Post on 25-May-2015
An update on DNA barcoding of human pathogenic fungi
Meyer, W1, Serena, C1, Firacative, C1, Kröger, B1, Arabatzis, M2, Robert, V3, de Hoog, S3, Balajee, A4, Velegrak, A2
1 Molecular Mycology Research Laboratory, Sydney Medical School – Westmead, University
of Sydney, Westmead Millennium Institute, Westmead Hospital, Westmead, NSW, Australia 2 Medical School, University of Athens, Athens, Greece 3 CBS-Fungal Biodiversity Center, 3508 AD Utrecht, The Netherlands4 Mycotic Diseases Branch, Centers for Disease Control and Prevention, Atlanta, GA, USA
E-mail: w.meyer@usyd.edu.au
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Major Issues in Medical Mycology
• Constant increase in invasive fungal infections
• Insufficiency of the current identification techniques (morphology/physiology)
• Limited available therapies • Emergence of resistant fungal strains
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Urgent need to improve fungal identification to enable a substantial improvement in clinical diseases outcome!Urgent need to improve fungal identification to enable a substantial improvement in clinical diseases outcome!
Blastomycoses
Zygomycoses
Candidiasis
© D.Ellis
© S. Chen
© D.Marriott
Sequence based identification strategies are the new “gold standard” for species ID
However, there are major problems with sequence based ID:
(A) Lack of a universally accepted appropriate genetic locus
(B) Lack of quality controlled sequence databases
(C) Arbitrary defined cut-off points for species ID
Molecular diagnostic tools
Achieve rapid and accurate detection and identification of fungi from cultures or clinical specimens
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
COX1 Alternative loci:
ITS1/2 region D1/D2 LSU rDNA geneHistone spacerTUBACTElongation FactorAFTOL genes: RNA polymerase genes RPB1
RPB2
does not work for many fungi
A DNA Barcode for fungi?
used since the 1990’s
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
LSU data show coinciding similarities among species!
ACT1 data resolved all investigated species!
LSU, COX1, RPB1 and RPB2, ACT1© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
The International Sub-commission on Fungal Barcoding has proposed the ITS region as the prime fungal barcode or the default region for species identification (http://www.allfungi.com/its-barcode.php).
Fungal specific primers: SR6R: 5’ AAGTATAAGTCGTAACAAGG 3’LR1: 5’ GGTTGGTTTCTTTCCT 3’
[Vilgalys & Hesters (1990) J. of Bacteriol. 20: 4238-4246]
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Steps towards a Fungal DNA barcode- - All Fungi Barcode of Life Planning WorkshopSmithsonian Conservation and Research Center, Front Royal, Virginia 13-15 May 2007
- Fungal DNA barcoding meeting Amsterdam April 2011 Large multi-centre and multi national study [ITS, LSU, SSU, RPB1 {RPB2, MCM7}]ITS, LSU, SSU, RPB1 {RPB2, MCM7}] (Conrad Schoch, Keith Seifert, John Spouge, Vincent Robert, Elena Bolchacova & more than 130 global colaborators )
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Pezizomycotina Basidiomycota Saccharomycotina Basal AllPezizomycotina Basidiomycota Saccharomycotina Basal All
John Spounge, NCBI
18S rDNA or SSU 5.8S rDNA 28S rDNA or LSU 1800 bp 159 bp 3396 bp
IGS ITS 1 ITS 2 IGS 361 bp 231 bp
D1 D2 D3 D4/5 D6/7a/7b D8 D9/10 D11/12 V1/2 V3/4 V5 V7 V8 V9
SR1R SR6R/ITS1
5.8S/ITS2
ITS3 LR1/ITS4
LROR LR12LR16
• RPB1 consistently produced the best results, followed by ITS
• Multigene combinations had slight improvements
• Ease of amplification makes the ITS the current best compromise choice for a fungal DNA barcode
Outcomes
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Schoch et al. The internal transcribed spacer as a universal DNA barcode marker for fungi. Submitted to PNAS October 2011Schoch et al. The internal transcribed spacer as a universal DNA barcode marker for fungi. Submitted to PNAS October 2011
35733573
56675667
1 1 23 23
10 10
13.1.2009
3863 Fungal Barcodes13.1.2009
3863 Fungal Barcodes
4.8.2010
6047 Fungal Barcodes4.8.2010
6047 Fungal Barcodes
13.4.2011
7813 Fungal Barcodes13.4.2011
7813 Fungal Barcodes
29.11.2011
9274 Fungal Barcodes29.11.2011
9274 Fungal Barcodes
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
If medical fungi are blasted:
e.g. Candida albicans
no results !!!!!!
