Post on 17-Aug-2015
Apoptosis and Cell Survival in the Epididymis after Androgen Withdrawal
Sophie-Anne Lamour
Department of Pharmacology and Therapeutics McGill University Montréal, Québec
August, 2010
A thesis submitted to McGill University in partial fulfillment of the requirements for the degree of Doctor of Philosophy.
© Copyright Sophie-Anne Lamour (2010)
2
3
ABSTRACT
Androgens regulate many reproductive and non-reproductive functions.
Dysregulation of androgen responses can lead to different pathologies. There is,
therefore, a need to better understand the molecular mechanisms underlying
androgen actions. We focus on the epididymis, an androgen-dependent tissue
responsible for the proper maturation and storage of spermatozoa. Unlike the
response of other hormone-dependent tissues, there is little apoptosis in the
epididymis after androgen withdrawal. Hence, our overall objective is to
understand the molecular mechanisms involved in the resistance of the epididymis
to apoptosis triggered by androgen withdrawal. We hypothesize that androgen
withdrawal triggers the activation of a series of specific survival signaling
pathways that act to help protect the epididymis against high levels of apoptosis.
The first objective was to identify the apoptotic and cell survival genes
activated after androgen withdrawal and/or replacement in the epididymis using
apoptosis-focused arrays. The expression of apoptotic and cell survival genes
changed in a region-specific manner and putative androgen-response elements
were identified in the promoter region of affected genes. Changes in expression
for Bmf, Mcl1, Tnfrsf11b, and Rad52 were further characterized.
The second objective was to determine the involvement of the IGF1
signaling pathway in the response of the epididymis to androgen withdrawal. In
the different epididymal regions, Igf1, Igf1r, insulin-degrading enzyme, Igfbp3,
and Birc5 were differentially regulated after androgen withdrawal. This study
indicated that members of the IGF1 signaling pathway participate in the response
of the epididymis to androgen withdrawal.
The third objective was to assess the effects of androgen withdrawal on the
PC-1 and DC-3 mouse epididymal cell lines. Androgen withdrawal did not
decrease PC-1 and DC-3 cell survival, which mimicked the in vivo situation. For
the markers studied, DC-3 cells seemed more sensitive to androgens than PC-1
cells.
Together, the three objectives of this thesis increase our understanding of
androgen regulation of apoptotic and cell survival genes in the epididymis as well
4
as of the molecular mechanisms underlying epididymal resistance to apoptosis
triggered by androgen withdrawal.
5
ABRÉGÉ
Les androgènes régulent plusieurs fonctions reproductives et non-
reproductives. La dérégulation des réponses aux androgènes peut causer
différentes pathologies. Il y a donc un besoin de mieux comprendre les
méchanismes moléculaires sous-jacents aux actions des androgènes. Nous nous
concentrons sur l’épididyme, un tissue dépendant des androgènes qui est
responsable de la maturation appropriée et du stockage des spermatozoïdes.
Contrairement à la réponse d’autres tissues dépendant des androgènes, il y a très
peu d’apoptose dans l’épididyme après le retrait des androgènes. Alors, notre
objectif général est de comprendre les méchanismes moléculaires impliqués dans
la résistance de l’épididyme à l’apoptose stimulée par le retrait des androgènes.
Nous avons posé l’hypothèse que le retrait des androgènes stimule l’activation
d’une série de chemins de signalisation spécifiques de survie qui agissent pour
aider à protéger l’épididyme contre des niveaux élevés d’apoptose.
Le premier objectif a été d’identifier les gènes d’apoptose et de survie
celluaire activés après le retrait des androgènes et/ou leur remplacement dans
l’épididyme en utilisant des micropuces spécifiques à l’apoptose. L’expression
des gènes d’apoptose et de survie cellulaire a changé de manière spécifique à
chaque région et des éléments de réponse aux androgènes possibles on été
identifés dans la région promoteuse des gènes affectés. Les changements
d’expression de Bmf, Mcl1, Tnfrsf11b et Rad52 ont été charactérisés plus en
détails.
Le second objectif a été de déterminer l’implication du chemin de
signalisation du facteur IGF1 dans la réponse de l’épididyme au retrait des
androgènes. Dans les différentes régions épididymales, Igf1, Igf1r, l’enzyme de
dégradation de l’insuline, Igfbp3 et Birc5 ont été régulés différemment après le
retrait des androgènes. Cette étude a indiqué que les membres du chemin de
signalisation du facteur IGF1 participent à la réponse de l’épididyme au retrait des
androgènes.
6
Le troisième objectif a été d’évaluer les effets du retrait des androgènes
sur les lignées cellulaires épididymales de souris PC-1 and DC-3. Le retrait des
androgènes n’a pas diminué la survie cellulaire de PC-1 and DC-3 ce qui a
ressemblé à la situation in vivo. Pour les marqueurs étudiés, les cellules DC-3 ont
semblé plus sensibles aux androgènes que les cellules PC-1.
L’ensemble des données des trois objectifs de cette thèse augmente notre
compréhension de la régulation par les androgènes des gènes d’apoptose et de
survie cellulaire aussi bien que des méchanismes moléculaires sous-jacents à la
résistance épididymale à l’apoptose stimulée par le retrait des androgènes.
7
TABLE OF CONTENTS
Page
Abstract.................................................................................................................. 3
Abrégé .................................................................................................................... 5
Table of Contents .................................................................................................. 7
List of Figures...................................................................................................... 15
List of Tables ....................................................................................................... 19
List of Abbreviations .......................................................................................... 21
Acknowledgements ............................................................................................. 27
Preface – Format of the thesis............................................................................ 29
Contribution of Authors.................................................................... 29
Chapter 1. Introduction...................................................................................... 31
1. The male reproductive system ....................................................................... 32
2. The epididymis ................................................................................................ 32
2.1. Structure......................................................................................................... 32
2.1.1. Gross anatomy .................................................................................... 33
2.1.2. Cell types of epithelium...................................................................... 35
2.1.3. The blood-epididymis barrier ............................................................. 37
2.2 Functions......................................................................................................... 37
2.2.1. Spermatozoa transport ........................................................................ 37
2.2.2. Sperm maturation................................................................................ 38
2.2.3. Sperm storage...................................................................................... 39
2.2.4. Sperm protection................................................................................. 39
2.3. Organ and cell culture.................................................................................... 39
2.3.1. Organ culture ...................................................................................... 40
2.3.2. Primary epithelial cell culture............................................................. 40
2.3.3. Immortalized cell lines........................................................................ 41
2.3.3.1. Spontaneously immortalized cell lines ........................................ 43
2.3.3.2. In vitro immortalization of epididymal epithelial cells................ 43
8
2.3.3.3. In vivo immortalization of epididymal epithelial cells ................ 44
2.4. Gene expression............................................................................................. 45
2.4.1. Tissue- and region-specific gene expressions..................................... 46
2.4.2. Cell-specific gene expression ............................................................. 47
2.5. Protein expression.......................................................................................... 47
2.6. Diseases of the epididymis............................................................................. 48
2.6.1. Epididymitis........................................................................................ 48
2.6.2. Cancer ................................................................................................. 48
3. Regulation of epididymal functions............................................................... 49
3.1. Hormones and vitamins ................................................................................. 49
3.1.1. Estrogens............................................................................................. 49
3.1.2. Oxytocin.............................................................................................. 50
3.1.3. Thyroid hormones............................................................................... 51
3.1.4. Retinoids ............................................................................................. 51
3.2. Testicular factors............................................................................................ 52
4. Androgens ........................................................................................................ 54
4.1. Steroidogenesis, metabolism, and regulation................................................. 54
4.1.1. Steroidogenesis in Leydig cells .......................................................... 54
4.1.2. Secretion, transport, and metabolism.................................................. 56
4.1.3. The hypothalamus-pituitary axis......................................................... 59
4.2. Mechanisms of androgen action .................................................................... 62
4.2.1. Androgen receptor (AR) ..................................................................... 62
4.2.2. Genomic androgen action ................................................................... 62
4.2.3. Non-genomic androgen action............................................................ 63
4.3. Androgen action in peripheral tissues............................................................ 66
4.4. Androgen action in the epididymis ................................................................ 66
4.4.1. Structure.............................................................................................. 67
4.4.2. Gene expression .................................................................................. 68
5. Apoptosis and cell survival............................................................................. 70
5.1. Apoptotic and cell survival pathways ............................................................ 70
5.1.1. Caspases.............................................................................................. 70
9
5.1.2. Extrinsic pathway................................................................................ 71
5.1.3. Intrinsic pathway................................................................................. 72
5.1.4. Regulation of apoptosis....................................................................... 72
5.2. Growth factors survival pathways ................................................................. 73
6. Cell survival and apoptosis in the epididymis .................................................. 74
7. Formulation of Project ................................................................................... 75
References ............................................................................................................ 78
Chapter 2. Identification of Apoptosis and Cell Survival Genes
Regulated by Androgens in the Rat Epididymis ............................................ 113
1. Abstract.......................................................................................................... 114
2. Introduction................................................................................................... 115
3. Material and Methods .................................................................................. 116
3.1. Chemicals..................................................................................................... 116
3.2. Animals ........................................................................................................ 116
3.3. Serum testosterone analysis ......................................................................... 117
3.4. RNA extraction, oligo arrays and hybridization .......................................... 117
3.5. Quantitatice Real-Time RT-PCRDot blot.................................................... 119
3.6. Dot blot ........................................................................................................ 119
3.7. Western blot analysis ................................................................................... 120
3.8. Immunohistochemistry ................................................................................ 121
3.9. Statistical analysis........................................................................................ 122
4. Results ............................................................................................................ 122
4.1. Orchidectomy, with or without testosterone replacement, changed
serum testosterone levels and sex accessory tissue weights ............................... 122
4.2. Testosterone differentially affected transcription of genes in the
different regions of the epididymis ..................................................................... 123
4.3. Testosterone and androgen receptor regulation of gene transcription ......... 124
4.4. Orchidectomy with or without testosterone replacement affected the
transcription of Bmf, Mcl-1, Rad52, and Tnfrsf11b ............................................ 125
5. Discussion....................................................................................................... 127
10
6. Acknowledgements ....................................................................................... 131
References .......................................................................................................... 132
Tables ................................................................................................................. 139
Figures and Legends ......................................................................................... 160
Connecting text.................................................................................................. 179
Chapter 3. Androgen Withdrawal Regulates IGF1 and BIRC5
Expression in the Rat Epididymis ................................................................... 181
1. Abstract.......................................................................................................... 182
2. Introduction................................................................................................... 183
3. Material and Methods .................................................................................. 184
3.1. Chemicals..................................................................................................... 184
3.2. Animals ........................................................................................................ 185
3.3. RNA extraction ............................................................................................ 186
3.4. Quantitative Real-Time RT-PCR................................................................. 186
3.5. Western blot analysis ................................................................................... 186
3.6. IGF1 ELISA................................................................................................. 187
3.7. Statistical analysis........................................................................................ 187
4. Results ............................................................................................................ 188
4.1. Effects of orchidectomy with or without testosterone replacement on Igf1 and
Igf1r expression ............................................................................................ 188
4.2. Effects of orchidectomy with or without testosterone replacement on
upstream regulators of IGF1 signaling ......................................................... 189
4.3. Effects of orchidectomy with or without testosterone replacement on Birc5
and Diablo expression................................................................................... 189
4.4. Effects of orchidectomy with or without testosterone replacement on
downstream signaling molecules .................................................................. 190
4.5. Effects of orchidectomy with or without testosterone replacement on IGF1,
IGF1R, and BIRC5 expression ..................................................................... 191
5. Discussion....................................................................................................... 191
11
6. Acknowledgements ....................................................................................... 194
References .......................................................................................................... 195
Tables ................................................................................................................. 200
Figures and Legends ......................................................................................... 201
Connecting text.................................................................................................. 221
Chapter 4. Effects of Androgen Withdrawal on the PC-1 and DC-3
Mouse Epididymal Cell Lines .......................................................................... 223
1. Abstract.......................................................................................................... 224
2. Introduction................................................................................................... 225
3. Material and Methods .................................................................................. 226
3.1. Chemicals..................................................................................................... 226
3.2. Cell culture................................................................................................... 226
3.3. Cell viability assay....................................................................................... 227
3.4. RNA extraction ............................................................................................ 228
3.5. Quantitative Real-Time RT-PCR................................................................. 228
3.6. IGF1 ELISA................................................................................................. 228
3.7. Statistical analysis........................................................................................ 228
4. Results ............................................................................................................ 229
4.1. Androgen treatment, withdrawal and/or blockade had no effect on PC-1 and
DC-3 cell viability......................................................................................... 229
4.2. Effects of androgen treatment, withdrawal and/or blockade on Igf1, Igf1r, and
Birc5 mRNA expression ............................................................................... 229
4.3. Androgen treatment, withdrawal and/or blockade had no effect on IGF1
concentration................................................................................................. 229
5. Discussion....................................................................................................... 230
6. Acknowledgements ....................................................................................... 232
References .......................................................................................................... 233
Tables ................................................................................................................. 237
Figures and Legends ......................................................................................... 238
12
Chapter 5. Discussion ....................................................................................... 241
1. Androgen regulation of apoptosis and cell survival in the
epididymis.......................................................................................................... 242
1.1. Regulation of apoptosis and cell survival genes in the epididymis………..242
1.2. Orchidectomy and testosterone replacement as a model system................. 243
1.3. Other models of androgen blockade ............................................................ 244
1.4. In vitro model systems ................................................................................. 246
2. Future directions ........................................................................................... 247
2.1. IGF1 survival signaling pathway in the response of the epididymis to
androgen withdrawal..................................................................................... 247
2.2. Developing a good in vitro model system to study the IGF1 signaling
pathway......................................................................................................... 248
2.3. Assessing the role of BIRC5 in the epididymis ........................................... 248
2.4. Androgen-dependence of Birc5 and regulation of BIRC5 .......................... 249
2.5. TNFRSF11B, a protein with a new role in the epididymis?........................ 250
3. Final conclusions ........................................................................................... 250
References .......................................................................................................... 252
List of original contributions ........................................................................... 262
Appendix 1 ......................................................................................................... 267
1. Materials and Methods................................................................................. 268
1.1. K-means cluster analysis.............................................................................. 268
2. Results and Discussion.................................................................................. 268
2.1. The Brown Norway rat strain responded similarly to orchidectomy as the
Sprague-Dawley rat strain............................................................................. 268
2.2. Treatment- and region-specific changes in the number of affected
transcripts...................................................................................................... 269
2.3. Effects of testosterone replacement on the number of affected transcripts
within each region......................................................................................... 269
13
2.4. Orchidectomy with or without testosterone replacement similarly
affected pro- and anti-apoptotic genes.......................................................... 270
References .......................................................................................................... 271
Figures and Legends ......................................................................................... 272
Tables…………………………………………………………………………..280
Appendix 2 ......................................................................................................... 307
1. Materials and Methods................................................................................. 308
1.1. Dot blot ........................................................................................................ 308
1.2. Cloning of the 3kb-upstream promoter region of Birc5 .............................. 309
2. Results ............................................................................................................ 309
2.1. Birc5 was highly expressed in the epididymis............................................. 309
2.2. BIRC5 localized in the cyptoplasm of principal cells ................................. 310
2.3. Effects of orchidectomy with or without testosterone replacement on Birc5
mRNA expression in the ventral prostate and seminal vesicles ................... 310
2.4. Cloning the 3kb-upstream promoter region of rat Birc5 ............................. 310
3. Discussion....................................................................................................... 311
References .......................................................................................................... 313
Figures and Legends ......................................................................................... 315
Appendix 3 ......................................................................................................... 319
1. Materials and Methods................................................................................. 320
1.1. Cell culture................................................................................................... 320
1.2. One-step PCR............................................................................................... 320
1.3. Two-steps RT-PCR...................................................................................... 320
1.4. Immunofluorescence.................................................................................... 321
2. Results and Discussion.................................................................................. 321
2.1. Birc5 was expressed in both PC-1 and DC-3 cells and Tnfrsf11b
only in DC-3 cells ......................................................................................... 321
2.2. BIRC5 localized to both cytoplasm and nucleus in the PC-1 cells.............. 321
14
2.3. Androgen treatment, withdrawal and/or blockade had no effect on Birc5, Igf1,
and Igf1r mRNA expressions over time in the PC-1 cell line ...................... 322
2.4. Androgen treatment, withdrawal and/or blockade had no effect on IGF1
concentration................................................................................................. 322
2.5. Passage number did not affect viability of PC-1 cells after androgen
treatment, withdrawal and/or blockade......................................................... 322
2.6. Androgen treatment, withdrawal and/or blockade had no effect on Mcl1
mRNA expression......................................................................................... 323
References .......................................................................................................... 324
Figures and Legends ......................................................................................... 325
15
LIST OF FIGURES
Page
Chapter 1
Figure 1. Diagrammatic Representation of the Testicular Excurrent
Duct System.................................................................................................... 34
Figure 2. Diagrammatic Representation of the Cellular Organization in the
Rat Epididymis................................................................................................ 36
Figure 3. Chronological Order of the Development of Epididymal
Epithelial Cell Lines ....................................................................................... 42
Figure 4. Steroid Biosynthetic Pathways in Leydig Cells .................................... 55
Figure 5. Active Metabolites of Testosterone....................................................... 57
Figure 6. Testosterone Metabolism....................................................................... 58
Figure 7. Feedback Mechanisms by the Hypothalamus-Pituitary-
Testis Axis ...................................................................................................... 60
Figure 8. Mechanisms of Androgen Action.......................................................... 64
Chapter 2 Figure 1. Effects of orchidectomy with and without testosterone
replacement on serum testosterone concentration and weights of prostate,
empty seminal vesicles, and epididymis ...................................................... 158
Figure 2. Number of transcripts changing in the different regions of the
epididymis after orchidectomy with or without testosterone replacement .. 159
Figure 3. Direct relationships between AR, testosterone, and the affected
transcripts...................................................................................................... 160
Figure 4: Potential pathways through which AR and/or testosterone could
regulate gene expression ............................................................................... 162
Figure 5: Potential interactions between growth factors and affected
genes ............................................................................................................. 164
