Which nucleotides are responsible for this particular sequence of amino acids?
Genetic diseases, like Phenlyketonuria (PKU), confirm that there is a link between an individual’s DNA and that individual’s proteins.
Below is a DNA molecule and the amino acid sequence that would result from translating the DNA sequence.
Assessments can aid in the construction of new knowledge
Example method: Group work followed by
report-out
Based on your understanding of natural selection and traits that vary along a continuum:
1. Explain the changes that occurred in the tree and dinosaur populations over time.
2. Based on your knowledge of evolution, propose a plausible mechanism by which the tree and dinosaur populations can change over time.
(AAAS 1999)
These represent theaverage for an entirepopulation
Certain misconceptions
appear consistently across years and
impede the development of
conceptual mastery
Students hold a wide range of different conceptions
Fraction of students answering correctly in two
consecutive semester
r = 0.93
Couch, Wood, Knight (2015) CBE-Life Sci Educ.
Assessments can help students confront misconceptions
Example method: clickers
As the acorn grows into the tree, from where does the majority of the biomass
come?A. Air
B. Soil
C. Water
D. Sun
Formative Assessment Type
Pre-Class In-Class Post-Class
Perc
ent S
tude
nts
Key Factors- Logistics- Alignment- Follow-through
A great resource for finding
different ideas for formative
assessment
Formative assessment in practice
What is an area of your course where you think you and your students might benefit from formative assessment?
What type of assessment would you administer? What information would it provide to you and the students? How might you use this information to alter your teaching?
Additional tools: Concept assessments
• Typically multiple-choice or multiple-T/F format• Measure conceptual understanding, not just facts• Focus on critical concepts that faculty value• Use common misconceptions as distractor items• Rigorously developed and tested with student interviews
A link to a comprehensive list of concept assessments across STEM disciplines:http://www.asbmb.org/uploadedFiles/Education/TeachingStrategies/Concept_Inventory/Concept%20Inventories%202%202%202015.pdf
Example of use of concept assessments: objectively measure learning gain
Genetics Concept Assessment (GCA)
Smith, Wood, Knight, 2008. The Genetics Concept Assessment: A New Concept Inventory for Gauging Student Understanding of Genetics. CBE Life Sci. Educ. 7, 422-430.
25 multiple choice questions that address 9 Learning Goals commonly cited by faculty as critical for student understanding of genetics
Students take the GCA on the first day of class (pre) and again at the final (post)
Perc
en
t C
orr
ect
Post testPre-test
Course
post test higher than pretest(p<0.05 in all cases)
Subset of GCA Questions are still difficult on post test
Perc
en
t C
orr
ect
Post testPre-test
Question Number
These areas can be targeted for instructional
change
Assessing attitudes and skills
Affective domain: http://www.asbmb.org/uploadedFiles/Education/TeachingStrategies/
Concept_Inventory/Student%20Views%20Attitudes%20Affective%20Instruments%201%2011%202015.pdf
Science process skills:http://www.asbmb.org/uploadedFiles/Education/TeachingStrategies/
Concept_Inventory/Student%20Skills%20Inventories%201%2011%202015.pdf
Program for Assigning Student Groups
www.catme.org