www.boldsystems.org
ITS1/2 region
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
~172,000 full-length fungal ITS sequences are available in Genbank
PROBLEMS
many sequences containing mistakes:
limited taxonomic coverage.
the total number of currently available fungal ITS sequences, represents less than 1% of the estimated 1.5 million fungal species
• as a result of experimental errors • misidentification of the species• exchange of cultures
Public databases: GenBank = EMBL = DDJB
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Comparative sequence based identification is only
meaningful if:
• well-curated, robust and reliable databases are available • that are populated with sequence data from:
• the strains have been rigorously validated in terms of
their nomenclature
type or reference strains (where possible) a wide range of clinical strains a wide variety of target species
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
New Quality controlled ITS sequence database at the Molecular Mycology Research Laboratoryat: http://www.mycologylab.org/BioloMICSID.aspx
1
23
4
5
67
8© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
• ITS database of Medical Fungi at: http://www.mycologylab.org 476 strains representing 182 human pathogenic fungal species (of 200 species which cause commonly human/animal diseases from the 1.5 Mill fungal species estimated to exist)
• Quality controlled in-house ITS data offer a higher accuracy and better predictive value for the correct identification of clinically important fungi than GenBank
• Other well-curated ITS database e.g. are:
Need to be integrated into BOLD
Quality Controlled Database
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Established: January 2010
Founding Coordinators: A/Prof. Wieland Meyer (University of Sydney, Australia)
Prof. Sybren de Hoog (CBS-KNAW, The Netherlands)
Dr. Arun Balajee (CDC, USA)
Current Coordinators: A/Prof. Wieland Meyer (e-mail: w.meyer@usyd.edu.au)
Prof. Sybren de Hoog (e-mail: s.hoog@cbs.knaw.nl)
Objectives: (1) to establish a medical barcode database as part of BOLD by incorporating the different already existing fungal group specific databases,
(2) to extend the number of quality controlled ITS sequences to cover all medical
important fungi over the next 3 years,
(3) to incorporate this sequences into BOLD, and
(4) to achieve a special status as quality controlled reference sequences for those
sequences within Genbank.
Membership: The working group is open to everybody who is interested on molecular identification of pathogenic fungi.
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
University of Aix Marseille
University of Sydney
CBS
Institute Pasteur
ParisOthers
Joined ITS Database for
Human/Animal Pathogenic
Fungi
Major outcomes of the first meeting of the working group: TIMM5 2-5.10.2011 Valencia, Spain
BOLDBOLD GenbankGenbank
Incorporating Sequence & MALDI-TOF MS
data
Next Meeting at 18Th ISHAM Congress 11-15.6.2012 in Berlin German
Next Meeting at 18Th ISHAM Congress 11-15.6.2012 in Berlin German
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Sequence based ID currently based on a cut-off point of 98-99% similarity with the type culture of
the species in question.
However, population based studies showed that the sequences variation in
clinical samples is much higher as those type culture dependent cut-off values.
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Molecular species borders currently undefined!
Currently type culture based cut off point: 99%
Carolina Serena/Wieland Meyer
Type Culture Based Cut-Off Point: 98-99%
Clinical sample based cut-off value: 91.5% similarityClinical sample based cut-off value: 91.5% similarity
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Chytridium confervae
Calic ium tricolor
Mycocal ici um albonigrum
Geom yces pannorum
Pneumocyst is carini i
Schizosaccharomyces pombe
Linderina pennispora
Cantharellus tubaeform is
Basidi obolus ranarum
Eurot iales
Onygenales
Chaetothyrial es
Sordariales
Ophiostomatal esDiaporthalesXylarial es
Hypocreales
Mi croascal es
Lecanoral es
Dothi deales
P leosporales
“Demat iaceae”
Leot iales
Pezizales
Hemiascomycetes
Uredinales
Spori diales
Til letial esUstilagi nales
Tremel lales
S tereales
Agari cales
Glom ales
Harpellales
Entom ophthorales
Mucorales
Chytridiales
Mort ierellales
Leot iales
Zygomycota
Basidiomycota
Ascomycota
Chytridiomycota
ITS works well
ITS not variable enough
ITS variable within species
Sybren de Hoog© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Raises the question: Is the ITS region the best barcode for fungi?Raises the question: Is the ITS region the best barcode for fungi?