Figure 6: Roles of BMF, Mcl-1, TNFRSF11B, and Rad52 in the apoptotic,
survival and repair responses ........................................................................ 166
16
Figure 7: Effects of orchidectomy with or without testosterone replacement
on Rad52 expression .................................................................................... 167
Figure 8: Effects of orchidectomy with or without testosterone replacement
on Mcl-1 expression ..................................................................................... 168
Figure 9: Effects of orchidectomy with or without testosterone replacement
on Bmf expression ........................................................................................ 169
Figure 10: Identification of Tnfrsf11b in different rat tissues ............................ 170
Figure 11: Effects of orchidectomy with or without testosterone replacement
on Tnfrsf11b transcript and protein expressions .......................................... 171
Figure 12: Identification of Tnfsf11 and Tnfrsf11a in the different regions
of the epididymis .......................................................................................... 173
Figure 13: Immunolocalization of TNFRSF11B in the different regions of
the epididymis .............................................................................................. 174
Chapter 3 Figure 1: Effects of orchidectomy with or without testosterone replacement on
Igf1 mRNA expression in the epididymis .................................................... 201
Figure 2: Effects of orchidectomy with or without testosterone replacement on
Igf1r mRNA expression in the epididymis .................................................. 202
Figure 3: Effects of orchidectomy with or without testosterone replacement on Ide
mRNA expression in the epididymis ........................................................... 203
Figure 4: Effects of orchidectomy with or without testosterone replacement on
Igfbp3 mRNA expression in the epididymis ................................................ 204
Figure 5: Effects of orchidectomy with or without testosterone replacement on
Birc5 mRNA expression in the epididymis ................................................. 205
Figure 6: Potential androgen-response elements in the upstream promoter region
of rat Birc5 ................................................................................................... 206
Figure 7: Effects of orchidectomy with or without testosterone replacement on
Diabl mRNA expression in the epididymis ................................................. 207
Figure 8: Effects of orchidectomy with or without testosterone replacement on
Bax mRNA expression in the epididymis .................................................... 208
17
Figure 9: Effects of orchidectomy with or without testosterone replacement on
Bid mRNA expression in the epididymis ..................................................... 209
Figure 10: Effects of orchidectomy with or without testosterone replacement on
IGF1 protein expression in the epididymis................................................... 210
Figure 11: Effects of orchidectomy with or without testosterone replacement on
IGF1R protein expression in the epididymis ............................................... 211
Figure 12: Effects of orchidectomy with or without testosterone replacement on
BIRC5 protein expression in the epididymis ............................................... 213
Figure 13: Patterns of changes in expression for Igf1, Igf1r, Igfbp3, and Ide
in the epididymis .......................................................................................... 215
Figure 14: Patterns of changes in expression for Birc5 and Diablo in the
epididymis .................................................................................................... 217
Figure 15: Patterns of changes in expression for Bax and Bid in the
epididymis..................................................................................................... 219
Chapter 4 Figure 1: Effects of androgen treatment, withdrawal and/or blockade on PC-1 and
DC-3 cell viability ........................................................................................ 238
Figure 2: Effects of androgen treatment, withdrawal and/or blockade on Ifg1,
Igf1r, and Birc5 mRNA expression .............................................................. 239
Figure 3: Effects of androgen treatment, withdrawal and/or blockade on IGF1
concentration................................................................................................. 240
Appendix 1
Figure 1: Comparisons of the effects of orchidectomy on serum testosterone
concentration and weights of ventral prostate, empty seminal vesicles,
and epididymis between the Brown Norway and Sprague-Dawley rat
strains ........................................................................................................... 272
Figure 2: Numbers of differentially affected transcripts in the different
regions of the epididymis at 0.5 day and 1 day after orchidectomy with or
without testosterone replacement ................................................................. 273
18
Figure 3: Numbers of differentially affected transcripts at 0.5 day and 1 day after
orchidectomy with or without testosterone replacement in the different regions
of the epididymis........................................................................................... 274
Figure 4: Number of transcripts changing at 0.5 day and 1 day after orchidectomy
between the without testosterone replacement group and the with testosterone
replacement group in the different regions of the epididymis ..................... 275
Figure 5: Effects of androgen withdrawal on overall gene expression
different regions of the epididymis ............................................................... 276
Figure 6: Effects of androgen withdrawal with testosterone replacement
on overall gene expression in the different regions of the epididymis ........ 278
Appendix 2 Figure 1: Identification of Birc5 in different rat tissues ..................................... 314
Figure 2: BIRC5 immunolocalization in the different regions of the
epididymis .................................................................................................... 315
Figure 3: Effects of androgen withdrawal and/or replacement on Birc5
mRNA expression in the ventral prostate and seminal vesicles ................... 316
Appendix 3 Figure 1: Presence of Birc5 and Tnfrsf11b in the PC-1 and DC-3 cell
lines .............................................................................................................. 325
Figure 2: Localization of BIRC5 in the PC-1 cell line ....................................... 326
Figure 3: Effects of androgen treatment, withdrawal and/or blockade on Birc5,
Igf1, and Igf1r mRNA expression in the PC-1 cell line................................ 327
Figure 4: Effects of androgen treatment, withdrawal and/or blockade on IGF1
concentration in the PC-1 cell line................................................................ 328
Figure 5: Effects of androgen treatment, withdrawal and/or blockade on PC-1 cell
viability ......................................................................................................... 329
Figure 6: Effects of androgen treatment, withdrawal and/or blockade on Mcl1
mRNA expression in the PC-1 and DC-3 cell lines...................................... 330
19
LIST OF TABLES
Page
Chapter 2
Table 1. Description of genes represented on the apoptosis-focused arrays…...136 Table 2. Real-Time RT-PCR primers. ................................................................ 141
Table 3. Transcripts up- or down-regulated by at least 1.5 fold at 0.5 and/or 1 day
after orchidectomy without testosterone replacement. ................................. 142
Table 4. Transcripts up- or down-regulated by at least 1.5 fold at 0.5 and/or 1 day
after orchidectomy with testosterone replacement. ...................................... 147
Table 5. Identification of putative androgen response elements (AREs)
up to 3kb upstream of available promoter sequences for the genes affected by
androgen withdrawal and/or replacement in the epididymis ........................ 151
Chapter 3
Table 1. Real-Time RT-PCR primers. ................................................................ 196
Chapter 4
Table 1. Real-Time RT-PCR primers. ................................................................ 233
Appendix 1 Table 1. IS - K-means analysis: orchidectomy without testosterone
replacement…………………………………………………………………280 Table 2. IS - K-means analysis: orchidectomy with testosterone
replacement…………………………………………………………………283 Table 3. Ca - K-means analysis: orchidectomy without testosterone
replacement…………………………………………………………………286 Table 4. Ca - K-means analysis: orchidectomy with testosterone
replacement…………………………………………………………………289 Table 5. Co - K-means analysis: orchidectomy without testosterone
replacement…………………………………………………………………292 Table 6. Co - K-means analysis: orchidectomy with testosterone
replacement…………………………………………………………………295 Table 7. Cd - K-means analysis: orchidectomy without testosterone
replacement…………………………………………………………………298
20
Table 8. Cd - K-means analysis: orchidectomy with testosterone replacement…………………………………………………………………302
21
LIST OF ABBREVIATIONS
17β-HSD 17 β-hydroxysteroid dehydrogenase
3β-HSD 3β-hydroxysteroid dehydrogenase
9-cis-RA 9-cis-retinoic acid
ABP androgen binding protein
Acta1 actin, alpha 1, skeletal muscle
ADAM a desintegrin and metalloprotease
Adam7 ADAM metallopeptidase domain 7
Ahr aryl hydrocarbon receptor
AIDS acquired immune deficiency syndrome
Akt1 thymoma viral protooncogene 1
ALS acid-labile subunit
APAF1 apoptotic protease activating factor-1
AR androgen receptor
ARE androgen response element
Armcx3 armadillo repeat containing, X-linked 3
Atf4 activating transcription factor 4
ATPase adenosine triphosphatase
Bcl2 B cell leukaemia/lymphoma 2
BH BCL2 homology
BIR baculovirus IAP repeat
BIRC5 baculoviral IAP repeat-containing 5
BMP8a bone morphogenetic protein 8A
Bmyc brain-expressed myelocytomatosis oncogene
BN Brown Norway
bp base pair
C/EBP CCAAT/Enhancer binding protein
Ca caput
Calcrl calcitonin receptor-like
cAMP cyclic adenosine monophosphate
Casp caspase
22
Ccna2 cyclin A2
Cd cauda
Cdh1 cadherin 1
Cdh2 cadherin 2
CF-FBS charcoal-filtered fetal bovine serum
Clu clusterin
Co corpus
Cox1 cyclo-oxygenase 1
CRABP cellular retinoic acid-binding protein
CRBP cellular retinol-binding protein
CRISP cystein-rich secretory protein
Cst11 cystatin 11
Cst12 cystatin 12
CTP/HE1/NCP2 cholesterol transfer protein
Ctsc cathepsin C
Ctsh cathepsin H
d day
Dad1 defender against cell death protein 1
DBD DNA-binding domain
DC-3 distal caput epididymis cell line 3
DcR decoy receptor
DD death domain
Defb11 beta-defensin 11
DHT 5α-dihydrotestosterone
DIABLO direct IAP-binding protein with low pI
DISC death inducing signaling complex
DR death receptor
EDAR ectodysplasin A receptor
EGF epidermal growth factor
ER estrogen receptor
E-RAPB epididymal retinoic acid-binding protein
23
ERK extracellular signal-regulated kinase
Etv5 ets variant gene 5
FADD Fas-associated death domain protein
FBS fetal bovine serum
FGF fibroblast growth factor
Fgfr1 fibroblast growth factor receptor 1
FHCE fertile human caput epididymal cell line
FHSE fertile human corpus epididymal cell line
Figf c-fos induced growth factor
FSH follicle-stimulating hormone
Gapdh glyceraldehydes-3-phosphate dehydrogenase
Gas7 growth arrest-specific 7
GF growth factor
GGT γ-glutamyl transpeptidase
Gj gap junction protein
GnRH gonadotropin-releasing hormone
GPX5 glutathione peroxidase 5
Grb2 growth factor receptor-binding protein 2
Grp glucose-regulated protein
H hinge region
HDL high-density lipoprotein
hrs hours
hsp heat shock protein
HTRA2 high-temperature requirement serine protease A2
IAP inhibitor of apoptosis protein
ICAD the inhibitor of caspase-activated DNase
IDE insulin-degrading enzyme
IGF insulin-like growth factor
IGF1 insulin-like growth factor 1
IGF1R insulin-like growth factor 1 receptor
IGFBP IGF binding protein
24
Igfbp2 insulin-like growth factor binding protein 2
IGFBP3 insulin-like growth factor binding protein 3
IHCE infertile human caput epididymal cell line
Ilk integrin linked kinase
IMCE immortalized canine epididymis
IRS insulin receptor substrate
IS initial segment
Itpr3 inositol 1,4,5-triphosphate receptor 3
Jund1 jun protooncogene-related gene d1
kb kilobases
Lama5 laminin
LBD ligand-binding domain
Lcn5 lipocalin 5
Lcn8 lipocalin 8
LDH lactate dehydrogenase
LDL low-density lipoprotein
LH luteinizing hormone
Lrp2 low-density lipoprotein receptor-related protein 2
Man2 alpha-mannosidase II
MAPK mitogen-activated protein kinase
Mcl1 myeloid cell differentiation protein 1
MEPC5 mouse epididymis caput epithelial cell line
Mgst1 microsomal glutathione S-transferase
NADPH nicotinamide adenine dinucleotide phosphate
NAIP neuronal apoptosis inhibitory protein
NF- κB nuclear factor-κB
NGFR nerve growth factor receptor
NTD N-terminal regulatory domain
OT oxytocin
P45017α 17α-hydroxylase cytochrome P450
P450scc cytochrome P450 enzyme cholesterol side-chain cleavage
25
PARP poly(ADP-ribose)polymerase
Pbp1 phosphatidylethanolamine binding protein 1
PC-1 proximal caput epididymis cell line 1
PDGF platelet-derived growth factor
Pdgfc platelet-derived growth factor, C polypeptide
PEA3 polyomavirus enhancer activator 3
PGDS prostaglandin D2 synthase
Phgdh 3-Phosphoglycerate dehydrogenase
PI3K phosphatidylinositol 3-kinase
PKA protein kinase A
PKB protein kinase B
PKC protein kinase C
Plau plasminogen activator, urokinase
Pppr2b2 protein phosphatase 2, regulatory subunit B, beta isoform
pRB retinoblastoma susceptibility protein
qRT-PCR quantitative real-time PCR
Rab2 RAB2, member RAS oncogene family
Rad21/23b RAD21/RAD23b homolog
Ramp3 receptor (G protein-coupled) activity modifying protein 3
RAR retinoic acid receptor
RBP retinoid-binding protein
RCE rat caput epididymal cell line
RIP receptor-interacting protein 1
Ripk1 receptor (TNFRSF)-interacting serine-threonine kinase 1
ROCK1 Rho-associated coiled-coil forming kinase 1
rT3 reverse T3
Serpinh1 serine (or cysteine) peptidase inhibitor, clade H, member 1
SHBG sex hormone-binding globulin
SHC Src- and collagen-homology
Slc solute carrier family
Sod1 superoxide dismutase
26
SR steroid 5 alpha-reductase
SV40LT SV40 large T-antigen
T testosterone
T3 3,5,5’-triiodothyronine
T4 thyroxine
TBG thyroxine binding globulin
TEBG testosterone-estradiol-binding globulin
TGFβ transforming growth factor-β
TH thyroid hormone
Thoc4 THO complex 4
Timp2 tissue inhibitor of metalloproteinase 2
TNF tumor-necrosis factor
TNFR tumor-necrosis factor receptor
TNFRSF tumor necrosis factor receptor superfamily
Tnfrsf1a tumor necrosis factor receptor 1
TR thyroid hormone receptor
TRADD TNFR1-associated death domain protein
TRAF TNF-receptor-associated factor
TRAIL-R1 TNF-related apoptosis inducing ligand receptor-1
TRAMP TNF-receptor-related apoptosis mediating protein
TRE thyroid response element
Ts-IAP testis-specific IAP
tsSV40LT temperature-sensitive mutant of SV40LT
Ttf1 transcription termination factor 1
XAF-1 XIAP-interacting protein
XIAP X-chromosome-linked IAP 5
27
ACKNOWLEDGEMENTS
I would like to thank my supervisor Dr. Bernard Robaire for giving me the
opportunity to study under his guidance and develop skills for independent
research. Thank you for opening my eyes to the world of research and the social
context of science.
I would also like to thank Dr. Terry Hébert and Dr. Louis Hermo for their
feedback and helpful suggestions on my research project, as well as Dr.
Guillermina Almazan for her advices.
I am deeply grateful to my advisor Dr. Derek Bowie for always taking the time to
meet with me and give me invaluable advices.
I would like to acknowledge the Department of Pharmacology and Therapeutics
of McGill University for creating a great environment to work in. Thank you to
Dr. Hans Zingg, Hélène Duplessis, Chantal Grignon, David Kalant, Pamalla
Moore, and Tina Tremblay for making the department run so smoothly. Thank
you to all the professors for creating a very stimulating environment.
I am grateful to CIHR for financially supporting these studies.
Thank you to Johanne for her kind words and Tony for bringing me food late at
night.
I would like to thank Élise Boivin-Ford, Chunwei Huang, and Trang Luu for
always being helpful. Trang, thank you for all the help you provided me and for
always being there to listen to me.
I would like to thank all the past and present members of the two labs for their
encouragements and the fun times: Dr. Adriana Aguilar, Dr. Sarah Ali-Khan,
28
Serena Banh, Ghalib Bardai, Dr. Tara Barton, Dr. Liga Bennetts, Dr. Karine
Bibeau, Michelle Carroll, Dr. Alexis Codrington, Caroline Dayan, Dr. Géraldine
Delbès, Dr. Sheila Ernest, Dr. Huge Galdones, Naveen Gnanabakthan, Lisanne
Grenier, Dr. Mahsa Hamzeh, Dr. Natali Henderson, Dr. Kate Jervis, Dr. Sukdeep
Kaur, Dr. Claudia Lalancette, Dr. Ludovic Marcon, Jennifer Maselli, Thomas
Nardelli, Dr. Cristian O’Flaherty, Dr. Christopher Oakes, France-Hélène Paradis,
Dr. Catriona Paul, Dr. Eddy Rijntjes, Ava Schlisser, Johanna Selvaratham, Farida
Vaisheva, Cameron Weir, Dr. Jin Yan, and Dr. Katia Zubkova.
Thank you to all my friends that have been very supportive throughout the years
and that have believed in me: Antoine, Babak, Cat, Charles, Dono, Ingrid, Joëlle,
Lisa, Malek, Marwan, Mélissa, Nat, Nav, Philippe, Philou, Sam, Shireen, and
Ying.
Finally, I am very grateful to my parents for their unconditional love, their
support in everything I have ever undertaken, and their faith in me. Xandrine,
thank you for helping me get through this.
29
PREFACE
Thesis Format
This is a manuscript-based thesis, which conforms to section 1.C. of the
“Thesis Preparation and Submission Guidelines” of the Faculty of Graduate
Studies and Research at McGill University. This thesis is comprised of five
chapters. Chapter one is a general introduction; it is a comprehensive review of
the epididymis, androgens, androgen regulation of the epididymis, as well as cell
survival and apoptosis. This chapter concludes with a rational for the studies
presented in this thesis and the objectives of the thesis. Chapters two to four are
data chapters bridged by connecting text to ensure that the thesis has continuity.
Chapters two and three will be submitted for publication, whereas chapter four is
a thesis chapter in the form of a manuscript. Chapter five is a discussion of the
overall results and includes ideas for future studies; it is followed by a list of
original contributions. References are provided at the end of each chapter. The
appendices contain supplemental data that could not be included in the chapters.
The ethics certificates for work on animal subjects and for the use of radioactive
materials as well as the copyright agreements for the figures used in the first
chapter are submitted separately.
Contributions of Authors
All the experiments and analyses described in this thesis were completed
by the candidate with the exception of the rat perfusions, which were done by
Ludovic Marcon and the dot blot experiments that were done by Trang Luu.
Trang Luu has also helped to do some qRT-PCR and western blots.
30
31
CHAPTER 1
Introduction
32
1. The male reproductive system
The male reproductive system consists of a series of organs that act in a
concerted manner to produce spermatozoa able to fertilize an oocyte and to
deliver these spermatozoa to the female reproductive tract (1). The testes produce
the gametes that are transported through a series of ducts that include in the
following order, the efferent ducts, epididymis, vas deferens, and urethra inside
the penis. The testes also produce androgens, a process that occurs in the
interstitial Leydig cells (2). In addition, the seminal vesicles, prostate, and
bulbourethral glands secrete fluids that constitute the ejaculated semen (3). This
thesis focuses on the epididymis, a critical site for spermatozoa maturation (the
process by which spermatozoa acquire the ability to swim, recognize, and fertilize
an oocyte) and where they are stored before ejaculation (2;4-8); spermatozoa
become fully capable of fertilizing an oocyte after they reside in the oviduct and
become capacitated (291).
2. The epididymis
The word “epididymis” comes from the Greek epí for “on” and dídymoi
for “twins” (testes) and refers to the localization of the epididymis on the surface
of the testis (4). It was first described by Aristotle in Historia Animalum in the 4th
century B.C., but it was only in 1668 that De Graaf described the first dissected
human epididymides (6;9;10). Despite an early discovery, the epididymis
received little attention up to the 1960’s when its role as the key player in
spermatozoa maturation was finally recognized (2;6;11).
2.1. Structure
Most studies done to understand the structure, function, and regulation of
the epididyimis were carried out in animal models (rat, mouse, rabbit, boar, and
stallion) due to the lack of available human epididymal tissue. However, the
human epididymis possesses specificities compared to other mammals that will be
introduced when appropriate (9).
33
2.1.1. Gross anatomy
The epididymis is a single highly convoluted tubule that links the efferent
ducts of the testis to the vas deferens (4;6;8) (Fig. 1). The highly coiled nature of
the epididymis can be illustrated with the human epididymis: only 10-12 cm in
length, it contains 6-7 m of coiled tubule (9). The epididymal tubule varies in
length from 1 m in mice (12), 3 m in rats (13), to up to 80 m in stallions (14).
Based on structural differences, it is usually separated into four distinct regions:
the initial segment (IS), caput (head, Ca), corpus (body, Co), and cauda (tail, Cd)
(2;6;15) (Fig. 1); in humans, the initial segment is absent (9). Other species-
specific nomenclatures have divided the epididymis in more regions or zones
based on the organization of each region into lobules separated by connective
tissue septa (6;16-19). These septa might participate in the lobule-specific and
region-specific expression of genes and proteins (20). Developmentally, the initial
segment seems to be derived from the mesonephric (Wolffian) tubule, while the
remaining regions are derived from the mesonephric duct [reviewed in
(2;6;21;22)]. This different developmental origin of the initial segment from the
other epididymal regions might explain the differences in their regulation (6); this
point will be reviewed in many sections of this thesis. In the adult, the epididymis
becomes highly differentiated with a mitotic index below 0.6% in rats (23). The
epididymis is further divided into three compartments: a lumen, an epithelium,
and an inter-tubular compartment (Fig. 2) (2). The lumen contains spermatozoa
bathing in a fluid with a composition that varies from region to region, thereby
creating specialized microenvironments for the proper maturation of spermatozoa
(24). These microenvironments are created by the secretion and absorption of
water, ions, small organic molecules, and proteins by the epithelium (2). The
composition of the epididymal epithelium will be discussed in the next section.
The epithelium is surrounded by myoid cells, connective tissue, and an
interstitium that contains blood vessels, lymphatics, and nerves (4). From
proximal (initial segment and caput) to distal (corpus and cauda) regions, the
epithelial cell height decreases and the luminal diameter increases (7).
34
Figure 1: Diagrammatic Representation of the Testicular Excurrent Duct
System
The testicular excurrent ducts of the male reproductive system conduct
spermatozoa from their site of production to their site of ejaculation. Spermatozoa
are produced in the seminiferous tubules and collected in the rete testis before
leaving the testis through the efferent ducts. The efferent ducts converge into a
single highly convoluted tubule, the epididymis. The epididymis is
morphologically and functionally separated into four distinct regions: initial
segment, caput, corpus, and cauda. Spermatozoa remain in the cauda epididymidis
until ejaculation at which time they empty into the vas deferens.
Reproduced from reference (6).
35
2.1.2. Cell types of the epididymal epithelium
The epididymal epithelium is composed of six cell types: principal, basal,
clear, narrow, apical, and halo cells (Fig. 2) (25). The structure, size, and number
of epididymal cells are region-specific [reviewed in (2)].
Principal cells. Principal cells, as their name implies, are the major cell
type present in the epididymis and, depending on the region, comprise 65% to
80% of the total cell population (2;8). Actively involved in protein synthesis, they
are also the main absorptive and secretory cells of the epididymis. In fact, all
proteins secreted in the lumen are synthesized by principal cells (8). Furthermore,
they are the main androgen-responsive cells of the epididymis (26).
Basal cells. Basal cells are the second most common cell type of the
epididymis and are located throughout the tissue (2;8). Their name derives from
their localization at the basement membrane, which prevents them from having
direct access to the lumen of the epididymis (6). They are not stem cells that could
replenish principal cells (23). Basal cells are closely associated with principal
cells and hence could regulate their functions by secretion and endocytosis of
proteins (6;25). In addition, they might act as immune cells because they express
macrophage antigens (27;28).
Clear cells. Clear cells are found in all epididymal regions, except initial
segment (8). In immunohistochemistry, these cells do not stain after
counterstaining with methylene blue hence their name. Involved in endocytosis of
proteins from the lumen in a region-specific manner, they particularly clear the
lumen of proteins from cytoplasmic droplets released by maturing spermatozoa.
Clear cells in collaboration with narrow and apical cells are also involved in
luminal acidification (6).
Narrow and apical cells. Narrow and apical cells are only found in the
initial segment. They differ from one another in terms of morphological
appearance, relative distribution, and protein expression. They both participate in
endocytosis of proteins and in luminal acidification (8).
36
Figure 2: Schematic Diagram of the Cellular Organization in the Rat
Epididymis
The epididymis is separated into three compartments: a lumen, an epithelium, and
an inter-tubular compartment. The lumen contains maturing spermatozoa, while
the epithelium is composed of six cell types. The relative position and distribution
of the different cell types are illustrated. The major functions associated with each
cell type are also identified.
Adapted from reference (6).
Principal cell
Clear cell
Myoid cell
EPITHELIUM
LUMEN
- Takes up luminal components- Role in luminal acidification Apical cell
- Proton secreting
-Major absorptiveand secretory cells
Halo cell - Immune functions
Basal cell - Not stem cells- Protective role
INTERSTITIUM SMOOTH MUSCLE CAPILLARIES
Tight junction
37
Halo cells. Halo cells are the primary immune cells of the epididymis and
are present throughout the tissue at the base of the epithelium. They comprise
helper T lymphocytes, cytotoxic T lymphocytes, and monocytes (8).
2.1.3. The blood-epididymis barrier
The blood-epididymis barrier, as its name implies, describes a physical
division between the blood content and the luminal environment of the
epididymis. The barrier is created by tight junctions located on the luminal side of
adjacent principal cells (29). Communication between cells is maintained by gap
junctions (6). This allows the epididymis to tightly regulate the molecules that
enter the lumen in a region-specific manner thereby creating specific
microenvironments along the duct (29-31). In addition, the blood-epididymis
barrier protects spermatozoa, that are immunogenic, from degradation by immune
cells, as well as from some toxic substances (6;7).
2.2 Functions
The epididymis participates in the transport, maturation, storage, and
protection of spermatozoa (9). Each epididymal region accomplishes specific
functions; the caput and corpus epididymides are involved in early and late
spermatozoa maturation, respectively, while the cauda epididymidis is the main
storage site for mature spermatozoa (25).
2.2.1. Spermatozoa transport
The epididymis transports spermatozoa from the testis to the vas deferens
thereby allowing ejaculation (32). Once released from the testis, spermatozoa are
transported to the epididymis by the movement of testicular fluid and possibly by
the beat of the ciliated cells of the efferent ducts (6). In the epididymis, the
epithelium is lined by immotile sterocilia and fluid flow is reduced by fluid
uptake, therefore, movement down the duct is maintained by hydrostatic pressures
and rhythmic muscular contractions of the smooth muscle surrounding the
38
epithelium (6;9). These events are controlled by adrenergic and cholinergic
mechanisms (33), neuropeptides (vasopressin) (34), hormones (androgen,
estrogen, and oxytocin) (34;35), prostaglandins (36), and temperature (37;38). For
different species, transit time through the epididymis takes around 12 days (2). In
the rat, luminal fluid goes through the initial segment/caput in 2.1 days, the corpus
in 0.8 day, and the cauda in 9.8 days (24). However, transit time for the human
epididymis is much faster with only 2-4 days. This raises a question on the quality
of spermatozoa produced by humans (32). In general, spermatozoa move faster
through the proximal regions where fluid is non-viscous and slower in the distal
regions where the luminal content is more viscous (9;24).