• 21 complete fungal genomes• 1 complete plant genome• 3 complete animal genomes• 531 euKaryote Orthologous Groups (KOGs) of proteins• 531 single gene trees• 1 super gene tree
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Should we continue with the genes that we are currently using?Should we continue with the genes that we are currently using?
Should we continue with the genes that we are currently using ?
Robert et al. 2011
For fungal ID most likely a combination of genes is needed
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
DNA barcoding of pathogenic fungi as the basis for the development of novel
standardized diagnostic tools
CI’s: Wieland Meyer (University of Sydney, Australia)
Vincent Robert (CBS/BioAware, The Netherlands/Belgium)
David Ellis (SA Pathology, Australia)
Sharon Chen (Westmead Hospital, Australia)
AI’s: Conrad Schoch (GenBank, USA)
Arun Balajee (CDC, USA)
Aristea Velegraki (University of Athens, Greece)
Sybren de Hoog (CBS, The Netherlands)
Atlas of Living Australia (Canberra, Australia)
APP1031952New Project:
2012-2014
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
AimsAim 1. Identification of the most informative genetic locus/loci to be
used for DNA barcoding of pathogenic fungi, by applying comparative genomics to all currently publically available
fungal genomes
Aim 2. Identification, design and testing of potential primers for the amplification of these loci from a wide range of pathogenic fungi
Aim 3. Generation of DNA barcodes and integration into reference databases for automated molecular identification of fungi accessible via the world-wide-web
Aim 4. Application of the novel identification system in the clinical setting
The identified locus/loci will form the basis for the development of new barcode identification tools, which will revolutionize the identification of
fungal pathogens in the clinical or quarantine setting.
The identified locus/loci will form the basis for the development of new barcode identification tools, which will revolutionize the identification of
fungal pathogens in the clinical or quarantine setting.
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
2 position available: 1) Postdoc with experience in Bioinformatics/whole genome analysis 2) RA with experience in microbiology/mycology/molecular biology
Project Impact:
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
• Loop-mediated isothermal amplification (LAMP)• Rolling circle amplification (RCA)• Reverse line blot (RLP)• Quantitative real-time PCR (qPCR)• Specifically primed PCR• Probing with microarrays• MALDI-TOF
DNA Barcoding - Basis for the Development of New Molecular Identification Methods:
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
Application of DNA barcoding
Longitudinal studies of Airway Colonization in Cystic Fibrosis patients and influence on disease progression
microbiome studies
via next-generation sequencing of sequential sputum samples
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
AcknowledgementsMolecular Mycology Research Laboratory, University of Sydney, Sydney Medical School – Westmead Hospital
Carolina Firacative, Benjamin Kröger, Carolina Serena, Heide-Marie Daniel, Krystyna Maszewska, Matthew Huynh, Clement Kin Ming Tsui, Nathalie van de Wiele, Sharon Chen, Wieland Meyer
Centre for Infectious Disease and Microbiology, Westmead Hospital
Fanrong Kong, Ying Sun, Catriona Halliday, Xianyu Zeng, Guy Porter, Ok-Cha Lee, Tania Sorrell
CBS-Fungal Biodiversity Center, Utrecht, The NetherlandsBioAware, Hannut, Belgium
Vincent Robert
Mycology Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece
Aristea Velegraki, Michael Arabatzis
NIH, NCBI, Genbank, Bethesda MD, USA
Conrad Schoch, John Spouge
LifeTech, USA
Elena Bolchacova
# 352303 to WM APP1031952
Funding: EC-FP7-228310; Sloan Foundation to VR
© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011