2.2.2. Spermatozoa maturation
As spermatozoa move down the epididymis, they acquire the potential for
vigorous and forward motility as well as the ability to fertilize an oocyte (capacity
to undergo the acrosome reaction, binding to and penetration of the zona
pellucida, binding to and fusion with the zona-free vitellus, and syngamy) (4).
This maturation process is active and occurs in multiple steps; the epididymis
secrete specific proteins leading to morphological and biochemical changes in the
spermatozoa (2;25). The site in the epididymis where spermatozoa acquire their
fertilizing ability varies from species to species, but in general this ability is only
gained after passage through the proximal epididymis (6). Changes allowing
spermatozoon-oocyte fusion usually occur in the proximal regions, whereas
changes allowing spermatozoon-zona binding occur in the distal regions (4).
Morphological changes in spermatozoa include changes in the dimension and
appearance of the acrosome and nucleus, chromatin condensation, migration and
removal of the cytoplasmic droplet, and structural changes in intracellular
organelles [reviewed in (39)]. The plasma membrane proteins of spermatozoa are
also reorganized, modified (through phosphorylation, deglycosylation, and
proteolytic processing), and renewed (25). In addition, the methylation status of
some spermatogenesis-specific genes has been shown to be modified after
39
epididymal transit (40). The maturation of spermatozoa in the epididymis is
regulated by 5α-dihydrotestosterone (DHT), a metabolite of testosterone (T) (41).
2.2.3. Spermatozoa storage
The cauda region is the major storage site of spermatozoa. In fact, 50% to
80% of spermatozoa present in the excurrent ducts are found in the cauda
epididymidis. Spermatozoa can be stored for periods longer than 30 days and
remain fertile (6). Compared to other mammals that can store three- to five-fold
more spermatozoa in the cauda than the daily production, the human epididymis
has a very limited storage capacity (6;42). To store spermatozoa, the cauda
epididymidis needs to maintain them in a quiescent state. This is achieved through
(i) the lowering of luminal sodium ion concentration thereby preventing proton
efflux and a rise in intracellular pH that triggers motility; (ii) a high concentration
of spermatozoa and secretion of a viscous mucoprotein (immobilin in rodents)
that restrict movement; and (iii) the secretion of proteins preventing inappropriate
acrosome reaction (4).
2.2.4. Spermatozoa protection
As stated in section 2.1.3., the blood-epididymis barrier protects
spermatozoa from immune cells and some xenobiotics by preventing their access
to the lumen. In addition, the epithelium secretes specific proteins that protect
spermatozoa from microbes and radical oxygen species; spermatozoa are highly
susceptible to oxidative damage. Antimicrobial defenses are ensured by defensins
or defensin-like proteins. Protection from oxidative stress is achieved through the
use of many antioxidant enzymes such as superoxide dismutase, γ-glutamyl
transpeptidase, glutathione peroxidases, and glutathione transferases (6;9).
2.3. Organ and cell culture
The goal of in vitro methods to study the functions and regulations of
tissues is to permit the precise manipulation of the environment in which the
tissue or cells reside. This would allow measurements of end points, for example
40
phosphorylation of proteins, that could not be done in vivo. Attempts at
developing an in vitro culture system of epididymal cells have been under way
since 1972 (43) and included the development of methods to culture epididymal
tubules (organ culture) and primary epithelial cells (2). However, it is only in
2001 that the first immortalized epididymal cell line was generated (44).
2.3.1. Organ culture
Using organ culture to study the epididymis has two advantages. First,
hormone-dependent tissues, such as the epididymis, retain their hormone
responsiveness in vitro, thereby allowing for the study of the effects of a single
hormone or several compounds on the epididymis. Second, the histological
architecture is preserved permitting the maintenance of functions, such as sperm
maturation, that would be lost in an isolated cell system (2). Using static and
continuous flow organ culture, it has been shown that sperm maturation is
dependent on DHT (45), and that the action of DHT is mediated through the
synthesis of RNA and proteins (46), some of which are potentially important for
sperm maturation (47-49). However, organ cultures can only be maintained for a
few days, which limit their usefulness (2).
2.3.2. Primary epithelial cell culture
Primary cell cultures provide simplified model systems to obtain specific
information on the activity and functions of individual cell types under defined
conditions and possess a longer lifespan than organ cultures (2). In culture,
epididymal cells flatten, form monolayers, and maintain some of their in vivo
structural features such as surface microvilli, prominent Golgi apparatus,
abundant rough and smooth endoplasmic reticula, lipid droplets, and
multivesicular bodies (50-52). They also maintain some in vivo functions
including ion secretion and reabsorption (53-55), testosterone metabolism (50;56),
expression of epididymal genes (57;58), and protein secretion (59-62). Studies
using primary epididymal cell cultures have allowed researchers to reach
important conclusions such as the requirement of factors found in the rete testis
41
fluid to maintain the conversion of T to DHT (56). Nonetheless, primary cell
cultures have limitations: they cannot be maintained indefinitely in culture, they
divide very slowly, and they lose their differentiated phenotype after a few
passages (51;56;63). In addition, results obtained with these cultures are variable
and they are often contaminated with fibroblasts (2).
2.3.3. Immortalized cell lines
Unlike primary epithelial cell cultures, immortalized cell lines are
homogeneous cell populations that will grow indefinitely in culture. Therefore,
they are useful tools to generate reproducible results. Furthermore, they reduce
the need for new material and hence the need to euthanize animals on a regular
basis and the consequent costs (64). However, the different cell types forming the
epididymal epithelium, the high proportion of connective tissue, the highly
differentiated state, and the slow proliferation of the epididymal epithelium have
rendered very challenging the immortalization of these cells (23;64;65). Most
epididymal cell lines generated so far have used caput epididymides because it is
the region with the most active protein secretion and hence is a good region to
study epididymal functions (65). Nevertheless, immortalized epididymal cells are
transformed and hence have lost the expression of certain epididymal markers and
some of their differentiated state features.
Generation of immortalized epididymal cell lines has relied on
spontaneous transformation or the use of the simian virus 40 large T-antigen
(SV40LT) both in vitro and in vivo (64). The SV40LT is an immortalizing gene
that can convert on its own primary cells into transformed cells (66). Although the
exact mechanisms for immortalization and transformation by SV40LT are still
unknown, it is established that SV40LT binds and inactivates p53 and
retinoblastoma susceptibility protein (pRB), two tumor-suppressor genes,
inhibiting apoptosis and allowing re-entry into the cell cycle, respectively (67;68).
In addition, p53-independent pathways have been reported (67;68). Figure 3
illustrates the chronological development of immortalized epididymal cell lines
(69).
42
Figure 3: Chronological Order of the Development of Epididymal Epithelial
Cell Lines
The immortalized epithelial cell lines of the epididymis are illustrated in the
chronological order of their development. Adapted from reference (45).
1991 2001 2002 2003 2004 2005 2010
Human fetal epididymis (70)
PC1, DC1, DC2, and DC3 mouse caput epididymis (75)
IMCEcanine epididymis (44)
MEPC5mouse caput epididymis (71)
RCErat caput epididymis (72)
FHCE/FHSEhuman caput and corpus epididymis (73)
mE-Capmouse caput epididymis (77)
A and B2mouse caput epididymis (66)
1991 2001 2002 2003 2004 2005 2010
Human fetal epididymis (70)
PC1, DC1, DC2, and DC3 mouse caput epididymis (75)
IMCEcanine epididymis (44)
IMCEcanine epididymis (44)
MEPC5mouse caput epididymis (71)
MEPC5mouse caput epididymis (71)
RCErat caput epididymis (72)
RCErat caput epididymis (72)
FHCE/FHSEhuman caput and corpus epididymis (73)
FHCE/FHSEhuman caput and corpus epididymis (73)
mE-Capmouse caput epididymis (77)
mE-Capmouse caput epididymis (77)
A and B2mouse caput epididymis (66)
A and B2mouse caput epididymis (66)
43
2.3.3.1. Spontaneously immortalized cell lines
Spontaneously immortalized cell lines are derived from cells that were not
immortalized using transforming oncogenes; they are selected for their ability to
proliferate and maintain their phenotype in culture over long periods of time. Two
spontaneously immortalized cell lines, cell lines A and B2, were generated using
primary cultures of mouse caput epididymidis. These cell lines are composed of a
homogeneous epithelial cell population, maintain some of the characteristic
features of in vivo epididymal epithelial cells such as polarization, and express
epididymis-specific genes. However, they are not androgen-responsive (65).
2.3.3.2. In vitro immortalization of epididymal epithelial cells
Epididymal cell lines have been generated by transfecting primary cultures
of epithelial cells with an SV40LT plasmid. The first epididymal cell line
originates from human fetal epididymis, but the cells lose their epididymal
characteristics over time (70).
The first immortalized cell lines generated from a differentiated adult
epididymis were obtained from the canine epididymis (IMCE) (44). They are all
of epithelial origin, retain some epididymal-specific gene expression, and
maintain the expression of the androgen receptor (AR) mRNA and protein.
However, known androgen-regulated genes do not respond to androgen
stimulation suggesting that the cells may have partially lost their differentiated
phenotype (44;64).
The next two generated cell lines were derived from mouse (mouse
epididymis caput epithelial cell line; MEPC5) (71) and rat (rat caput epididymal
cell line; RCE) (72) epididymides. The MEPC5 cell line is a conditionally
immortalized cell line established using the temperature-sensitive mutant of
SV40LT (tsSV40LT) (71). This mutant contains a single nucleotide mutation,
which produces a product that functions at the permissive temperature of 330C,
but is rapidly degraded at the nonpermissive temperature of 390C. This allows to
turn on or off cell proliferation by culturing cells at either 330C or 390C (64). The
MEPC5 cells express some epididymis-specific genes and maintain polarity and
44
gap junctions (71). The RCE cell line is the only rat epididymal cell line available
to date. These cells are mostly composed of principal cells with some clear cells.
They retain many characteristics of cells in vivo such as polarity and expression of
tight and adhering junctions. In addition, they express many epididymis-specific
genes as well as the AR. However, they are not fully responsive to androgen
stimulation (72).
Recently, human epididymal cell lines have been derived from one fertile
(73) and one azoospermic (absence of spermatozoa in the ejaculate) (74) patient,
by transforming cells from each with SV40LT. Using epididymal tissue from a
fertile patient, Dube et al. (73) have developed four cell lines originating from the
caput epididymidis (FHCE1-4 for fertile human caput epididymal cell line) and
one originating from the corpus epididymidis (FHSE1 for fertile human corpus
epididymal cell line); they have been unsuccessful at creating a cauda epididymal
cell line. These cell lines comprise homogeneous cell populations of principal
cells that have maintained characteristics of in vivo cells. In addition, they express
mRNA and proteins of adhering and tight junctions. However, only three cell
lines express the AR (FHCE1-3) and they have a very slow doubling time of 13 to
20 days (73). The five cell lines derived from the caput epididymidis of an
azoospermic patient are called infertile human caput epididymal cell lines
(IHCE1-5). They comprise homogeneous populations of epithelial cells that
resemble structurally in vivo principal cells and express some epididymal markers
and jucntional proteins. However, only IHCE1-2 express AR and they have a
slow doubling time of 7 to 11 days (74).
2.3.3.3. In vivo immortalization of epididymal epithelial cells
Two different transgenic mouse models have been used to create
immortalized epididymal cells. In the first approach, Araki et al. (75) have used
transgenic mice constitutively expressing tsSV40LT (76). These mice do not
express SV40LT at the nonpermissive temperature of the body; this prevents the
formation of tumors. Immortalization is achieved when the cells are isolated and
cultured at 330C (64;76). They have generated four stable cell lines from the
45
proximal caput (PC-1) and three cell lines from the distal caput (DC-1, DC-2, and
DC-3) epididymides that maintain morphological characteristics of in vivo
epithelial cells. These cells also express some epididymal-specific markers and
are androgen-responsive (64;75). In the second approach, Sipila et al. (77) have
used transgenic mice expressing SV40LT only in the caput epididymis through
the use of a 5.0-kb mouse glutathione peroxidase 5 promoter (Gpx5-Tag) (78).
They have generated eighteen epithelial cell lines, named mE-Cap11-28, that
express some epididymal-specific genes. However, they express low levels of
AR, and hence are not androgen-responsive (77).
2.4. Gene expression
The molecular mechanisms responsible for the creation of specific
microenvironments along the epididymal duct have been investigated by many
groups. These groups have looked at the tissue-, region-, and cell-specific gene
expression patterns of the epididymis; the region-specific gene expression is a
hallmark of the epididymis. These groups have looked at overall gene expression
in the human (79-84), rat (85-89), mouse (88-93), and boar (94) epididymides and
their regulation under different pathological (81) and experimental conditions (95-
99). A few of the generated databases are available online:
- Mammalian Reproductive Genetics Database (mouse and rat
transcriptomes): http://mrg.genetics.washington.edu/ (89;100)
- Mouse epdididymis transcriptome :
http://www.wsu.edu/~griswold/microarray/epididymis_dht/ (99) and
http://www.ttuhsc.edu/cbb/faculty/cornwall/Nelson%5Csupplemental%20
data.html (90)
- Human epididymis transcriptome:
http://www.scbit.org/human_epididymis_transcriptomes (82-84) and
http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi (GSE7808) (80)
46
2.4.1. Tissue- and region-specific gene expressions
According to Turner et al. (101), there are, in the mouse epididymis, 307
genes that are considered epididymis-selective (mean expression of that gene in
any region is at least three-fold higher than the mean expression in any other
tissues) and 75 genes that are considered epididymis-specific (present in the
epididymis but never detected in other tissues). Some epididymal specific genes
include the antioxidant enzyme glutathione peroxidase 5 (Gpx5) (102), the
protease inhibitor cystatin-related epididymal spermatogenic (cystatin 11, Cst11)
(103), the antimicrobial peptide beta-defensin 11 (Defb11) (104), and the
transporters lipocalin 5 and 8 (Lcn5, Lcn8) (101;105) . In the human, the sperm
protein P34H is exclusively expressed in the epididymis (106).
Most genes are more highly expressed or enriched in the proximal regions,
the regions most active in terms of protein synthesis and secretion (2). In fact,
Hsia and Cornwall (90) have identified 53 genes that are at least 2.5 times more
highly expressed in the initial segment than in the other regions. They include the
protease inhibitor cystatin 12 (Cst12) (107), the transcription factor ets variant
gene 5 (Etv5) (108), the endopeptidase cathepsin H (Ctsh) (109), the antioxidant
enzyme microsomal glutathione S-transferase (Mgst1) (110), and the tumor
suppressors armadillo repeat containing, X-linked 3 (Armcx3) (111) and brain-
expressed myelocytomatosis oncogene (Bmyc) (112). In addition, Sipila et al. (93)
have identified 235 genes only expressed in the initial segment, whereas Chauvin
and Griswold (99) have identified 162, 55, and 133 genes enriched in the caput,
corpus, and cauda, respectively. Hence, genes expressed in a region-specific
manner belong to different gene families and include modifying enzymes [α-
mannosidase (113)] and growth factors [bone morphogenetic protein 8A (Bmp8a)
(114)]. They can also be intracellular proteins including transcription factors
[CCAAT/Enhancer binding protein (C/EBP) (115)] and kinases [A-raf serine
threonine kinase (116)]. Tissue- and region-specific gene expressions are
reviewed in (117).
47
2.4.2. Cell-specific gene expression
In the epididymis, some genes are only expressed in a particular cell type.
Principal cells exclusively express a desintegrin and metalloprotease 7 (Adam7)
(118), low-density lipoprotein receptor-related protein 2 (Lrp2) (119), and
cadherin 1 (Cdh1) (120), whereas basal cells express cyclo-oxygenase 1 (Cox1)
(121) and superoxide dismutase (Sod1) (122); clear cells specifically express
alpha-mannosidase II (Man2) (123). Furthermore, some of the genes are
expressed in a “checkerboard-like” pattern where some principal cells intensely or
faintly express the gene and others do not (124); these genes include clusterin
(Clu) (125) and phosphatidylethanolamine binding protein 1 (Pbp1) (126).
2.5. Protein expression
The epididymis secretes and absorbs proteins in a sequential and region-
specific manner to create specific microenvironments for the maturation of
spermatozoa. In humans, region-specificity is achieved by the modulation of
protein secretion and not by the presence or absence of region-specific proteins
(127). In order to identify the proteins responsible for the maturation process,
proteomics studies have been done in different species including human (127), rat
(128), mouse (129), rhesus monkey (130), boar (131), bull (132), stallion (131),
dog (132), hamster (133), guinea pig (133), rabbit (133), sheep (131), and
platypus (134). However, no more than 10% of the secreted proteins have been
identified so far (131). Most of the proteins that enter the lumen of the epididymis
from the rete testis are absorbed in the proximal caput epididymidis. Therefore,
most of the proteins identified are secreted in the epididymis with the exception of
some blood proteins (albumin and transferrrin) (131;133). In fact, secreted
proteins represent 20% to 60% of total protein synthesis in the corpus-cauda and
caput, respectively (133). In addition, new proteins are mostly synthesized in the
proximal caput with, for example in the boar, 107 new secreted proteins in the
caput, but only 13 and 5 new secreted proteins in the corpus and cauda
epididymidis, respectively (133). Protein concentrations in epididymal fluid vary
from region to region: from 2-4 mg/ml in initial segment, a maximum of 50-60
48
mg/ml in the distal caput, to 20-30 mg/ml in the cauda; these changes follow the
decrease in luminal water content from proximal to distal epididymis (131). More
than 60-80% of the total protein is composed of only 15-20 proteins, which
include lactoferrin, procathepsin D, NCP2 (HE1, CTP, cholesterol transfer
protein), glutathione peroxidase 5 (GPx5), beta-N-acetyl-hexominidase,
mannosidase, galactosidase, prostaglandin D2 synthase (PGDS), clusterin,
cystein-rich secretory protein (CRISP), and epididymal retinoic acid-binding
protein (E-RAPB) (131) [each protein is reviewed in (133)]. Secreted proteins can
be metabolic enzymes (lactate dehydrogenase (LDH), pyruvate kinase, enolase)
or enzymes involved in protection against peroxidation (glutathione S-transferase
P, thioredoxin peroxidase, and superoxide dismutase) (127). Although most of the
secreted proteins are not epididymis-specific, their secreted isoforms are
epididymis-specific due to their high degree of glycosylation and sulfation (133).
The roles of the identified proteins in epididymal spermatozoa maturation are still
unknown (132).
2.6. Diseases of the epididymis
2.6.1. Epididymitis
Epididymitis, an inflammation of the epididymis, is the most common
pathology of the epididymis and affects sexually active men. It is mostly caused
by infection with Chlamydia trachomatis, E. coli or Neisseria gonorrhoeae (135).
2.6.2. Cancer
Primary tumors of the epididymis are extremely rare, less than 40 cases
have been reported in the literature since 1916. Most epididymal tumors are
benign; there are only 24 reported cases of malignant tumors and they include
both primary and metastatic tumors (136;137).
49
3. Regulation of epididymal functions
The epididymis depends on hormones, vitamins, testicular factors, and
growth factors for the regulation of its structure, functions, and gene and protein
expressions.
3.1. Hormones and vitamins
Androgens are steroid hormones that are the primary regulators of
epididymal functions and hence will be dealt with in greater details in section 4.
Estrogens are also steroid hormones that play a role in the epididymis (6). The
role of other steroid hormones (glucorticoids, mineralocorticoids, and
progestagens) are still poorly understood (138). In addition, other hormones such
as oxytocin and thyroid hormones as well as vitamins such as retinoids (vitamin
A) play important roles in the epididymis (6).
3.1.1. Estrogens
The main estrogen in men is estradiol that arises from the irreversible
conversion of testosterone by cytochrome P450 aromatase (139). In the
epididymis, conversion of testosterone to estradiol can occur in the lumen and/or
epithelium. In the lumen, cytochrome P450 aromatase activity is found in
spermatozoa (6), whereas in the epithelium, cytochrome P450 aromatase activity
is found in principal cells (140;141). In the mouse, estradiol has been reported to
increase the rate of spermatozoa transport through the epididymis (35). This
process is mediated by the activation of the RhoA/ROCK (Rho-associated coiled-
coil forming kinase 1) signaling pathway that increases calcium sensitivity of the
contractile apparatus independently of intracellular calcium levels (142).
Estrogens act through the estrogen receptor (ER), which exists in two
isoforms (α and β). ERα and β are functionally distinct receptors that have
specific ligand binding domains (143). Expression of ERs in the epididymis is
developmentally-regulated (144) and there are cellular and regional differences in
their expressions. In fact, in the initial segment, narrow, apical, and some basal
cells express ERα; in the caput, principal and clear cells stain positively, whereas
50
in the distal regions, only clear cells express it. In contrast, ERβ is present in the
entire epididymis with stronger staining observed in the distal regions (6). The
importance of ERα in epididymal function has been demonstrated using the ERα
knockout mouse, which is infertile. The infertility is due to back-pressure atrophy
of the seminiferous tubules caused by the inability of the efferent ducts and initial
segment to reabsorb the large volume of fluid secreted by the testis. Hence,
estrogens control fluid reabsorption in the initial segment of the epididymis (145).
In addition, ERα knockout mice produce abnormal spermatozoa due to the
exposure of spermatozoa to an epididymal luminal environment with increased
pH and decreased osmolality (146;147). The role of ERβ in epididymal function
is still unknown because the ERβ knockout mouse is fertile and has normal testes
and epididymides (148).
In the epididymis, estradiol controls expression of genes involved in
apoptosis [nerve growth factor receptor (Ngfr)], calcium ion binding [S100
calcium binding protein G (S100g)], transport [albumin (Alb) and rhesus blood
group-associated C glycoprotein (Rhcg)] (149), and solute transport [cystic
fibrosis transmembrane regulator homolog (Cftr) and solute carrier 26, member 3
(Slc26a3)] (150).
3.1.2. Oxytocin
Oxytocin is a neurohypophysial hormone secreted by the hypothalamus
and stored in the posterior pituitary until its release into the circulation.
Traditionally considered a “female hormone” because of its role in parturition and
milk ejection, oxytocin plays important roles in the epididymis (151). Oxytocin
receptors localize to peritubular cells as well as to principal and basal cells in a
region- and species-specific manner (6). Oxytocin plays two important roles in the
epididymis. First, it stimulates basal contractility of the duct therefore promoting
transport of spermatozoa through the epididymis (152). This activity is regulated
in part by estrogens that increase gene and protein expressions of the oxytocin
receptor (153). Second, oxytocin promotes formation of DHT by stimulating 5α-
reductase activity in the initial segment (154); 5α-reductase (Srd5a) converts T to
51
DHT and exists as two isoforms, Srd5a type 1 and type 2 (6). The mechanism
underlying the stimulation of Srd5a activity by oxytocin is still unknown, but is
believed to involve phosphorylation of the enzyme by a tyrosine kinase (155).
3.1.3. Thyroid hormones
Thyroid hormones, the pro-hormone thyroxine (T4) and the active
hormone 3,5,5’-triiodothyronine (T3), produced by the thyroid gland, are essential
for normal development, growth, and metabolism (156). They also play crucial
roles in sexual maturation and reproductive function (157). Thyroid hormones
have been shown to affect the epididymis. In fact, hyperthyroidism changes the
activity of different glycosidases (158). On the other hand, hypothyroidism causes
morphological changes in the caput and cauda epididymidis with a decrease in the
number of epithelial cells (159) and an increased expression of thyroid hormone
receptor α1 (TRα1) and TRβ1 at the mRNA and protein levels (160). In addition,
sperm recovered from the cauda of hypothyroid rats are less motile (161).
Gestational-onset hypothyroidism causes decreased secretory activity of the
epididymis, decreased Srd5a activity and decreased expression of the androgen
receptor (AR) protein (162). The epididymis also expresses the highest level of
type I deioidinase of all male reproductive tissues; its activity and mRNA
expression are regulated by estradiol (163).
3.1.4. Retinoids
Retinoids (vitamin A) are highly potent molecules that control a wide
range of biological processes during development and in the adult (164). Due to
their hydrophobic nature, retinoids are bound to chaperones to ensure proper
storage, transport, and uptake by tissues. There are two extracellular retinoid-
binding proteins (RBP) [retinol-binding proteins and epididymal retinoic acid-
binding protein (E-RABP)] and four intracellular RBPs [cellular retinol-binding
protein (CRBP) I and II, and cellular retinoic acid-binding protein (CRABP) I and
II]. Retinoids act by binding to two classes of nuclear retinoic acid receptors,
RAR and RXR, each of which consists of three receptor subtypes α, β, and γ.
52
RARs and RXRs form heterodimers that bind retinoic acid response elements in
the promoter region of target genes (165).
Most components of the retinoid signaling pathway have been identified in
the epididymis. In fact, the epididymis expresses retinol, retinyl ester, all-trans
retinoic acid, and 9-cis-retinoic acid (9-cis-RA) in a region-specific manner. In
addition, the epididymis expresses RARα, β, and γ, as well as CRBPs, CRABPs,
and E-RABP (6). The importance of retinoids in the maintenance of epididymal
structure can be seen through vitamin A deficiency and RARα and/or γ knockout
mice. Indeed, vitamin A deficiency causes benign changes in the epithelial lining
(squamous metaplasia) of the epididymis (6). In addition, RARα knockout mice
show loss of organization of the columnar epithelium lining of the cauda,
vacuolization, and transformation by squamous metaplasia. This causes blockage
or rupture of the duct, inflammation, and infertility (166;167). The RARα/γ
double-null mutants show severe abnormality in development (dysplasia) or
complete failure of development during embryonic growth (agenesis) (168).
3.2. Testicular factors
Epididymal functions are also regulated by factors coming from the testis
through the lumen. These testicular factors regulate gene expression of the
epididymis in a paracrine manner termed “lumicrine” because it occurs in a
duct/tubal system (169). Lumicrine regulation occurs not only between the testis
and epididymis, but also between epididymal regions. The initial segment is the
region most sensitive to the regulation by testicular factors, but there could be
more distal effects that need to be investigated. In fact, testicular factors are
important for maintaining initial segment morphology (170), region-specific gene
expression (117), as well as protein synthesis and secretion (171). Although the
identity of most testicular factors is still unknown, candidates include steroids
such as androgens and estrogens and nonsteroidal proteins such as the androgen
binding protein (ABP), the basic fibroblast growth factor (FGF2), and
spermatozoa or spermatozoa-associated factors (6).
53
The ABP, as its name implies, acts as a carrier of T (6). It is synthesized
by Sertoli cells of the testis and more than 80% of it reaches the epididymis (172).
Principal cells also synthesize and secrete ABP (173). Where needed, T is
released from ABP and converted to the more potent DHT by Srd5a (6). ABP has
also been suggested to regulate Srd5a (174), to play a role in protein synthesis in
the caput (171), and to enhance the conversion of T to DHT in cultures of
epididymal principal cells (174).
FGFs play a role in mitogenesis, differentiation, migration, cell survival,
and male reproduction, acting in a paracrine or endocrine manner (175). FGFs
activate cell membrane FGF receptors (FGFRs) with tyrosine kinase activity
leading to the activation of the extracellular signal-regulated kinases (ERKs).
ERKs, in turn, phosphorylate downstream targets to mediate specific cell
responses (176). Although three soluble FGFs (2, 4, and 8) have been identified in
testicular luminal fluid, FGF2 is the only one with a functional role in the
epididymis; it regulates the mRNA expression of γ-glutamyl transpeptidase IV, a
gene highly expressed in the initial segment (6). Gene expression analysis has
identified Fgfr1-4 and Fgf1, 2, 7, 9 and 12 as being expressed in a region-specific
manner in the epididymis (176;177). In addition, FGFR-1 has been localized to
principal cells in the initial segment (178).
The presence of spermatozoa has been postulated to regulate initial
segment function, not by themselves, but through the ligands they might carry
(179). In fact, testicular spermatozoa express growth factor (GF) receptors (180).
It is possible that once in the initial segment, these GFs dissociate from the sperm
surface and become available to bind their receptors on epididymal cell surfaces
(6).
54
4. Androgens
Androgens are nonaromatized C19 steroids that play important roles in
different physiological processes (181). The two main androgens that act on male
reproductive tissues are T and the more potent DHT (182). In males, the Leydig
cells of the testis produce more than 95% of total circulating T, the remainder
being produced by the cortical cells of the adrenal glands (183;184).
4.1. Steroidogenesis, metabolism, and regulation
This section provides a brief overview of the production, secretion, and
metabolism of T, as well as the regulation of T biosynthesis by the hypothalamus-
pituitary axis.
4.1.1. Steroidogenesis in Leydig cells
Cholesterol is the precursor of androgens and other steroids. In Leydig
cells, cholesterol either enters the cells from plasma carried by low-density
lipoprotein (LDL) or high-density lipoprotein (HDL), or is synthesized de novo
from lipid droplets (185). Once the Leydig cells are stimulated by LH to
synthesize T, cholesterol is transported to the mitochondria where it is converted
to pregnenolone by the cytochrome P450 enzyme cholesterol side-chain cleavage
(P450scc), which is the rate-limiting step in the biosynthesis of T. Pregnenolone
then diffuses across the mitochondria membrane to the smooth endoplasmic
reticulum where it is converted to T following a series of enzymatic reactions
catalyzed by 17α-hydroxylase cytochrome P450 (P45017α), 3β-hydroxysteroid
dehydrogenase (3β-HSD), and 17 β-hydroxysteroid dehydrogenase (17β-HSD)
(186;187) (Fig. 4).
55
Figure 4: Steroid Biosynthetic Pathways in Leydig Cells
Testosterone is synthesized from cholesterol in Leydig cells through a series of
enzymatic reactions. The designations Δ4 and Δ5 refer to the localization of the
double bond in the steroid. P450scc is localized in the mitochondria, whereas all
the other enzymes are localized in the smooth endoplasmic reticulum. The
abbdreviations are as follows: P450scc: cytochrome P450 enzyme cholesterol
side-chain cleavage; P450c17: 17α-hydroxylase cytochrome P450; 3β-HSD: 3β-
hydroxysteroid dehydrogenase; 17β-HSD: 17 β-hydroxysteroid dehydrogenase;
5α-RED: 5α-reductase; P450arom: cytochrome P450 aromatase; NADPH:
nicotinamide adenine dinucleotide phosphate.
Reproduced from reference (183) with kind permission from Springer+Business
Media.
56
4.1.2. Secretion, transport, and metabolism
After synthesis, T leaves the Leydig cells by passive diffusion. In blood,
only 2% of total T circulates freely, the majority is bound to albumin or a carrier
protein called sex hormone-binding globulin (SHBG) or testosterone-estradiol-
binding globulin (TEBG) (184;186). SHBG is a glycoprotein that shares the same
amino acid sequence with ABP, the only difference being the types of
oligosaccharides associated with them (188). Although albumin has a low binding
affinity for T, the high concentration of albumin, as compared to SHBG, in blood
results in the approximate same proportion of T bound to albumin and SHBG.
Once it reaches its target tissue, T dissociates from albumin and enters the cell by
diffusion where it can exert its biological effects. Testosterone can directly
mediate its effects or be converted to its more potent metabolite DHT by Srd5a or
to estradiol by cytochrome P450 aromatase, thereby triggering different biological
responses (184) (Fig. 5). If T does not reach its target tissue, it is metabolized in
the liver through oxidation by 17β-HSDs, reduction through 3α-HSDs, followed
by glucuronidation and renal excretion (183) (Fig. 6).
57
Figure 5: Active Metabolites of Testosterone
Testosterone (T) can be reduced to dihydrotesterone (DHT) or aromatized to
estradiol (E2) in peripheral tissues.
Adapted from reference (45).
Testosterone (T)
Dihydrotestosterone (DHT)
NADPH
NADP+
5α-re
ducta
ses
Estradiol (E2)
Cytochrome P450
aromatase
NADP +
NADPH + O2
Testosterone (T)
Dihydrotestosterone (DHT)Dihydrotestosterone (DHT)
NADPH
NADP+
5α-re
ducta
ses
Estradiol (E2)
Cytochrome P450
aromatase
NADP +
NADPH + O2
58
Figure 6: Testosterone Metabolism
In target tissues, testosterone can be irreversibly converted to dihydrotestosterone
or estradiol. Testosterone or dihydrotestosterone can be metabolized through
oxidation by 17β-HSDs, reduction through 3α-HSDs, followed by
glucuronidation and renal excretion. Abbreviations are as follow: 3α-HSD: 3α-
hydroxysteroid dehydrogenase; 17β-HSD: 17 β-hydroxysteroid dehydrogenase;
G: glucuronide; HSD: hydroxyl steroid dehydrogenase; UGT: UDP-
glucuronosyltransferase.
Reproduced from reference (183) with kind permission from Springer+Business
Media.
59
4.1.3. The hypothalamus-pituitary axis
In males, steroidogenesis is controlled by luteinizing hormone (LH),
whereas spermatogenesis is under the control of both T and follicle-stimulating
hormone (FSH) (189). The relative role of FSH in the regulation of
spermatogenesis is beyond the scope of this section but is reviewed in references
(190-192). The gonadotropins LH and FSH are produced and secreted by the
anterior pituitary in response to stimulation by hypothalamic gonadotropin-
releasing hormone (GnRH). Secretion of GnRH is pulsatile and hence
gonadotropin release also occurs in pulses resulting in a series of peaks and
troughs in the circulation (183). LH binds to LH receptors present on the surface
of Leydig cells, thereby activating adenylate cyclase and stimulating production
of cyclic adenosine monophosphate (cAMP) that activates protein kinases. This in
turn stimulates the transport of cholesterol to the mitochondria to initiate T
production. LH is also necessary to maintain the expression of the T biosynthetic
enzymes. Once T is secreted, LH receptors are internalized and degraded
(186;187).
Regulation of T production occurs through a negative feedback
mechanism. Secreted T inhibits GnRH release from the hypothalamus, as well as
LH and FSH release from the pituitary. Leydig cells also produce E2 that inhibits
LH stimulation of T biosynthesis. This regulation occurs through AR and ER
present in the hypothalamus and the pituitary. Sertoli cells also regulate FSH
release by secreting inhibins, activins, and follistatin (193) (Fig. 7).
60
Figure 7: Feedback Mechanisms in the Hypothalamus-Pituitary-Testis Axis.
The production of testosterone is regulated by the hypothalamus and pituitary. (+)
indicates positive feedback, and (-) indicates negative feedback. Abbreviations are
as follows: GnRH: gonadotropin-releasing hormone; LH: luteinizing hormone;
FSH: follicle-stimulating hormone; T: testosterone; E2: estradiol.
Reproduced from reference (45).
61
Hypothalamus
GnRH
(+)
Pituitary
LH FSH
Leydigcell
Sertolicell
Germcell
Inhibitin, activin, follistatin
(+/-)
T
(-)
E2
(-)
Hypothalamus
GnRH
(+)
Pituitary
LH FSH
Leydigcell
Sertolicell
Germcell
Inhibitin, activin, follistatin
(+/-)
T
(-)
E2
(-)
62
4.2. Mechanisms of androgen action
Androgens predominantly act by binding to AR leading to the
transcription of target genes. There is also increasing evidence that androgens can
have rapid nongenomic effects.
4.2.1. Androgen receptor (AR)
The AR belongs to the steroid and nuclear receptor superfamily that are
ligand-inducible transcription factors (194). Located on the X chromosome, the
AR gene encodes a multidomain receptor that includes an N-terminal regulatory
domain (NTD), a DNA-binding domain (DBD), a small hinge region (H), and a
ligand-binding domain (LBD) (194;195). The NTD mediates the majority of AR
transcriptional activity and AR binding to co-regulators. Co-regulators affect
ligand selectivity and DNA-binding capacity of AR in a positive (co-activators) or
negative (co-repressors) manner (194). Co-activators and co-repressors are
reviewed in (196) and (197), respectively. More than 70 AR co-regulators have
been identified (198). The DBD is not only responsible for the binding of AR to
specific androgen response elements (AREs) in the promoter of target genes, but
also for the dimerization between AR monomers (194). The H region contains the
nuclear localization signal and sites for phosphorylation, acetylation, and
degradation, whereas the LBD mediates high affinity binding to androgenic
ligands (194). Mutations in AR cause a spectrum of disorders of androgen
insensitivity syndrome, prostate cancer, and feminization [reviewed in (198)].
4.2.2. Genomic androgen action
In target cells, the inactive AR is in the cytoplasm where it is bound by
heat shock proteins (hsps) that maintain it in a hormone-binding state (199). Upon
binding of T or DHT, AR goes through a series of conformational changes that
include dissociation of hsps, homodimerization, phosphorylation, and
translocation to the nucleus through the NLS (183). DHT has a two- to three-fold
higher affinity for AR and a five-fold slower dissociation rate than T making it a
more potent ligand than T (200). Once in the nucleus, AR binds to the AREs,
63
which are found as direct (5’-TGTTCTNNNTGTTCT-3’) and inverted (5’-
GGTACANNNTGTTCT-3’) repeats. While the direct repeat is specific for the
AR, the inverted repeat can be recognized by glucocorticoid, mineralocorticoid,
and progesterone receptors (201). AR then recruits other transcription co-
regulators that can (i) directly regulate transcription through physical interaction
with general transcription factors and RNA polymerase II; (ii) covalently modify
histone tails; and (iii) remodel the chromatin structure (194). Binding of T and
DHT to the AR elicits the transcription of different sets of genes (202).
Physiological effects of genomic androgen action take place 6h to 24h after
stimulation because they require de novo protein synthesis (203) (Fig. 8).
4.2.3. Non-genomic androgen action
Androgens can also trigger rapid responses, within seconds or minutes,
that occur too quickly to be accounted for by effects on transcription (204). For
example, application of T to a rat hypothalamus triggers neuron firing within
seconds (205), whereas application of T to rat anterior pituitary tissues stimulates
release of prolactin within 5 min (206). These effects are not prevented by
inhibiting transcription or translation (204). They occur through the rapid
induction of signaling cascades that include increase in free intracellular calcium
as well as activation of protein kinase A (PKA), protein kinase C (PKC), and
mitogen-activated protein kinases (MAPKs). These effects appear to be mediated
by membrane-bound receptors, although no membrane-associated AR has been
isolated so far (207;208). In addition, T can induce cAMP and PKA by binding to
SHBG associated to its receptor on the cell surface; SHBG normally binds T in
the circulation (reviewed in section 4.1.2.). The induction of these signaling
cascades may ultimately regulate the transcriptional activity of AR or other
transcription factors. T and DHT can also influence membrane fluidity by
interacting with membrane phospholipids (208) (Fig. 8).
64
Figure 8: Mechanisms of Androgen Action
Androgens predominantly act by binding to AR leading to the transcription of
target genes, a mode of action referred to as genomic (classical) (A). They can
also trigger rapid responses through the activation of second messengers in a
nongenomic (non-classical) manner (B). Nongenomic modes of action can occur
through stimulation of intracellular tyrosine kinase c-steroid receptor co-activator
(Src) and sex hormone binding globulin receptor (SHBG-R) leading to the
activation of protein kinase A (PKA) and mitogen-activated protein kinases
(MAPKs). In addition, androgens may bind a plasma membrane G protein-
coupled receptor or an uncharacterized membrane-bound AR causing an increase
in free intracellular calcium and activation of protein kinase C (PKC), PKA, and
MAPKs. The induction of these signaling cascades may ultimately regulate the
transcriptional activity of AR or other transcription factors. Abbreviations are as
follows: ARE: androgen response element; cAMP: cyclic AMP; CaM:
calmodulin; Pol II complex: RNA polymerase II complex; PTK: phosphotyrosine
kinase; SH2: Src homology 2 domain; SH3: Src homology 3 domain; Srd5aR:
steroid 5α-reductase; T: testosterone; DHT: dihydrotestosterone; TFs:
transcription factors.
Adapted from reference (208).
65
LegendT
DHTAR
CoregulatorsB. Nongenomic (Non-Classical)
A. Genomic (Classical)
G protein-coupled receptor
SHBG-R
Src
LegendT
DHTAR
CoregulatorsB. Nongenomic (Non-Classical)
A. Genomic (Classical)
G protein-coupled receptor
SHBG-R
Src
66
4.3. Androgen action in peripheral tissues
In the male, T plays crucial roles in sexual differentiation in utero and in
the development of secondary sexual characteristics at puberty (186). In the adult,
T maintains secondary sex organs and regulates male sexual behavior and
spermatogenesis. It also acts on muscle to maintain muscle mass and strength as
well as on bone to regulate bone mineral density. In addition, T acts on the central
nervous system and cardiovascular system. The tissue-specific effects of
androgens can be attributed to the expression of specific co-regulators as well as
the presence of metabolizing enzymes. As mentioned previously in section 4.2.1,
co-regulators affect ligand selectivity and DNA-binding capacity of AR in a
positive (co-activators) or negative (co-repressors) manner (194). Metabolizing
enzymes determine not only which androgen acts on the target tissue but also the
duration of the response. In the muscle, where Srd5a activity is low, T directly
acts on the AR, whereas in some brain nuclei, T is aromatized to estradiol to exert
its effects. In addition, in tissues such as the epididymis, prostate, seminal
vesicles, and skin, T is converted to DHT by Srd5a (6). Enzymes such as 17β-
HSD2 and 3α-HSDs regulate intracellular androgen concentration and activation
of AR; 17β-HSD2 inactivates T, DHT, and estradiol, whereas 3α-HSDs
specifically inactivate DHT (184).
4.4. Androgen action in the epididymis
Although few studies have focused specifically on the mechanisms of
androgen action in the epididymis, it is highly probable that many of the
characteristics and modes of action of AR resemble those in other tissues, while
some are likely to be specific to the epididymis (6). In the epididymis, AR is
expressed in a cell-specific manner throughout the duct with a slight decline in
mRNA and protein expressions from caput to cauda (209;210).
Androgens, in particular T and DHT, regulate epididymal structure, gene
expression, and survival. In order to study androgen action in the epididymis,
different approaches have been used that include treatment with AR antagonists to
inhibit androgen action (211-213), treatment with SR inhibitors to distinguish the
67
effects of T from DHT (214;215), treatment with GnRH antagonists to inhibit T
biosynthesis (216;217), removal of both testes by bilateral orchidectomy
(26;85;218-222), and efferent duct ligation (219;223-226). Bilateral orchidectomy
causes not only a loss of androgens, but also of testicular factors, whereas efferent
duct ligation only removes testicular factors and maintains serum T. In order to
assess the direct effects of T and DHT on epididymal functions, T replacement is
often used (227-230).
4.4.1. Structure
After orchidectomy, epididymal weight decreases to 25% of control over a
two week period, followed by a further 5% in the subsequent two weeks. This
decrease in weight is not as marked as other reproductive tissues such as the
prostate; prostate weight decreases to 10% of control by four weeks after
orchidectomy. Unlike other reproductive tissues, T replacement, even at
supraphysiological levels, restores epididymal weight to only 50% of control.
This partial rescue is due to the loss of luminal fluid and spermatozoa that, in the
rat, make up half of the epididymal weight (231;232). Orchidectomy also causes
major morphological changes to the epididymal epithelium that include a decrease
in luminal diameter and epithelial cell height as well as an increase in intertubular
stroma (219). Principal cells are the most affected cells after orchidectomy
indicating that they are particularly sensitive to androgen levels (26). In an
androgen-deprived state, principal cells have compromised secretory function
marked by the disappearance of the endoplasmic reticulum and of vesicles from
the cell apex; they also undergo loss of apical microvilli from their surface,
vacuolization, lysosome accumulation, and increased endocytosis (26;222;233).
In that state, AR activity is decreased, while Srd5a activity becomes undetectable,
suggesting that androgen action is compromised (226;231). In addition, after
orchidectomy, total epididymal protein, RNA, and DNA content are decreased,
whereas DNA concentration is increased (234). DNA concentration increases
because there is a decrease in cell volume, which is the principal mechanism by
which the epithelium regresses after orchidectomy (6). Restoration of T to serum
68
T levels reverses regressive changes in the caput, corpus, and cauda epididymides
observed after orchidectomy, but not in the initial segment, even when
supraphysiological levels are administered (231).
In the adult rat epididymis, the mitotic rate is not affected by the constant
androgen stimulation as opposed to other androgen-dependent tissues such as the
prostate and seminal vesicles (23;235). This may be due to the presence of
antiproliferative signals that prevent cellular proliferation in response to androgen
stimulation. In fact, the proximal caput highly expresses a potential
antiproliferative protein B-myc. B-myc is a transcription factor that inhibits
cellular proliferation; its expression depends on androgens and testicular factors
(112;236). However, in the regressed rat epididymis, T supplementation increases
mitotic rate in all epididymal regions (237).
4.4.2. Gene expression
Androgens regulate many epididymal functions that include intermediate
metabolism, ion transport, synthesis and secretion of many epididymal proteins,
as well as the activity of some enzymes. Androgens also regulate transport,
maturation, and storage of spermatozoa (6). This dependence on androgens for
epididymal functions is associated with the control of gene transcription by
androgens. Although many transcripts have been shown to be androgen-regulated
(89;99;150), only a few have been shown to contain functional AREs in their
promoter region. These genes include Gpx5 (238;239), lipocalin 5 (240),
reproductive homeobox 5 (241), and Crisp1 (242). Some genes such as Ar (243),
Gpx3 (244), and carbonic anhydrase IV (245) are regulated by androgens. Genes
having a level of expression that does not return to control levels after T
replacement are regulated by testicular factors. These genes include γ-glutamyl
transpeptidase (GGT) (246), polyomavirus enhancer activator 3 (PEA3) (247),
Gpx5 (248), and Srd5a (249).
Many groups have used gene array technology to identify androgen-
regulated genes in the epididymis (85;89;99;150;250;251). These studies have
allowed not only to confirm the androgen-dependence of previously characterized
69
genes, but also to identify novel genes and overall patterns of gene expression
after orchidectomy. They have shown that genes belonging to different functional
families are regulated by androgens. These functional families include solute
carrier family (Slc1a5, Slc12a3, Slc15a2, Slc22a5, and Slc9a2), heat shock
proteins [Hsp47, Hsp27, glucose-regulated protein 97 and 78 (Grp97 and Grp78],
gap junction proteins (Gja1, Gja4, and Gjb3), proteins regulating cell growth, cell
proliferation, and apoptosis [aryl hydrocarbon receptor (Ahr), plasminogen
activator urokinase (Plau), platelet-derived growth factor, C polypeptide (Pdgfc),
and c-fos induced growth factor (Figf)], proteins involved in signal pathway and
signal transduction [receptor (G protein-coupled) activity modifying protein 3
(Ramp3), calcitonin receptor-like (Calcrl), and inositol 1,4,5-triphosphate
receptor 3 (Itpr3)], proteolytic and peptidolytic enzymes [Adam7, Adam9, and
cathepsin C (Ctsc)], and proteins regulating development [actin, alpha 1, skeletal
muscle (Acta1), growth arrest-specific 7 (Gas7), and protein phosphatase 2,
regulatory subunit B, beta isoform (Pppr2b2)] (85;150;251). In addition, in the
PC-1 mouse epididymis cell line, genes involved in apoptosis [thymoma viral
protooncogene 1 (Akt1) and caspase 1 (Casp1)], cell adhesion [cadherin 2 (Cdh2)
and laminin, α5 (Lama5)], cell signaling [fibroblast growth factor receptor 1
(Fgfr1) and integrin linked kinase (Ilk)], cell cycle [cyclin A2 (Ccna2) and jun
protooncogene-related gene d1 (Jund1)], cell proliferation [insulin-like growth
factor binding protein 2 (Igfbp2)], DNA repair [RAD21 homolog (Rad21) and
RAD23b homolog (Rad23b)], metabolism [glyceraldehyde-3-phosphate
dehydrogenase (Gapdh) and tissue inhibitor of metalloproteinase 2 (Timp2)],
enzyme activity [3-phosphoglycerate dehydrogenase (Phgdh)], protein folding
[serine (or cysteine) peptidase inhibitor, clade H, member 1 (Serpinh1)], mRNA
processing [THO complex 4 (Thoc4)], transcription [transcription termination
factor 1 (Ttf1) and activating transcription factor 4 (Atf4)], and protein transport
[RAB2, member RAS oncogene family (Rab2)], have been shown to be androgen-
regulated (250).
70
5. Apoptosis and cell survival
Apoptosis or programmed cell death is a locally and temporally defined
process of self-destruction. The term apoptosis comes from the Greek “falling of
leaves from a tree in the fall” and refers to the life and death cycle of life (252).
Apoptosis plays an important role in development and morphogenesis to control
cell number and to remove damaged, infected or mutated cells (253). Many
diseases are correlated with misregulated apoptotis. In fact, too much apoptosis is
associated with neurodegenerative diseases such as Parkinson’s and Alzheimer’s
diseases, spinal muscular atrophy, and AIDS, whereas too little apoptosis is
observed in cancer or autoimmune diseases such as diabetes type I (252).
Apoptosis is initiated by specific signals and characterized by chromatin
condensation, nuclear fragmentation, cytoplasmic shrinkage, membrane blebbing
and formation of apoptotic bodies. The latter are removed by macrophages
therefore preventing inflammation at the site (252). Apoptosis can be initiated
through two specific signaling pathways, the extrinsic and intrinsic pathways, is
accomplished through the activation of caspases, and is regulated at different
levels.
5.1. Apoptotic and cell survival pathways
5.1.1. Caspases
Caspases are cysteine-dependent aspartate-specific proteases that are
synthesized as pro-enzymes; their activation requires proteolysis by other
caspases. Caspases involved in apoptosis are divided into two subgroups
depending on their function; (i) the initiator caspases that initiate the apoptotic
pathway and include caspase-2, -8, -9, and -10; and (ii) the effector or executioner
caspases that degrade cellular targets and include caspase-3, -6, and -7. Initiator
caspases can be activated either by the extrinsic pathway such as caspase-8 and -
10 or by the intrinsic pathway such as caspase-9. On the other hand, executioner
caspases are activated by their cleavage by initiator caspases (254). Once
activated, executioner caspases cleave cellular substrates causing all the
71
morphological changes occurring during apoptosis. Targets of caspase cleavage
include many important cellular substrates such as the inhibitor of caspase-
activated DNase (ICAD), ROCK1, the DNA repair enzyme poly(ADP-
ribose)polymerase (PARP), actin, lamin, cell cycle regulators [retinoblastoma
protein (pRB)], transcription factors (NF-κB), and cell signaling proteins [Raf,
protein kinase B (PKB)] (252;255) [reviewed in (256)].
5.1.2. Extrinsic pathway
The extrinsic pathway is initiated by the binding of tumor-necrosis factor
(TNF) ligands to specific cell-death receptors, the tumor-necrosis factor receptors
(TNFRs), on the surface of cells (257). Eight members of the TNFR family
contain a death domain (DD) that allow them to participate in apoptosis and
include FAS [Apo-1, CD95 or death receptor-1 (DR1)], TNF-R1 (DR2), DR3
[TNF-receptor-related apoptosis mediating protein (TRAMP) or Apo-3], DR4
[TNF-related apoptosis inducing ligand receptor-1 (TRAIL-R1) or DR4], DR5
(TRAIL-R2 or Apo-2), DR6, ectodysplasin A receptor (EDAR), and nerve growth
factor receptor (NGFR). There are also four decoy receptors to which ligands
bind, but that do not lead to signal activation therefore inhibiting apoptotic
signaling; these receptors are decoy receptor-1 (DcR1), DcR2, DcR3, and
osteoprotegerin (255;258). TNFRs have no enzymatic activity of their own; hence
they rely on adapter proteins to transmit the signal, thereby allowing for specific
responses (259). The five adaptor proteins that bind to the receptors and one
another to transduce signaling are TNFR1-associated death domain protein
(TRADD), receptor-interacting protein (RIP), Fas-associated death domain
protein (FADD), TNF-receptor-associated factor (TRAF), and CASP2 and RIPK1
domain containing adaptor with death domain (CRADD) (260). They form a
death inducing signaling complex (DISC) that recruits the initiator pro-caspase 8
leading to its processing into caspase-8. Caspase-8 then activates the executioner
caspase-3 (252).
72
5.1.3. Intrinsic pathway
The intrinsic or mitochondrial pathway is a stress-induced response of the
cell to stressors such as UV- and γ-radiations, genotoxic and cytotoxic drugs,
oxidative free radicals, and cytokine and growth factor deprivation (261). These
stimuli lead to the release of cytochrome c from the mitochondria into the
cytoplasm, where it binds the apoptotic protease activating factor-1 (APAF-1).
This binding triggers the formation of the apoptosome that recruits pro-caspase 9
to activate it into caspase-9. Caspase-9 in turn activates caspase-3 (252).
The B cell leukaemia/lymphoma 2 (Bcl2) family of proteins regulate the
activation of the intrinsic pathway by either controlling cytochrome c release or
formation of the apoptosome. They are categorized into three subfamilies
according to their function and structure; (i) the anti-apoptotic Bcl2 subfamily that
contains four Bcl2 homology (BH) domains (BH1-4) and include Bcl2, Bcl2l1
(Bcl-xL), Bcl2l2 (Bcl-w), Bcl2l10 (Bcl-B/Diva/Boo), Mcl1, and Bcl2a1a (A1); (ii)
the pro-apoptotic Bax subfamily with three BH domains (BH1-3) that include
Bax, Bak1, and Bok; and (iii) the pro-apoptotic BH3-only domain subfamily that
include Bik, Bad, Bid, Blk, Hrk, Bcl2l11, and Bnip3. The members of the Bcl2
and Bax subfamilies are anchored into the mitochondrial membrane, whereas the
members of the BH3-only subfamily act as ligands that associate with the
membrane-anchored proteins (254). The fate of the cell is determined by the
interactions between the pro- and anti-apoptotic members (262).
5.1.4. Regulation of apoptosis
Tight regulation of apoptotis is required to prevent inadequate activation.
Although activation of caspases is a committed step toward apoptosis, there are
proteins that inhibit caspase enzymatic activity, the inhibitor of apoptosis proteins
(IAPs). There are seven mammalian IAPs that are characterized by the presence
of one or more copies of the baculovirus IAP repeat (BIR) motif; they are cellular
IAP-1 (cIAP-1, BIRC2), cIAP-2 (BIRC3), X-chromosome-linked IAP (XIAP),
neuronal apoptosis inhibitory protein (NAIP), survivin (BIRC5), livin (BIRC7),
and testis-specific IAP (ts-IAP, BIRC8) (263). IAPs are in turn negatively
73
regulated by two mitochondrial proteins, DIABLO (direct IAP-binding protein
with low pI) and HTRA2 (high-temperature requirement serine protease A2), and
the nuclear protein XIAP-interacting protein (XAF-1). DIABLO and HTRA2 are
released from the mitochondria into the cytoplasm during apoptosis and bind to
IAPs preventing their inhibition of caspase activity. On the other hand, XAF-1 not
only directly inhibits IAP activity, but also sequesters them away from the
cytoplasm into the nucleus (264).
5.2. Growth factor survival pathways
Growth factors interact with their respective cell surface receptors to
regulate cell growth, metabolism, differentiation, cell death, and survival (265). In
the epididymis, many growth factors are expressed. They include epidermal
growth factor (EGF) (266), basic fibroblast growth factor (FGF2) (177), vascular
endothelial growth factor A (VEGFA) (267), nerve growth factor (NGF) (268),
platelet-derived growth factor (PDGF) (269), transforming growth factor-β
(TGFβ) (270), insulin-like growth factor (IGF) (271), erythropoietin (272), and
hepatocyte growth factor (273). Previously, Henderson and Robaire (250) have
shown that treatment with PNU157706, a dual Srd5a inhibitor, decreases Igf1
expression in the distal epididymal regions. In addition, Hamzeh and Robaire
(149) have identified Igf1 and Igbp3 as two genes changing early after androgen
withdrawal. As these data suggest a potential involvement of the IGF1 signaling
pathway in the response of the epididymis to androgen withdrawal, this section
focuses on IGF1.
IGF1 binding to the extracellular domain of IGF1R triggers
autophosphorylation and tyrosine phosphorylation of IGF1R substrates, which
include insulin receptor substrate (IRS)-1 or -2, Src- and collagen-homology
(SHC) proteins, and growth factor receptor-binding protein 2 (Grb2). These
phosphorylated proteins then activate the Ras/Raf/MAPK pathway or the
phosphatidylinositol 3-kinase (PI3K)/Akt pathway. Activation of the MAPK
pathway leads to cell proliferation, whereas the PI3K/Akt pathway regulates the
anti-apoptotic responses. Activation of the PI3K/Akt pathway leads to the
74
activation of the anti-apoptotic proteins Bcl2 and Bcl2l1 and inhibition of the pro-
apoptotic proteins Bax, Bad, Bcl2l1, and caspase-9. Furthermore, it activates
nuclear factor-κB (NF-κB) transcriptional activity leading to transcription of
survival genes (274;275). IGF1 bioavailability is regulated by IGF binding
proteins (IGFBPs). The most abundant one, IGFBP3 forms a ternary complex
with IGF1 and acid-labile subunit (ALS) that prolongs IGF1 half-life and prevents
it from reaching its receptor (275). In addition, IGFBP3 may exert IGF1-
independent effects that can promote both cell death and cell survival [reviewed
in (276)]. Once internalized, IGF1 is degraded by the insulin-degrading enzyme
(IDE) leading to signal termination (277). Many interactions exist between the
AR and the IGF1 signaling pathway [reviewed in (278)]. In fact, IGF1 (279) and
IGFBP3 (280) have functional AREs in their promoter region leading to
transcriptional regulation, whereas AR up-regulates IGF1R expression (279).
Furthermore, activation of IGF1 and the PI3K signaling cascade leads to
increased AR expression (281), whereas interaction between IDE and AR
enhances AR DNA binding (282;283).
6. Cell survival and apoptosis in the epididymis
During postnatal development in the mouse, orchidectomy causes low
levels of apoptosis in all regions of the epididymis; this can be prevented by
administration of T (220). This illustrates the dependence of the epididymis on
androgens and testicular factors for its growth and differentiation (6). In the adult
rat, although after orchidectomy there are varying degrees of apoptosis observed
in each region, at the peak of the response, the number of apoptotic cells averages
only 1 cell per tubule. The low rate of observed apoptosis can be prevented by
administration of T in all regions, except the initial segment. In addition, efferent
duct ligation causes the same extent of apoptosis in the initial segment as
orchidectomy; the caput is less affected than in orchidectomized rats, whereas the
corpus and cauda are not affected. Principal cells are the only cell type affected
(229). Investigations on the molecular mechanisms underlying the apoptosis
observed after orchidectomy have shown that it is independent of p53 (284;285)
75
and Fos (FBJ osteosarcoma oncogene) (286). The tumour-suppressor Tp53 is a
central sensor of cellular stress and its activation leads to apoptosis (287), whereas
Fos combines with Jun family members to form the AP-1 transcription factor that
plays a role in proliferation, differentiation, and apoptosis (288). Conflicting
reports exist on its dependence on Fas with one group showing that it is (289) and
the other one showing that it is not (290). In addition, Bcl2, an anti-apoptotic
protein, is suppressed after orchidectomy (289).
At the transcriptional level, two pro-apoptotic genes [defender against cell
death protein 1 (Dad1) and tumor necrosis factor receptor 1 (Tnfrsf1a)] and an
anti-apoptotic gene [myeloid cell differentiation protein 1 (Mcl1)] have been
shown to be affected after orchidectomy in the epididymis (85).
7. Formulation of project
Androgens are steroid hormones that predominantly act by binding to AR
leading to the transcription of genes thereby regulating many reproductive and
non-reproductive functions. Dysregulation of androgen functions can lead to male
infertility, alopecia, benign prostatic hyperplasia, and prostate cancer. There is,
therefore, a need to better understand the molecular mechanisms underlying
androgen actions. This thesis focuses on the epididymis, the tissue where
spermatozoa acquire their fertilizing ability and where they are stored before
ejaculation. The epididymis depends on androgens and testicular factors to
maintain its functions. However, unlike other hormone-dependent tissues such as
the prostate, the epididymis is particularly resistant to tumor formation. In
addition, after androgen withdrawal by orchidectomy, there is little apoptosis with
less than 1% of the cells lost; this is in sharp contrast with the prostate where 80%
of the cells are lost by apoptosis within 10 days of surgery.
The overall goal of this thesis is to understand the molecular mechanisms
involved in the resistance of the epididymis to apoptosis triggered by androgen
withdrawal using in vivo and in vitro systems. I hypothesize that androgen
withdrawal triggers the activation of a series of specific survival signaling
pathways that act to help protect the epididymis against high levels of apoptosis.
76
Despite numerous studies on the overall gene expression in the epididymis
of different species and under different pathological and experimental conditions,
little is known about the apoptotic and cell survival genes activated or repressed
after orchidectomy. Chapter 2 of this thesis identifies the apoptotic and survival
genes activated early after orchidectomy with or without testosterone replacement
in the rat epididymis. Using gene array technology, bioinformatics, and molecular
biology tools, androgen-regulated genes belonging to the major apoptotic and cell
survival gene families were identified in the different regions of the epididymis.
The IGF1 signaling pathway and BIRC5 are important regulators of cell
survival. They are both expressed in the epididymis and regulated by androgens.
In addition, IGF1 is a central regulator of the response of the mouse PC-1
epididymal cell line to androgen withdrawal. Chapter 3 explores the effects of
orchidectomy on the IGF1 signaling pathway and BIRC5 in the rat epididymis.
Changes in mRNA and protein expression of IGF1, IGF1R, and BIRC5 were
assessed by quantitative real-time PCR (qRT-PCR) and western blots. In addition,
changes in mRNA expression of two upstream regulators of IGF1 signaling,
Igfbp3 and insulin-degrading enzyme, as well as of Bax and Diablo, two pro-
apoptotic genes acting downstream of the signaling cascade were assessed by
qRT-PCR.
Most of the work on the effects of androgen withdrawal on the epididymis
has been done in vivo. However, in order to determine the specific signaling
cascades triggered after androgen withdrawal in the epididymis, in vitro cell
model systems are necessary. The PC-1 and DC-3 mouse epididymal cell lines are
androgen-dependent cells and offer a potential useful tool to answer specific
questions about androgen regulation of the epididymis. Chapter 4 assesses the
effects of androgen withdrawal on the PC-1 and DC-3 mouse epididymal cell
lines by determining their viability after androgen treatment or withdrawal.
Furthermore, changes in transcript expression for Igf1, Igf1r, and Birc5 were
determined by qRT-PCR.
Together, these studies will provide novel insights into androgen
regulation of apoptotic and survival genes in the epididymis, as well as into the
77
molecular mechanisms underlying epididymal resistance to apoptosis triggered by
androgen withdrawal.
78
References
1. Roberts KP 1995 What are the components of the male reproductive
system? In: Robaire B., Pryor J.L., Trasler J.M., eds. Handbook of
Andrology. The American Society of Andrology ed. Allen Press; 1-4
2. Robaire B, Hermo L 1988 Efferent Ducts, Epididymis, and Vas
Deferens: Structure, Functions, and Their Regulation. In: E.Knobil and
J.Neill et al., ed. The Physiology of Reproduction. Raven Press, Ltd.; 999-
1080
3. Setchell BP, Breed WG 2006 Anatomy, Vasculature, and Innervation of
the Male Reproductive Tract. In: J.D.Neill, ed. Knobil and Neill's
Physiology of Reproduction. 3rd edition ed. Academic Press; 771-825
4. Cooper TG 1999 Epididymis. Encyclopedia of Reproduction. Academic
Press; 1-17
5. Reid B, Clewland K 1957 The structure and function of the epididymis.
1. The histology of the rat epididymis. Aust J Zool223-246
6. Robaire B, Hinton BT, Orgebin-Crist MC 2006 The Epididymis. In:
Jimmy D.Neill, ed. Knobil and Neill's Physiology of Reproduction. Third
Edition ed. Elsevier; 1071-1148
7. Hinton BT 1995 What does the epididymis do and how does it do it? In:
Bernard Robaire, Jon L.Pryor, Jacquetta M.Trasler, eds. Handbook of
Andrology. The American Society of Andrology ed. Allen Press, Inc.; 18-
20
8. Hermo L, Robaire B 2002 Epididymal cell types and their functions. In:
Robaire, Hinton, eds. The Epididymis: From Molecules to Clinical
Practice. Kluwer Academic-Plenum Publishers; 81-97
79
9. Turner TT 2008 De Graaf's Thread: The Human Epididymis. 29 ed.; 237-
250
10. Orgebin-Crist MC 1998 The epididymis across 24 centuries. J Reprod
Fertil Suppl 53:285-292
11. Hamilton DW 2002 The testicular excurrent duct system: an historical
outlook. In: Robaire B., Hinton B.T., eds. The Epididymis: From
Molecules to Clinical Practice. Kluwer Academic/Plenum Publishers; 1-10
12. Takano H., Abe K., Ito T. 1981 Changes in the mouse epididymis after
ligation of the ductuli efferentes or proximal epididymal duct: qualitative
and quantitative histological studies. Kaibogaku Zasshi 56:79-90
13. Turner TT, Gleavy J.L., Harris J.M. 1990 Fluid movement in the lumen
of the rat epididymis: effect of vasectomy and subsequent vasovasostomy.
J Androl 11:422-428
14. Maneely RB 1959 Epididymal structure and function: a historical and
critical review. Acta Zool 40:1-21
15. Benoit J 1926 Recherches anatomiques, cytologiques et
histophysiologiques sur les voies excrétrices du testicule chez les
mammifères. Arch Anat Histol Embryol (Strasb) 5:173-412
16. Nicander L 1958 Studies on the regional histology and cytochemistry of
the ductus epididymis in stallions, rams, and bulls. Acta Morphol Neerl
Scand 1:337-362
17. Hoffer AP, Karnovsky ML. 1981 Studies on zonation in the epididymis
og the guinea pig: I. Ultrastructural and biochemical analysis of the zone
rich in large lipid droplets (zone II). Anat Rec 201:623-633
18. Reid B.L., Cleland K.W. 1957 The structure and function of the
epididymis: histology of the rat epididymis. Aust J Zool 5:223-246
80
19. Hermo L 1995 Structural features and functions of principal cells of the
intermediate zone of the epididymis of adult rats. Anat Rec 242:515-530
20. Turner TT, Bomgardner D, Jacobs JP, Nguyen QA 2003 Association
of segmentation of the epididymal interstitium with segmented tubule
function in rats and mice. Reproduction 125:871-878
21. Rodríguez CM, Kirby JL, Hinton BT 2002 The development of the
epididymis. In: Robaire B., Hinton B.T., eds. The Epididymis: From
Molecules to Clinical Practice. Kluwer Academic/Plenum Publishers; 251-
267
22. Joseph A, Yao H, Hinton BT 2009 Development and morphogenesis of
the Wolffian/epididymal duct, more twists and turns. Dev Biol 325:6-14
23. Clermont Y, Flannery J 1970 Mitotic Activity in the Epithelium of the
Epididymis in Young and old Adult Rats. Biol Reprod 3:283-292
24. Turner TT 1991 Spermatozoa are exposed to a complex
microenvironment as they traverse the epididymis. In: Robaire B, ed. The
male germ cell - Spermatogonium to fertilization. New York: Annals of
the New York Academy of Sciences; 364-383
25. Cornwall GA 2009 New insights into epididymal biology and function.
Hum Reprod Update 15:213-227
26. Moore HD, Bedford JM 1979 Short-term effects of androgen withdrawal
on the structure of different epithelial cells in the rat epididymis. Anat Rec
193:293-311
27. Seiler P, Cooper TG, Nieschlag E 2000 Sperm number and condition
affect the number of basal cells and their expression of macrophage
antigen in the murine epididymis. Int J Androl 23:65-76
81
28. Seiler P, Wenzel I, Wagenfeld A, Yeung CH, Nieschlag E, Cooper TG
1998 The appearance of basal cells in the developing murine epididymis
and their temporal expression of macrophage antigens. Int J Androl
21:217-226
29. Cyr DG, Finnson K, Dufresne J, Gregory M 2002 Cellular interactions
and the blood-epididymal barrier. In: Robaire B, Hinton BT, eds. The
Epididymis: From Molecules to Clinical Practice. Kluwer
Academic/Plenum Publishers; 103-118
30. Hinton BT, Palladino MA 1995 Epididymal epithelium: its contribution
to the formation of a luminal fluid microenvironment. Microsc Res Tech
30:67-81
31. Cyr DG, Robaire B, Hermo L 1995 Structure and turnover of junctional
complexes between principal cells of the rat epididymis. Microsc Res
Tech 30:54-66
32. Bedford JM 1994 The status and the state of the human epididymis.
Human Reproduction Update 9:2187-2199
33. Pholpramool C, Triphrom N 1984 Effects of cholinergic and adrenergic
drugs on intraluminal pressures and contractility of the rat testis and
epididymis in vivo. J Reprod Fertil 71:181
34. Hib J 1977 The 'in vivo' effects of oxytocin and vasopressin on
spontaneous contractility of the rat epididymis. Int J Fertil 22:63-64
35. Meistrich ML, Hughes TH, Bruce WR 1975 Alteration of epididymal
sperm transport and maturation in mice by oestrogen and testosterone.
Nature 258:145-147
36. Hib J, Oscar P 1978 Effects of prostaglandins and indomethacin on rat
epididymal responses to norepinephrine and acetylcholine. Arch Androl
1:43-47
82
37. Jaakkola U-M, Talo A 1980 Effect of temperature on the electrical
activity of the rat epididymis in vitro. J Therm Biol 5:207-210
38. Bedford JM 1978 Influence of abdominal temperature on epididymal
function in the rat and rabbit. Am J Anat 152:509-522
39. Olson GE, NagDas SK, Winfrey VP 2002 Structural differentiation of
spermatozoa during post-testicular maturation. In: Robaire B, Hinton BT,
eds. The Epididymis: From Molecules to Clinical Practice. New York:
Kluwer Academic/Plenum Publishers; 371-387
40. Ariel M, Cedar H, McCarrey J 1994 Developmental changes in
methylation of spermatogenesis-specific genes include reprogramming in
the epididymis. Nat Genet 7:59-6
41. Orgebin-Crist MC, Jahad N, Hoffman LH 1976 The effects of
testosterone, 5alpha-dihydrotestosterone, 3alpha-androstanediol, and
3beta-androstanediol on the maturation of rabbit epididymal spermatozoa
in organ culture. Cell Tissue Res 167:515-525
42. Johnson L, Varner DD 1988 Effect of Daily Spermatozoan Production
but Not Age on Transit Time of Spermatozoa through the Human
Epididymis. Biology of Reproduction 39:812-817
43. Orgebin-Crist MC, Tichenor PL 1972 A technique for studying sperm
maturation in vitro. Nature 239:227-228
44. Telgmann R, Brosens JJ, Kappler-Hanno K, Ivell R, Kirchhoff C
2001 Epididymal epithelium immortalized by simian virus 40 large T
antigen: a model to study epididymal gene expression. Mol Hum Reprod
7:935-945
83
45. Orgebin-Crist MC, Jahad N, Hoffman LH 1976 The effects of
testosterone, 5alpha-dihydrotestosterone, 3alpha-androstanediol, and
3beta-androstanediol on the maturation of rabbit epididymal spermatozoa
in organ culture. Cell Tissue Res 167:515-525
46. Orgebin-Crist MC, Jahad N 1978 The maturation of rabbit epididymal
spermatozoa in organ culture: inhibition by antiandrogens and inhibitors
of ribomucleic acid and protein synthesis. Endocrinology 103:46-53
47. Blaquier JA 1973 An in vitro action of androgens on protein synthesis by
epididymal tubules maintained in organ culture. Biochem Biophys Res
Commun 52:1177-1183
48. Blaquier JA, Breger D 1974 The in vitro effects of androgens on RNA
synthesis by cultured rat epididymal tubules. Endocr Res Commun 1:247-
260
49. Cuasnicu PS, Echeverria FG, Piazza A, Blaquier JA 1984 Addition of
androgens to cultured hamster epididymis increases zona recognition by
immature spermatozoa. J Reprod Fert 70:541-547
50. Klinefelter GR, Amann RP, Hammerstedt RH 1982 Culture of
principal cells from the rat caput epididymis. Biol Reprod 26:885-901
51. Olson GE, Jonas-Davies J, Hoffman LH, Orgebin-Crist MC 1983
Structural features of cultured epithelial cells from the adult rat
epididymis. J Androl 4:347-360
52. White MG, Huang YS, Tres LL, Kierszenbaum AL 1982 Structural
and functional aspects of cultured epididymal epithelial cells isolated from
pubertal rats. J Reprod Fertil 66:475-484
53. Wong PY 1988 Mechanism of adrenergic stimulation of anion secretion
in cultured rat epididymal epithelium. Am J Physiol 254:F121-F133
84
54. Leung GP, Cheung KH, Tse CM, Wong PY 2001 Na+ reabsorption in
cultured rat epididymal epithelium via the Na+/nucleoside cotransporter.
Biol Reprod 64:764-769
55. Leung GP, Tse CM, Chew SB, Wong PY 2001 Expression of multiple
Na+/H+ exchanger isoforms in cultured epithelial cells from the rat
efferent duct and cauda epididymidis. Biol Reprod 64:482-490
56. Brown DV, Amann RP, Wagley LM 1983 Influence of rete testis fluid
on the metabolism of testosterone by cultured principal cells isolated from
the proximal or distal caput of the rat epididymis. Biol Reprod 28:1257-
1268
57. Kierszenbaum AL, Lea O, Petrusz P, French FS, Tres LL 1981
Isolation, culture, and immunocytochemical characterization of
epididymal epithelial cells from pubertal and adult rats. Proc Natl Acad
Sci U S A 78:1675-1679
58. Pera I, Ivell R, Kirchhoff C 1996 Body temperature (37 C) specifically
down-regulates the messenger ribonucleic acid for the major surface
antigen CD52 in epididymal cell culture. Endocrinology 137:4451-4459
59. Carballada R, Saling PM 1997 Regulation of mouse epididymal
epithelium in vitro by androgens, temperature and fibroblasts. J Reprod
Fertil 110:171-181
60. Cooper TG, Yeung CH, Meyer R, Schulze H 1990 Maintenance of
human epididymal epithelial cell function in monolayer culture. J Reprod
Fertil 90:81-91
61. Castellon EA, Huidobro CC 1999 Androgen regulation of glycosidase
secretion in epithelial cell cultures from human epididymis. Hum Reprod
14:1522-1527
85
62. Skudlarek MD, Orgebin-Crist MC 1986 Glycosidases in cultured rat
epididymal cells: enzyme activity, synthesis and secretion. Biol Reprod
35:167-178
63. Orgebin-Crist MC, Jonas-Davies J, Storey P, Olson GE 1984 Effect of
D-valine and cytosine arabinoside on [3H]thymidine incorporation in rat
and rabbit epididymal epithelial cell cultures. In Vitro 20:45-52
64. Kirchhoff C, Araki Y, Huhtaniemi I, Matusik RJ, Osterhoff C,
Poutanen M, Samalecos A, Sipila P, Suzuki K, Orgebin-Crist MC
2004 Immortalization by large T-antigen of the adult epididymal duct
epithelium. Mol Cell Endocrinol 216:83-94
65. Britan A, Lareyre JJ, Lefrancois-Martinez AM, Manin M, Schwaab
V, Greiffeuille V, Vernet P, Drevet JR 2004 Spontaneously
immortalized epithelial cells from mouse caput epididymidis. Mol Cell
Endocrinol 224:41-53
66. Saenz-Robles MT, Sullivan CS, Pipas JM 2001 Transforming functions
of Simian Virus 40. Oncogene 20:7899-7907
67. Livingston DM, Bradley MK 1987 The simian virus 40 large T antigen.
A lot packed into a little. Mol Biol Med 4:63-80
68. Ludlow JW 1993 Interactions between SV40 large-tumor antigen and the
growth suppressor proteins pRB and p53. FASEB J 7:866-871
69. Seenundun S 2006 Transcriptional and epigenetic regulation of steroid
5alpha-reductase type 2 and androgen action in epididymal principal cells.
70. Coleman L, Harris A 1991 Immortalization of male genital duct
epithelium: an assay system for the cystic fibrosis gene. J Cell Sci 98:85-
89
86
71. Tabuchi Y, Toyama Y, Toshimori K, Komiyama M, Mori C 2005
Functional characterization of a conditionally immortalized mouse
epididymis caput epithelial cell line MEPC5 using temperature-sensitive
simian virus 40 large T-antigen. Biochem Biophys Res Commun 329:812-
823
72. Dufresne J, St Pierre N, Viger RS, Hermo L, Cyr DG 2005
Characterization of a novel rat epididymal cell line to study epididymal
function. Endocrinology 146:4710-4720
73. Dube E, Dufresne J, Chan PTK, Hermo L, Cyr DG 2010 Assessing the
Role of Claudins in Maintaining the Integrity of Epididymal Tight
Junctions Using Novel Human Epididymal Cell Lines. Biol Reprod
82:1119-1128
74. Dube E, Hermo L, Chan PT, Cyr DG 2010 Alterations in the Human
Blood-Epididymis Barrier in Obstructive Azoospermia and the
Development of Novel Epididymal Cell Lines from Infertile Men. Biol
Reprod 83:584-596
75. Araki Y, Suzuki K, Matusik RJ, Obinata M, Orgebin-Crist M.C. 2002
Immortalized epididymal cell lines from transgenic mice overexpressing
temperature-sensitive simian virus 40 large T-antigen gene. J Androl
23:854-869
76. Yanai N, Suzuki M, Obinata M 1991 Hepatocyte cell lines established
from transgenic mice harboring temperature-sensitive simian virus 40
large T-antigen gene. Exp Cell Res 197:50-56
77. Sipila P, Shariatmadari R, Huhtaniemi IT, Poutanen M 2004
Immortalization of epididymal epithelium in transgenic mice expressing
simian virus 40 T antigen: characterization of cell lines and regulation of
the polyoma enhancer activator 3. Endocrinology 145:437-446
87
78. Sipila P, Cooper TG, Yeung CH, Mustonen M, Penttinen J, Drevet J,
Huhtaniemi I, Poutanen M 2002 Epididymal dysfunction initiated by the
expression of simian virus 40 T-antigen leads to angulated sperm flagella
and infertility in transgenic mice. Mol Endocrinol 16:2603-2617
79. Dube E, Hermo L, Chan PT, Cyr DG 2008 Alterations in gene
expression in the caput epididymides of nonobstructive azoospermic men.
Biol Reprod 78:342-351
80. Thimon V, Koukoui O, Calvo E, Sullivan R 2007 Region-specific gene
expression profiling along the human epididymis. Mol Hum Reprod
13:691-704
81. Thimon V, Calvo E, Koukoui O, Legare C, Sullivan R 2008 Effects of
vasectomy on gene expression profiling along the human epididymis. Biol
Reprod 79:262-273
82. Zhang JS, Liu Q, Li YM, Hall SH, French FS, Zhang YL 2006
Genome-wide profiling of segmental-regulated transcriptomes in human
epididymis using oligo microarray. Mol Cell Endocrinol 250:169-177
83. Li JY, Wang HY, Liu J, Liu Q, Zhang JS, Wan FC, Liu FJ, Jin SH,
Zhang YL 2008 Transcriptome analysis of a cDNA library from adult
human epididymis. DNA Res 15:115-122
84. Zhang J, Liu Q, Zhang W, Li J, Li Z, Tang Z, Li Y, Han C, Hall SH,
Zhang Y 2010 Comparative profiling of genes and miRNAs expressed in
the newborn, young adult, and aged human epididymides. Acta Biochim
Biophys Sin 42:145-153
85. Ezer N, Robaire B 2003 Gene expression is differentially regulated in the
epididymis after orchidectomy. Endocrinology 144:975-988
86. Jervis KM, Robaire B 2001 Dynamic changes in gene expression along
the rat epididymis. Biol Reprod 65:696-703
88
87. Douglass J, Garrett SH, Garrett JE 1991 Differential patterns of
regulated gene expression in the adult rat epididymis. Ann N Y Acad Sci
637:384-398
88. Jelinsky SA, Turner TT, Bang HJ, Finger JN, Solarz MK, Wilson E,
Brown EL, Kopf GS, Johnston DS 2007 The rat epididymal
transcriptome: comparison of segmental gene expression in the rat and
mouse epididymides. Biol Reprod 76:561-570
89. Johnston DS, Turner TT, Finger JN, Owtscharuk TL, Kopf GS,
Jelinsky SA 2007 Identification of epididymis-specific transcripts in the
mouse and rat by transcriptional profiling. Asian J Androl 9:522-527
90. Hsia N, Cornwall GA 2004 DNA microarray analysis of region-specific
gene expression in the mouse epididymis. Biol Reprod 70:448-457
91. Yamazaki K, Adachi T, Yanagisawa Y, Fukata H, Seki N, Mori C,
Komiyama M 2006 Identification and characterization of novel and
unknown mouse epididymal-specific genes by complementary DNA
microarray technology. Biol Reprod 75:462-468
92. Penttinen J, Pujianto DA, Sipila P, Huhtaniemi I, Poutanen M 2003
Discovery in silico and characterization in vitro of novel genes exclusively
expressed in the mouse epididymis. Mol Endocrinol 17:2138-2151
93. Sipila P, Pujianto DA, Shariatmadari R, Nikkila J, Lehtoranta M,
Huhtaniemi IT, Poutanen M 2006 Differential endocrine regulation of
genes enriched in initial segment and distal caput of the mouse epididymis
as revealed by genome-wide expression profiling. Biol Reprod 75:240-251
94. Guyonnet B, Marot G, Dacheux JL, Mercat MJ, Schwob S, Jaffrezic
F, Gatti JL 2009 The adult boar testicular and epididymal transcriptomes.
BMC Genomics 10:369-398
89
95. Jervis KM, Robaire B 2004 The effects of long-term vitamin E treatment
on gene expression and oxidative stress damage in the aging Brown
Norway rat epididymis. Biol Reprod 71:1088-1095
96. Jervis KM, Robaire B 2003 Effects of caloric restriction on gene
expression along the epididymis of the Brown Norway rat during aging.
Exp Gerontol 38:549-560
97. Jervis KM, Robaire B 2002 Changes in gene expression during aging in
the Brown Norway rat epididymis. Exp Gerontol 37:897-906
98. Turner TT, Johnston DS, Finger JN, Jelinsky SA 2007 Differential
gene expression among the proximal segments of the rat epididymis is lost
after efferent duct ligation. Biol Reprod 77:165-171
99. Chauvin TR, Griswold MD 2004 Androgen-regulated genes in the
murine epididymis. Biol Reprod 71:560-569
100. Johnston DS, Jelinsky SA, Bang HJ, DiCandeloro P, Wilson E, Kopf
GS, Turner TT 2005 The mouse epididymal transcriptome:
transcriptional profiling of segmental gene expression in the epididymis.
Biol Reprod 73:404-413
101. Turner TT, Johnston DS, Jelinsky SA 2006 Epididymal genomics and
the search for a male contraceptive. Mol Cell Endocrinol 250:178-183
102. Chabory E, Damon C, Lenoir A, Henry-Berger J, Vernet P, Cadet R,
Saez F, Drevet JR 2010 Mammalian glutathione peroxidases control
acquisition and maintenance of spermatozoa integrity. J Anim Sci
88:1321-1331
103. Li Y, Friel PJ, McLean DJ, Griswold MD 2003 Cystatin E1 and E2,
new members of male reproductive tract subgroup within cystatin type 2
family. Biol Reprod 69:489-500
90
104. Yamaguchi Y, Nagase T, Makita R, Fukuhara S, Tomita T, Tominaga
T, Kurihara H, Ouchi Y 2002 Identification of multiple novel
epididymis-specific beta-defensin isoforms in humans and mice. J
Immunol 169:2516-2523
105. Yu X, Suzuki K, Wang Y, Gupta A, Jin R, Orgebin-Crist MC,
Matusik RJ 2006 The role of forkhead box A2 to restrict androgen-
regulated gene expression of lipocalin 5 in the mouse epididymis. Mol
Endocrinol 20:2418-2431
106. Legare C, Gaudreault C, St-Jacques S, Sullivan R 1999 P34H sperm
protein is preferentially expressed by the human corpus epididymidis.
Endocrinology 140:3318-3327
107. Li Y, Putnam-Lawson CA, Knapp-Hoch H, Friel PJ, Mitchell D,
Hively R, Griswold MD 2005 Immunolocalization and regulation of
cystatin 12 in mouse testis and epididymis. Biol Reprod 73:872-880
108. Schlesser HN, Simon L, Hofmann MC, Murphy KM, Murphy T, Hess
RA, Cooke PS 2008 Effects of ETV5 (ets variant gene 5) on testis and
body growth, time course of spermatogonial stem cell loss, and fertility in
mice. Biol Reprod 78:483-489
109. Schweiger A, Christensen IJ, Nielsen HJ, Sorensen S, Brunner N, Kos
J 2004 Serum cathepsin H as a potential prognostic marker in patients
with colorectal cancer. Int J Biol Markers 19:289-294
110. Maeda A, Crabb JW, Palczewski K 2005 Microsomal glutathione S-
transferase 1 in the retinal pigment epithelium: protection against
oxidative stress and a potential role in agingM. Biochemistry 44:480-489
111. Mou Z, Tapper AR, Gardner PD 2009 The armadillo repeat-containing
protein, ARMCX3, physically and functionally interacts with the
developmental regulatory factor Sox10. J Biol Chem 284:13629-13640
91
112. Cornwall GA, Collis R, Xiao Q, Hsia N, Hann SR 2001 B-Myc, a
proximal caput epididymal protein, is dependent on androgens and
testicular factors for expression. Biol Reprod 64:1600-1607
113. Belmonte SA, Romano P, Sartor T, Sosa MA 2002
Compartmentalization of lysosomal enzymes in cauda epididymis of
normal and castrated rats. Arch Androl 48:193-201
114. Zhao GQ, Liaw L, Hogan BL 1998 Bone morphogenetic protein 8A
plays a role in the maintenance of spermatogenesis and the integrity of the
epididymis. Development 125:1103-1112
115. Hsia N, Cornwall GA 2001 CCAAT/enhancer binding protein beta
regulates expression of the cystatin-related epididymal spermatogenic
(Cres) gene. Biol Reprod 65:1452-1461
116. Winer MA, Wadewitz AG, Wolgemuth DJ 1993 Members of the raf
gene family exhibit segment-specific patterns of expression in mouse
epididymis. Mol Reprod Dev 35:16-23
117. Cornwall GA, Lareyre JJ, Matusik RJ, Hinton BT, Orgebin-Crist
MC 2002 Gene expression and epididymal function. In: Robaire B,
Hinton BT, eds. The Epididymis: From Molecules to Clinical Practice.
Kluwer Academic/Plenum Publishers; 169-199
118. Oh JS, Han C, Cho C 2009 ADAM7 is associated with epididymosomes
and integrated into sperm plasma membrane. Mol Cells 28:441-446
119. Hermo L, Lustig M, Lefrancois S, Argraves WS, Morales CR 1999
Expression and regulation of LRP-2/megalin in epithelial cells lining the
efferent ducts and epdidymis during postnatal development. Mol Reprod
Dev 53:282-293
92
120. Cyr DG, Hermo L, Blaschuk OW, Robaire B 1992 Distribution and
regulation of epithelial cadherin messenger ribonucleic acid and
immunocytochemical localization of epithelial cadherin in the rat
epididymis. Endocrinology 130:353-363
121. Cheung KH, Leung GP, Leung MC, Shum WW, Zhou WL, Wong PY
2005 Cell-cell interaction underlies formation of fluid in the male
reproductive tract of the rat. J Gen Physiol 125:443-454
122. Perry AC, Jones R, Hall L 1993 Isolation and characterization of a rat
cDNA clone encoding a secreted superoxide dismutase reveals the
epididymis to be a major site of its expression. Biochem J 293 (Pt 1):21-25
123. Igdoura SA, Herscovics A, Lal A, Moremen KW, Morales CR, Hermo
L 1999 Alpha-mannosidases involved in N-glycan processing show cell
specificity and distinct subcompartmentalization within the Golgi
apparatus of cells in the testis and epididymis. Eur J Cell Biol 78:441-452
124. Robaire B, Viger RS 1995 Regulation of epididymal epithelial cell
functions. Biol Reprod 52:226-236
125. Hermo L, Wright J, Oko R, Morales CR 1991 Role of epithelial cells of
the male excurrent duct system of the rat in the endocytosis or secretion of
sulfated glycoprotein-2 (clusterin). Biol Reprod 44:1113-1131
126. Nixon B, MacIntyre DA, Mitchell LA, Gibbs GM, O'Bryan M, Aitken
RJ 2006 The identification of mouse sperm-surface-associated proteins
and characterization of their ability to act as decapacitation factors. Biol
Reprod 74:275-287
127. Dacheux JL, Belghazi M, Lanson Y, Dacheux F 2006 Human
epididymal secretome and proteome. Molecular and Cellular
Endocrinology 250:36-42
93
128. Mathur PP, Marshall A, Cheng CY 2000 Protein profiles in various
epididymal segments of normal and castrated rats. Asian J Androl 2:57-64
129. Chaurand P, Fouchecourt S, DaGue BB, Xu BJ, Reyzer ML, Orgebin-
Crist MC, Caprioli RM 2003 Profiling and imaging proteins in the
mouse epididymis by imaging mass spectroscopy. Proteomics 3:2221-
2239
130. Arslan M, Haider MZ, Qazi MH 1986 Characterization and androgen
dependence of specific proteins in the epididymis of adut rhesus monkey
(Macaca mulatta). Arch Androl 16:67-74
131. Dacheux JL, Belleannee C, Jones R, Labas V, Belghazi M, Guyonnet
B, Druart X, Gatti JL, Dacheux F 2009 Mammalian epididymal
proteome. Molecular and Cellular Endocrinology 306:45-50
132. Gatti JL, Castella S, Dacheux F, Ecroyd H, Metayer S, Thimon V,
Dacheux JL 2004 Post-testicular sperm environment and fertlity. Animal
Reproduction Science 82-83:321-339
133. Dacheux JL, Dacheux F 2002 Protein secretion in the epididymis. In:
Robaire B, Hinton BT, eds. The Epididymis: From Molecules to Clinical
Practice. Kluwer Academic/Plenum Publishers; 151-168
134. Dacheux JL, Dacheux F, Labas V, Ecroyd H, Nixon B, Jones RC 2009
New proteins identified in epididymal fluid from the platypus
(Ornithorhynchus anatinus). Reproduction, Fertility and Development
21:1002-1007
135. Luzzi GA, O'Brien TS 2001 Acute epididymitis. BJU International
87:747-755
136. Arisan S, Akbulut ON, Cakir OO, Ergenekon E 2004 Primary
adenocarcinoma of the epididymis: Case report. International Urology and
Nephrology 36:77-80
94
137. Ganem JP, Jhaveri FM, Marroum MC 1998 Primary adenocarcinoma
of the epididymis: case report and review of the literature. Urology
52:904-908
138. Silva EJR, Queiroz DBC, Honda L, Avellar MCW 2010 Glucorticoid
receptor in the rat epididymis: Expression, cellular distribution and
regulation by steroid hormones. Molecular and Cellular Endocrinology
325:64-77
139. Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood
MM, Graham-Lorence S., Amarneh B, Ito Y., Fisher CR, Michael
MD, Mendelson CR, Bulun S 1994 Aromatase cytochrome P450, the
enzyme responsible for estrogen biosynthesis. Endocr Rev 15:342-355
140. Wiszniewska B 2002 Primary culture of the rat epididymal epithelial cells
as a source of oestrogen. Andrologia 34:180-187
141. Carpino A, Romeo F, Rago V 2004 Aromatase immunolocalization in
human ductuli efferentes and proximal ductus epididymis. J Anat 204(Pt
3):217-220
142. Fibbi B, Filippi S, Morelli A, Vignozzi L, Silvestrini E, Chavalmane A,
De Vita G, Marini M, Gacci M, Manieri C, Vannelli GB, Maggi M
2009 Estrogens regulate humans and rabbit epididymal contractility
through the RhoA/Rho-kinase pathway. J Sex Med 6:2173-2186
143. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA,
Labrie F, Giguere V 1997 Cloning, chromosomal localization, and
functional analysis of the murine estrogen receptor beta. Mol Endocrinol
11:353-365
144. Toney TW, Danzo BJ 1988 Developmental changes in and hormonal
regulation of estrogen and androgen receptors present in the rabbit
epididymis. Biol Reprod 39:818-828
95
145. Hess RA, Bunick D, Lubahn DB, Zhou Q, Bouma J 2000 Morphologic
changes in efferent ductules and epididymis in estrogen receptor-alpha
knockout mice. J Androl 21:107-121
146. Joseph A, Hess RA, Schaeffer DJ, Ko C, Hudgin-Spivey S, Chambon
P, Shur BD 2010 Absence of estrogen receptor alpha leads to
physiological alterations in the mouse epididymis and consequent defects
in sperm function. Biol Reprod 82:948-957
147. Joseph A, Shur BD, Ko C, Chambon P, Hess RA 2010 Epididymal
hypo-osmolality induces abnormal sperm morphology and function in the
estrogen receptor knockout mouse. Biol Reprod 82:958-967
148. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF,
Sar M, Korach KS, Gustafsson JA, Smithies O 1998 Generation and
reproductive phenotypes of mice lacking estrogen receptor beta. Proc Natl
Acad Sci U S A 95:15677-15682
149. Hamzeh M, Robaire B 2010 Identification of early response genes and
pathway activated by androgens in the initial segment and caput regions of
the regressed rat epididymis. Endocrinology
150. Snyder EM, Small CL, Li Y, Griswold MD 2009 Regulation of gene
expression by estrogen and testosterone in the proximal mouse
reproductive tract. Biol Reprod 81:707-716
151. Thackare H, Nicholson HD, Whittington K 2006 Oxytocin--its role in
male reproduction and new potential therapeutic uses. Hum Reprod
Update 12:437-448
152. Nicholson HD, Parkinson TJ, Lapwood KR 1999 Effects of oxytocin
and vasopressin on sperm transport from the cauda epididymis in sheep. J
Reprod Fertil 117:299-305
96
153. Filipi S, Luconi M, Granchi S, Vignozzi L, Bettuzzi S, Tozzi P, Ledda
F, Forti G, Maggi M 2002 Estrogens, but not androgens, regulate
expression and functional activity of oxytocin receptor in rabbit
epididymis. Endocrinology 143:4271-4280
154. Nicholson HD, Jenkin L 1994 Oxytocin increases 5α−reductase activity
in the rat testis. In: Bartke A, ed. Function of Somatic Cells in the Testis.
New York: Springer-Verlag; 278-285
155. Assinder SJ, Johnson C, King K, Nicholson HD 2004 Regulation of 5α-
reductase isoforms by oxytocin in the rat ventral prostate. Endocrinology
145:5767-5773
156. Yen PM 2001 Physiological and molecular basis of thyroid hormone
action. Physiol Rev 81:1097-1142
157. Jannini EA, Ulisse S, D'Armiento M 1995 Thyroid hormone and male
gonadal function. Endocr Rev 16:443-459
158. Maran RR, Priyadarsini D, Udhayakumar RC, Arunakaran J,
Aruldhas MM 2001 Differential effect of hyperthyroidism on rat
epididymal glycosidases. Int J Androl 24:206-215
159. Del Rio AG, Palaoro LA, Canessa OE, Blanco AM 2003 Epididymal
cytology changes in hypothyroid rats. Arch Androl 49:247-255
160. De Paul AL, Mukdsi JH, Pellizas CG, Montesinos M, Gutierrez S,
Susperreguy S, Del Rio A, Maldonado CA, Torres AI 2008 Thyroid
hormone receptor α1−β1 expression in epididymal epithelium from
euthyroid and hypothyroid rats. Histochem Cell Biol 129:631-642
161. Del Rio AG, Blanco AM, Niepomniscze H, Carizza C, Parera F 1998
Thyroid gland and epididymal motility in rats. Arch Androl 41:23-26
97
162. Anbalagan J, Sashi AM, Vengatesh G, Stanley JA, Neelamohan R,
Aruldhas MM 2010 Mechanism underlying transient gestational-onset
hypothyroidism-inuced impairment of posttesticular sperm maturation in
adult rats. Fertil Steril 93:2491-2497
163. Anguiano B, Aranda N, Delgado G, Aceves C 2008 Epididymis
expressed the highest 5'-deiodinase activity in the male reproductive
system: kinetic characterization, distribution, and hormonal regulation.
Endocrinology 149:4209-4217
164. Hong WK, Itri LM 1994 Retinoids and human cancer. In: Sporn MB,
Roberts AB, Goodman DS, eds. The Retinoids: Biology, Chemistry, and
Medicine. Second Edition ed. New York: Raven Press Ltd.; 597-630
165. Chambon P 1996 A decade of molecular biology of retinoic acid
receptors. FASEB J 10:940-954
166. Costa SL, Boekelheide K, Vanderhyden BC, Seth R, McBurney MW
1997 Male infertility caused by epididymal dysfunction in transgenic mice
expressing a dominant negative mutation of retinoic acid receptor alpha 1.
Biol Reprod 56:985-990
167. Lufkin T, Lohnes D, Mark M, Dierich A, Gorry P, Gaub M-P,
LeMeur M, Chambon P 1993 High postnatal lethality and testis
degeneration in retinoid acid receptor alpha mutant mice. Proc Natl Acad
Sci U S A 90:7225-7229
168. Mendelsohn C, Lohnes D, Decimo D, Lufkin T, LeMeur M, Chambon
P, Mark M 1994 Function of the retinoic acid receptors (RARs) during
development (II): multiple abnormalities at various stages of
organogenesis in RAR double mutants. Development 120:2749-2771
98
169. Hinton BT, Lan ZJ, Lye RJ, Labus JC 2000 Regulation of epididymal
function by testicular factors: The lumicrine hypothesis. In: Goldberg E,
ed. The Testis: From Stem Cell to Sperm Function. New York: Springer;
163-173
170. Fawcett DW, Hoffer AP 1979 Failure of exogenous androgen to prevent
regression of the initial segments of the rat epididymis after efferent duct
ligation or orchidectomy. Biol Reprod 20:162-181
171. Turner TT, Miller DW, Avery EA 1995 Protein synthesis and secretion
by the rat caput epididymis in vivo: influence of the luminal
microenvironment. Biol Reprod 52:1012-1019
172. French F, Ritzen E 1973 A high-affinitiy androgen-binding protein
(ABP) in rat testis: evidence for secretion into efferent duct fluid and
absorption by epididymis. Endocrinology 93:88-95
173. Hermo L, Barin K, Oko R 1998 Androgen binding protein secretion and
endocytosis by principal cells in the adult rat epididymis and during
postnatal development. J Androl 19:527-541
174. Brown DV, Amann RP, Wagley LM 1983 Influence of rete testis fluid
on the metabolism of testosterone by cultured principal cells isolated from
the proximal or distal caput of the rat epididymis. Biol Reprod 28:1257-
1268
175. Cotton LM, O'Bryan MK, Hinton BT 2008 Cellular signaling by
fibroblast growth factors (FGFs) and their receptors (FGFRs) in male
reproduction. Endocr Rev 29:193-216
176. Tomsig JL, Turner TT 2006 Growth Factors and the Epididymis. Journal
of Andrology 27:348-357
99
177. Tomsig JL, Usanovic S, Turner TT 2006 Growth factor-stimulated
mitogen-activated kinase (MAPK) phosphorylation in the rat epididymis is
limited by segmental boundaries. Biol Reprod 75:598-604
178. Kirby JL, Yang L, Labus JC, Hinton BT 2003 Characterization of
fibroblast growth factor receptors expressed in principal cells in the initial
segment of the rat epididymis. Biol Reprod 68:2314-2321
179. Garrett JE, Garrett SH, Douglass JA 1990 A spermatozoa-associated
factor regulates proenkephalin gene expression in the rat epididymis. Mol
Endocrinol 4:108-118
180. Cancilla B, Davies A, Ford-Perriss M, Risbridger GP 2000 Discrete
cell- and stage-specific localization of fibroblast growth factors and
receptor expression during testis development. J Endocrinol 164:149-159
181. Brown TR 1999 Steroid Hormones, Overview. In: Knobil E, Neill JM,
eds. Encyclopedia of Reproduction. Academic Press; 634-644
182. Bhasin S 1999 Androgens, Effects in Mammals. Encyclopedia of
Reproduction. Academic Press; 197-206
183. Gao W, Bohl CE, Dalton JT 2005 Chemistry and Structural Biology of
Androgen Receptor. Chem Rev 105:3352-3370
184. Sherbet DP, Auchus RJ 2007 Peripheral Testosterone Metabolism. In:
Payne AH, Hardy MP, eds. Contemporary Endocrinology: The Leydig
Cell in Health and Disease. Totowa, NJ: Humana Press Inc.; 181-188
185. Hall PF 1988 Testicular Steroid Synthesis: Organization and Regulation.
In: Knobil E, Neill JM, eds. The Physiology of Reproduction. New York:
Raven Press, Ltd.; 975-998
100
186. Bardin CW, Hardy MP, Catterall JF 1996 Androgens. In: Adashi EY,
Rock JA, Rosenwaks Z, eds. Reproductive endocrinology, surgery, and
technology. Lippincott-Raven; 506-545
187. Payne AH 2007 Steroidogenic Enzymes in Leydig Cells. In: Payne AH,
Hardy MP, eds. Contemporary Endocrinology: The Leydig Cell in Health
and Disease. Totowa, NJ: Humana Press Inc.; 157-171
188. Cheng CY, Gunsalus GL, Musto NA, Bardin CW 1984 The
heterogeneity of rat androgen-binding protein in serum differs from that in
testis and epididymis. Endocrinology 114:1386-1394
189. Weinbauer GF, Nieschlag E 1996 Hormonal regulation of reproductive
organs. In: Greger R, Windhorst U, eds. Comprehensive human
physiology - from cellular mechanisms to integration. Berlin Heidelberg,
New York: Springer; 2231-2252
190. Weinbauer GF, Gromoll J, Simoni M, Nieschlag E 1997 Physiology of
testicular function. In: Nieschlag E, Behre HM, eds. Andrology: Male
Reproductive Health and Dysfunction. Berlin: Springer-Verlag; 25-57
191. Reichert LEJr 1999 FSH (Follicle-Stimulating Hormone). In: Knobil E,
Neill JM, eds. Encyclopedia of Reproduction. San Diego: Academic Press;
418-422
192. Bousfield GR, Jia L, Ward DN 2006 Gonadotropins: Chemistry and
Biosynthesis. In: Neill JD, ed. Knobil and Neill's Physiology of
Reproduction. St. Louis: Elsevier Academic Press; 1581-1634
193. Androgens and Androgen Receptor: Mechanisms, Functions, and Clinical
Applications 2010 Boston: Kluwer Academic Publishers
194. Li J, Al-Azzawi F 2009 Mechanism of androgen receptor action.
Maturitas 63:142-148
101
195. MacLean II JA, Wilkinson MF 2005 Gene Regulation in
Spermatogenesis. Current Topics in Developmental Biology Vol. 71.
Elsevier Inc.; 131-197
196. Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an
overview. Endocrine Reviews 23:175-200
197. Wang L, Hsu C-L, Chang C 2004 Androgen receptor corepressors: an
overview. The Prostate 9999:1-14
198. Gottlieb B, Beitel LK, Wu JH, Trifiro M 2004 The androgen receptor
mutations database (ARDB): 2004 update. Hum Mutat 23:527-533
199. Pratt WB, Toft DO 1997 Steroid receptor interactions with heat shock
protein and immunophilin chaperones. Endocr Rev 18:306-360
200. Grino PB, Griffin JE, Wilson JD 1990 Testosterone at high
concentrations interacts with the human androgen receptor similarly to
dihydrotestosterone. Endocrinology 126:1165-1172
201. Claessens F, Verrijdt G, Schoenmakers E, Haelens A, Peeters B,
Verhoeven G, Rombauts W 2001 Selective DNA binding by the
androgen receptor as a mechanism for hormone-specific gene regulation.
The Journal of Steroid Biochemistry & Molecular Biology 76:23-30
202. Avila DM, Fuqua SA, George FW, McPhaul MJ 1998 Identification of
genes expressed in the rat prostate that are modulated differently by
castration and finasteride treatment. J Endocrinol 159:403-411
203. Landers JP, Spelsberg TC 1991 Updates and new models for steroid
hormone action. Ann N Y Acad Sci 637:26-55
204. Rahman F, Christian HC 2007 Non-classical actions of testosterone: an
update. TRENDS in Endocrinology and Metabolism 18:371-378
102
205. Yamada Y 1979 Effects of testosterone on unit activity in rat
hypothalamus and septum. Brain Res 172:165-168
206. Christian HC, Rolls NJ, Morris JF 2000 Non-genomic actions of
testosterone on a subset of lactotrophs in the male rat pituitary.
Endocrinology 141:3111-3119
207. Foradori CD, Weiser MJ, Handa RJ 2008 Non-genomic actions of
androgens. Front Neuroendocrinol 29:169-181
208. Heinlein CA, Chang C 2002 The roles of androgen receptors and
androgen-binding proteins in nongenomic androgen actions. Mol
Endocrinol 16:2181-2187
209. Yamashita S 2004 Localization of estrogen and androgen receptors in
male reproductive tissues of mice and rats. Anat Rec A Discov Mol Cell
Evol Biol 279:768-778
210. Ezer N, Robaire B 2002 Androgenic regulation of the structure and
functions of the epididymis. In: Bernard Robaire, Hinton, eds. The
Epididymis: From Molecules to Clinical Practice. Kluwer Academic-
Plenum Publishers; 297-316
211. Kaur J, Radhakrishnan B, Rajalakshmi M 1992 Effect of
cytoproterone acetate on structure and function of rhesus monkey
reproductive organs. Anat Rec 234:62-72
212. Dhar JD, Srivastava SR, Setty BS 1982 Flutamide as an androgen
antagonist on epididymal function in the rat. Andrologia 14:55-61
213. Rulli SB, Gonzalez-Calvar SI, Calandra RS 1997 Ornithine
decarboxylase activity and polyamine levels in epididymis of prepubertal
rat after antiandrogen administration. Arch Androl 38:163-171
103
214. Henderson NA, Cooke GM, Robaire B 2004 Effects of PNU157706, a
dual 5alpha-reductase inhibitor, on gene expression in the rat epididymis. J
Endocrinol 181:245-261
215. Henderson NA, Robaire B 2005 Effects of PNU157706, a dual 5alpha-
reductase inhibitor, on rat epididymal sperm maturation and fertility. Biol
Reprod 72:436-443
216. Yeung CH, Weinbauer GF, Cooper TG 1999 Effect of acute androgen
withdrawal by GnRH antagonist on epididymal sperm motility and
morphology in the cynomolgus monkey. Journal of Andrology 20:72-79
217. Danzo BJ 1995 The effects of a gonadotropin-releasing hormone
antagonist on androgen-binding protein distribution and other parameters
in the adult male rat. Endocrinology 136:310-317
218. Sujarit S, Pholpramool C 1985 Enhancement of sperm transport through
the rat epididymis after castration. J Reprod Fert 74:497-502
219. Delongeas JL, Gelly JL, Leheup B, Grignon G 1987 Influence of
testicular secretions on differentiation in the rat epididymis: ultrastructural
studies after castration, efferent duct ligation and cryptorchidism. Expl
Cell Biol 55:74-82
220. Takagi-Morishita Y, Kuhara A, Sugihara A, Yamada N, Yamamoto
R, Iwasaki T, Tsujimura T, Tanji N, Terada N 2002 Castration induces
apoptosis in the mouse epididymis during postnatal development.
Endocrine Journal 49:75-84
221. Brooks DE 1977 The androgenic control of the composition of the rat
epididymis determined by efferent duct ligation or castration. J Reprod
Fert 49:383-385
104
222. Moore HD, Bedford JM 1979 The differential absorptive activity of
epithelial cells of the rat epididymus before and after castration. Anat Rec
193:313-328
223. Abe K, Takano H 1989 Cytological response of the principal cells in the
initial segment of the epididymal duct to efferent duct cutting in mice.
Arch Histol Cytol 52:321-326
224. Abe K, Takano H 1989 Early degeneration of the epithelial cells in the
initial segment of the epididymal duct in mice after efferent duct cutting.
Arch Histol Cytol 52:299-310
225. Brooks DE 1977 The androgenic control of the composition of the rat
epididymis determined by efferent duct ligation or castration. J Reprod
Fert 49:383-385
226. Pujol A, Bayard F 1979 Androgen receptors in the rat epididymis and
their hormonal control. J Reprod Fert 56:217-222
227. Robaire B, Hales BF 1982 Regulation of epididymal glutathione S-
transferases: effects of orchidectomy and androgen replacement. Biol
Reprod 26:559-565
228. Fawcett DW, Hoffer AP 1979 Failure of exogenous androgen to prevent
regression of the initial segments of the rat epididymis after efferent duct
ligation or orchidectomy. Biol Reprod 20:162-181
229. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
230. Setty BS, Riar SS, Kar AB 1977 Androgenic control of epididymal
function in rhesus monkey and rabbit. Fertil Steril 28:674-681
105
231. Robaire B, Ewing LL, Zirkin BR, Irby DC 1977 Steroid delta4-5alpha-
reductase and 3alpha-hydroxysteroid dehydrogenase in the rat epididymis.
Endocrinology 101:1379-1390
232. Brooks DE 1979 Influence of androgens on the weights of the male
accessory reproductive organs and on the activities of mitochondrial
enzymes in the epididymis of the rat. J Endocrinol 82:293-303
233. Orgebin-Crist MC, Davies J 1974 Functional and morphological effects
of hypophysectomy and androgen replacement in the rat epididymis. Cell
Tiss Res 148:183-201
234. Brooks DE 1977 The androgenic control of the composition of the rat
epididymis determined by efferent duct ligation or castration. J Reprod
Fert 49:383-385
235. Niemi M, Tuohimaa P 1971 The mitogenic activity of testosterone in the
accessory sex glands of the rat in relation to its conversion to
dihydrotestosterone. In: Hubinot PO, Leroy F, eds. Basic Actions of Sex
Steroids on Target Organs. Basel: S. Karger; 258-264
236. Gregory MA, Xiao Q, Cornwall GA, Lutterbach B, Hann SR 2000 B-
Myc is preferentially expressed in hormonally-controlled tissues and
inhibits cellular proliferation. Oncogene 19:4886-4895
237. Hamzeh M, Robaire B 2009 Effect of testosterone on epithelial cell
proliferation in the regressed rat epididymis. J Androl 30:200-212
238. Ghyselinck NB, Dufaure I, Lareyre JJ, Rigaudiere N, Mattei MG
1993 Structural organization and regulation of the gene for the androgen-
dependent glutathione peroxidase-like protein specific to the mouse
epididymis. Mol Endocrinol 7:258-272
106
239. Lareyre JJ, Claessens F, Rombauts W, Dufaure JP, Drevet JR 1997
Characterization of an androgen response element within the promoter of
the epididymis-specific murine glutathione peroxidase 5 gene. Mol Cell
Endocrinol 129:33-46
240. Lareyre JJ, Reid K, Nelson C, Kasper S, Rennie PS, Orgebin-Crist
MC, Matusik RJ 2000 Characterization of an androgen-specific response
region within the 5' flanking region of the murine epididymal retinoic acid
binding protein gene. Biol Reprod 63:1881-1892
241. Barbulescu K, Geserick C, Schuttke I, Schleuning WD, Haendler B
2001 New androgen response elements in the murine pem promoter
mediate selective transactivation. Mol Endocrinol 15:1803-1816
242. Roberts KP, Hoffman LB, Ensrud KM, Hamilton DW 2001
Expression of crisp-1 mRNA splice variants in the rat epididymis, and
comparative analysis of the rat and mouse crisp-1 gene regulatory regions.
J Androl 22:157-163
243. Zhu LJ, Hardy MP, Inigo IV, Huhtaniemi I, Bardin CW, Moo-Young
AJ 2000 Effects of androgen on androgen receptor expression in rat
testicular and epididymal cells: a quantitative immunohistochemical study.
Biol Reprod 63:368-376
244. Schwaab V, Faure J, Dufaure JP, Drevet JR 1998 Gpx3: the plasma-
type glutathione peroxidase is expressed under androgenic control in the
mouse epididymis and vas deferens. Mol Reprod Dev 51:362-372
245. Kaunisto K, Fleming RE, Kneer J, Sly WS, Rajaniemi H 1999
Regional expression and androgen regulation of carbonic anhydrase IV
and II in the adult rat epididymis. Biol Reprod 61:1521-1526
107
246. Palladino MA, Hinton BT 1994 Expression of multiple gamma-glutamyl
transpeptidase messenger ribonucleic acid transcripts in the adult rat
epididymis is differentially regulated by androgens and testicular factors
in a region-specific manner. Endocrinology 135:1146-1156
247. Drevet JR, Lareyre JJ, Schwaab V, Vernet P, Dufaure JP 1998 The
PEA3 protein of the Ets oncogene family is a putative transcriptional
modulator of the mouse epididymis-specific glutathione peroxidase gene
gpx5. Mol Reprod Dev 49:131-140
248. Rigaudiere N, Ghyselinck NB, Faure J, Dufaure JP 1992 Regulation of
the epididymal glutathione peroxidase-like protein in the mouse:
dependence upn androgens and testicular factors. Mol Cell Endocrinol
89:67-77
249. Viger RS, Robaire B 1996 The mRNAs for the steroid 5 alpha-reductase
isozymes, types 1 and 2, are differentially regulated in the rat epididymis.
J Androl 17:27-34
250. Seenundun S, Robaire B 2007 Time-dependent rescue of gene
expression by androgens in the mouse proximal caput epididymidis-1 cell
line after androgen withdrawal. Endocrinology 148:173-188
251. Robaire B, Seenundun S, Hamzeh M, Lamour SA 2007 Androgenic
regulation of novel genes in the epididymis. Asian J Androl 9:545-553
252. Lawen A 2003 Apoptosis-an introduction. Bioessays 25:888-896
253. Vaux DL, Korsmeyer SJ 1999 Cell death in development. Cell 96:245-
254
254. Zhang A, Wu Y, Lai HLW, Yew DT 2004 Apoptosis - A brief review.
Neuroembryology 3:47-59
108
255. Vermeulen K, Dirk R, Bockstaele V, Berneman ZN 2005 Apoptosis:
mechanisms and relevance in cancer. Ann Hematol 84:627-630
256. Earnshaw WC, Martins LM, Kaufmann SH 1999 Mammalian
caspases: structure, activation, substrates, and functions during apoptosis.
Annu Rev Biochem 68:383-424
257. Strasser A, O'Connor L, Dixit VM 2000 Apoptosis signaling. Annu Rev
Biochem 69:217-245
258. Bhardwaj A, Aggarwal BB 2003 Receptor-mediated choreography of
life and death. Journal of Clinical Immunology 23:317-332
259. Wallach D, Varfolomeev EE, Malinin NL, Goltsev YV, Kovalenko
AV, Boldin MP 1999 Tumor necrosis factor receptor and Fas signaling
mechanisms. Ann Rev Immunol 17:331-367
260. Baud V, Karin M 2001 Signal transduction by tumor necrosis factor and
its relatives. TRENDS in Cell Biology 11:372-377
261. Fumarola C, Guidotti GG 2004 Stress-induced apoptosis: Toward a
symmetry with receptor-mediated cell death. Apoptosis 9:77-82
262. Burlacu A 2003 Regulation of apoptosis by Bcl-2 family proteins. J Cell
Mol Med 7:249-257
263. Liston P, Fong WG, Korneluk RG 2003 The inhibitors of apoptosis:
there is more to life than Bcl2. Oncogene 22:8568-8580
264. LeBlanc AC 2003 Natural cellular inhibitors of caspases. Progress in
Neuro-Psychopharmacology & Biological Psychiatry 27:215-229
265. Kim JJ, Fazleabas AT 1999 Growth factors. Encyclopedia of
Reproduction. Academic Press; 573-583
109
266. Radhakrishnan B, Suarez-Quian CA 1992 Characterization of
epidermal growth factor receptor (EGFR) in testis, epididymis and vas
deferens of non-human primates. J Reprod Fertil 26:13-23
267. Korpelainen EI, Karkkainen MJ, Tenhunen A, Lakso M, Rauvala H,
Vierula M, Parvinen M, Alitalo K 1998 Overexpression of VEGF in
testis and epididymis causes infertility in transgenic mice: evidence for
non-endothelial targets for VEGF. J Cell Biol 143:1705-1712
268. Ayer-LeLievre C, Olson L, Ebendal T, Hallbook F, Persson H 1988
Nerve growth factor mRNA and protein in the testis and epididymis of
mouse and rat. Proc Natl Acad Sci U S A 85:2628-2632
269. Basciani S, Mariani S, Arizzi M, Brama M, Ricci A, Betsholtz C,
Bondjers C, Ricci G, Catizone A, Galdieri M, Spera G, Gnessi L 2004
Expression of platelet-derived growth factor (PDGF) in the epididymis
and analysis of the epidermal development in PDGF-A, PDGF-B, and
PDGF receptor β deficient mice. Biol Reprod 70:168-177
270. Desai KV, Flanders KC, Kondaiah P 1998 Expression of transforming
growth factor β isoforms in the rat male accessory sex organs and
epididymis. Cell Tiss Res 294:271-277
271. Leheup B, Grignon G 1993 Immunohistochemical localization of
insulin-like growth factor 1 (IGF-1) in the rat epididymis. J Androl
14:159-163
272. Kobayashi T, Yanase H, Iwanaga T, Sasaki R, Nagao M 2002
Epididymis is a novel site of erythropoietin production in mouse
reproductive organs. Biochem Biophys Res Commun 296:145-151
273. Catizone A, Ricci G, Galdieri M 2002 Functional role of hepatocyte
growth factor receptor during sperm maturation. J Androl 23:911-918
110
274. Gennigens C, Menetrier-Caux C, Droz JP 2006 Insulin-Like Growth
Factor (IGF) family and prostate cancer. Crit Rev Oncol Hematol 58:124-
145
275. Butt AJ, Firth SM, Baxter RC 1999 The IGF axis and programmed cell
death. Immunol Cell Biol 77:256-262
276. Yamada PM, Lee K-W 2009 Perspectives in mammalian IGFBP-3
biology: local vs. systemic action. Am J Physiol Cell Physiol 296:954-976
277. Authier F, Posner BI, Bergeron JJ 1996 Insulin-degrading enzyme. Clin
Invest Med 19:149-160
278. Wu JD, Haugk K, Woodke L, Nelson P, Coleman I, Plymate SR 2006
Interaction of IGF signaling and the androgen receptor in prostate cancer
progression. J Cell Biochem 99:392-401
279. Wu Y, Zhao W, Zhao J, Pan J, Wu Q, Zhang Y, Bauman WA,
Cardozo CP 2007 Identification of androgen response elements in the
insulin-like growth factor 1 usptream promoter. Endocrinology 148:2984-
2993
280. Peng L, Malloy PJ, Wang J, Feldman D 2006 Growth inhibitory
concentrations of androgens up-regulate insulin-like growth factor binding
protein-3 expression via an androgen response element in LNCaP human
prostate cancer cells. Endocrinology 147:4599-4607
281. Manin M, Baron S, Goossens K, Beaudin C, Jean C, Veyssiere G,
Verhoeven G, Morel L 2002 Androgen receptor expression is regulated
by the phosphoinositide 3-kinase/Akt pathway in normal and tumoral
epithelial cells. Biochem J 366(Pt 3):729-736
282. Kupfer SR, Marschke KB, Wilson EM, French FS 1993 Receptor
accessory factor enhances specific DNA binding of androgen and
glucocorticoid receptors. J Biol Chem 268:17519-17527
111
283. Kupfer SR, Wilson EM, French FS 1994 Androgen and glucocorticoid
receptors interact with insulin degrading enzyme. J Biol Chem 269:20622-
20628
284. Jara M, Esponda P, Carballada R 2002 Abdominal temperature induces
region-specific p53-independent apoptosis in the cauda epididymidis of
the mouse. Biol Reprod 67:1189-1196
285. Turner TT, Riley TA 1999 p53 independent, region-specific epithelial
apoptosis is induced in the rat epididymis by deprivation of luminal
factors. Mol Reprod Dev 53:188-197
286. Kuhara A, Yamada N, Sugihara A, Ohyama H, Tsujimura T, Hayashi
S, Terada N 2005 Fos plays no role in apoptosis of epithelia in the mouse
male accessory sex organs and uterus. Endocr J 52:153-158
287. Farnebo M, Bykov VJ, Wiman KG 2010 The p53 tumor suppressor: a
master regulator of diverse cellular processes and therapeutic target in
cancer. Biochem Biophys Res Commun 396:85-89
288. Hess J, Angel P, Schorpp-Kistner M 2004 AP-1 subunits: quarrel and
harmony among siblings. J Cell Sci 117(Pt 25):5965-5973
289. Suzuki A, Matsuzawa A, Iguchi T 1996 Down regulation of Bcl-2 is the
first step on Fas-mediated apoptosis of male reproductive tract. Oncogene
13:31-37
290. Sugihara A, Yamada N, Tsujimura T, Iwasaki T, Yamashita K,
Takagi Y, Tsuji M, Terada N 2001 Castration induces apoptosis in the
male accessory sex organs of Fas-deficient lpr and Fas ligand-deficient gld
mutant mice. In Vivo 15:385-390
291. Suarez SS 2008 Regulation of sperm storage and movement in the
mammalian oviduct. Int J Dev Biol 52(5-6):455-462
112
113
CHAPTER 2
Identification of Apoptosis and Cell Survival Genes Regulated by
Androgens in the Rat Epididymis
Sophie-Anne Lamour1, Bernard Robaire1,2 1Departments of Pharmacology & Therapeutics and 2Obstetrics & Gynecology
McGill University, QC, Canada
114
1. Abstract
The epididymis is an androgen-dependent tissue that is responsible for the
maturation and storage of spermatozoa. Androgen withdrawal by orchidectomy
causes a region-specific and time-dependent wave of apoptosis along the tissue,
but the absolute number of apoptotic cells is limited. To investigate the early gene
expression response of survival and apoptosis genes after the withdrawal and/or
immediate replacement of androgen on the different regions of the epididymis, we
used apoptosis-focused arrays. We assessed changes in gene expression at 0.5 and
1 day after orchidectomy with or without testosterone (T) replacement and
selected genes (Bmf, Mcl1, Rad52, and Tnfrsf11b) were analyzed by qRT-PCR.
Pathway analysis was used to identify direct regulatory relationships between the
androgen receptor (AR), T and the affected genes; promoter sequence analysis
was also undertaken to identify putative androgen response elements (AREs).
Changes in protein levels and immunolocalization of TNFRSF11B were also
determined. We uncovered androgen-regulated apoptotic and cell survival genes;
some of these genes could be directly regulated by AR through putative AREs.
We also found that Bmf, Mcl1, Rad52, and Tnfrsf11b were repressed by T.
TNFRSF11B showed a region-specific localization in the cytoplasm of principal
cells. These results suggest that androgens regulate the expression of apoptotic
and cell survival genes in a region-specific manner in the epididymis.
115
2. Introduction
The epididymis, a highly convoluted tubule that links the efferent ducts of
the testis to the vas deferens, provides optimal microenvironments for the proper
maturation and storage of spermatozoa (1). Based on morphological and
functional differences, the epididymis is divided into four regions: initial segment
(IS), caput (Ca), corpus (Co), and cauda (Cd); its epithelium comprises four major
cell types (principal, basal, halo, and clear cells) (2;3). Androgens, in particular
dihydrotestosterone (DHT), the 5α –reduced metabolite of testosterone (T),
regulate epididymal structure and functions (4;5). Furthermore, testicular factors
such as basic fibroblast growth factor (bFGF2) (6) and androgen binding protein
(7) regulate protein secretions in the proximal regions of the epididymis (8;9).
Androgen withdrawal by orchidectomy causes a decrease in epididymal
weight due to the loss of spermatozoa and luminal fluid as well as a decrease in
epididymal cell height (10;11). In addition, it has been demonstrated that, in the
rat, androgen withdrawal by orchidectomy causes a region-specific and time-
dependent wave of apoptosis, although at the peak of the response, the number of
apoptotic cells averages only 1 cell per tubule (12). Previous studies on the
molecular mechanisms explaining the apoptosis triggered by androgen withdrawal
in the epididymis have determined that it is p53-independent (13;14), but
conflicting reports exist on its Fas-dependence (15;16). Ezer and Robaire (17)
have also identified two pro-apoptotic genes [defender against cell death protein
1 (Dad1) and tumor necrosis factor receptor 1 (Tnfrsf1a)] and an anti-apoptotic
gene [myeloid cell differentiation protein 1 (Mcl1)] as being regulated by
androgens in the epididymis. However, the underlying pro- and anti-apoptotic
pathways triggered by androgen withdrawal in the epididymis are still unknown.
Numerous studies have been undertaken to assess changes in overall
transcription in the human (18-20), rat (17;21), and mouse (22;23) epididymides
under different pathological (18;20) and experimental (19;24-27) conditions. In
the present study, we investigated early changes in the expression of apoptotic
and cell survival genes in the four epididymal regions after androgen withdrawal.
We also determined which affected genes could be rescued by immediate
116
replacement with testosterone. We used apoptosis-focused arrays and qRT-PCR
to determine changes in gene expression at 0.5 and 1 day after androgen
withdrawal and replacement. We found region-specific changes in the expression
of apoptotic and cell survival genes and uncovered genes potentially regulated by
androgens through putative androgen response elements.
3. Materials and Methods
3.1. Chemicals
T (4-Androsten-17β-ol-3-one) was purchased from Steraloids Inc.
(Newport, RI). Sodium azide was bought from Fisher Scientific Company
(Nepean, ON). Medical adhesive (Silicone type A, cat. no. 891) and tubing (cat.
no. 602-305) to make the polydimethylsiloxane (Silastic) implants were
purchased from Dow Corning Silicones (Midland, MI). Bovine serum albumin
(Fraction V) (BSA), NP-40 substitute and sodium deoxycholate/DOC were
obtained from Sigma-Aldrich Canada Ltd. (Oakville, ON). NaCl, SDS, and TRIS
were bought from Invitrogen Canada Inc. (Burlington, ON). Normal saline (0.9%
w/v NaCl in water), Bestatin, PMSF, leupeptin, and aprotinin were bought from
Roche Applied Science (Laval, QC). Ketamine was bought from Bioniche
(Belleville, ON), acepromazine from Wyeth-Ayerst (St-Laurent, QC), xylazine
from Novopharm (Montreal, QC), and buprenorphine from Reckitt & Cloman
(Bristol, UK).
3.2. Animals
Adult male Brown Norway (BN) rats (3-4 months old) were obtained from
Charles River Canada (Saint-Constant, QC) and housed at the McIntyre Animal
Resources Centre of McGill University. Rats (3 per cage) were kept under
controlled light (14-h light, 10-h dark) and temperature (22°C) and had access to
regular rat chow and water ad libitum. All animal studies were conducted in
accordance with the principles and procedures outlined in the Guide to the Care
and use of Experimental Animals prepared by the Canadian Council on Animal
Care (Animal Use Protocol no. 206).
117
Rats were separated into 11 groups (n=6/group): sham-operated;
orchidectomized and implanted sc. with an empty 2.5-cm Silastic capsule (-T
groups) and sacrificed at 0.5, 1, 2, 3 or 7 days after surgery; or orchidectomized
and implanted sc. with a T-filled 2.5-cm Silastic capsule (+T groups) and
sacrificed at 0.5, 1, 2, 3 or 7 days after surgery. Rats were anaesthetized by an
intramuscular injection of ketamine, xylazine, and acepromazine (5:2.5:1) in
normal saline (0.1ml/100g body weight) and received buprenorphine
(0.001mg/100g body weight) after surgery. Bilateral orchidectomy was done as
described elsewhere (17) and capsules were implanted sc. at the time of surgery.
Implants were made according to the method of Stratton et al. (28) and had a T
release rate of 30µg/cm/day, releasing T to an equivalent amount to serum T. To
ensure a steady rate of T release, implants were bathed for 2 days prior to surgery
in a solution of normal saline containing 1% BSA and 0.1% sodium azide. At the
time of death, blood was collected as well as epididymides that were separated
into IS, Ca, Co, and Cd regions, frozen in liquid nitrogen and kept at -80°C.
3.3. Serum testosterone analysis
Serum was isolated from blood samples by centrifugation. Supernatants
were kept at -80°C until used. Concentrations of serum T were measured
using a commercially available Testosterone ELISA kit (Fitzgerald Industries
International Inc., Acton, MA) following the manufacturer’s instructions.
Sensitivity of the assay was 0.1ng/ml. Intra-assay variation was 4.5%, whereas
inter-assay variation was 6.9%.
3.4. RNA extraction, oligo arrays and hybridization
RNA was isolated from the IS, Ca, Co and Cd of sham-operated, 0.5 day
(-T), 1 day (-T), 0.5 day (+T), and 1 day (+T) groups using Qiagen Mini-prep
(Qiagen Inc., Mississauga, ON) following manufacturer’s instructions. DNase
treatment was done using the RNase-free DNase set (Qiagen Inc.) following the
manufacturer’s instructions. Concentration and quality of RNA were verified by
measuring OD at 260nm and 280nm (DU7 spectrophotometer, Beckman,
118
Mississauga, ON). Quality of RNA was also assessed by running the samples in
non-denaturing 1% agarose gels. Each RNA sample was extracted from a single
epididymal region from an individual rat; no samples were pooled.
RNA samples were transcribed into biotin-labeled cRNA following the
True-Amp protocol from SABiosciences (SABiosciences, Frederick, MD).
Briefly, 1.5 µg to 2 µg of RNA was reverse transcribed into cDNA followed by
overnight transcription and amplification into biotin-labeled cRNA using the
GeneAmp PCR System 2400 machine (PerkinElmer, Woodbridge, ON). Four
micrograms of biotin-labeled cRNA were then hybridized to apoptosis-focused
oligo GEArrays (ORN-012, SABiosciences) following manufacturer’s
instructions; these arrays contain 112 probes, description of which can be found in
table 1. Five arrays for each of the four epididymal region for the two time points
after orchidectomy and sham (n=5/region/time; 100 samples) were hybridized and
referred to as replicates. Hybridized membranes were visualized by exposing
them to an ECL film (GE Healthcare, Baie d’Urfe, QC) for 20 sec. Arrays on
films were scanned (ScanJet ADF, Hewlett Packard, Kirkland, QC) on grayscale
with a resolution of 600dpi and saved as tiff- files. Scanned images were imported
into the GEASuite software (http://geasuite.superarray.com) from SABiosciences
where the arrays were aligned and raw data obtained. Raw data were then
imported into Excel for background correction, which was done by subtracting the
average value of 5 probe sets (Blk, Cideb, Lyst, Rem2, and Xiap) that had the
lowest expression on every array to the raw data obtained. The data were analyzed
using GeneSpring GX 7.2 software (Agilent Technologies, Mississauga, ON),
where a custom genome was created. Two normalization steps were applied. First,
every value below 0.01 was transformed into 0.01. Then, a per chip normalization
was applied by normalizing every gene against all the others. This was followed
by a per gene normalization where every gene was normalized to the median
value of its measurements. For a gene to be considered expressed, its expression
had to be two-fold above background. Genes were considered differentially
expressed if they were up- or down-regulated by at least 1.5 fold (i.e. 50%
increase or 33% decrease) as compared to sham-operated in at least 3 arrays out
119
of 5. In order to identify putative AREs in the promoter region of affected genes,
we used the “Find potential regulatory sequences” tool. We used the following
sequence AGAACCnnnTGTTCT allowing for a maximum of 3 unknown bases.
Pathway analysis was done using PathwayStudio 7 (Ariadne Genomics,
Rockville, MD) and ResNet-7 database to visualize relationships between
transcripts differentially affected by orchidectomy with and without T implants,
the androgen receptor (AR), T, and growth factors. Objects were proteins and
small molecules; pathways and relationships were limited to expression,
regulation, and promoter binding.
3.5. Quantitative Real-Time RT-PCR
Real-Time RT-PCR was done on selected genes (Table 2) to quantify their
expression levels using the QuantiTect RT-PCR SybrGreen kit (Qiagen Inc.) and
the LightCycler system (Roche Applied Science, Laval, QC) as described
previously (29). Each sample was assayed in duplicate. Changes in gene
expression were normalized against peptidylprolyl isomerase A (Ppia, cyclophilin
A) expression. Ppia is a housekeeping gene; its mRNA expression is not affected
by androgen manipulation (30). Transcript-specific primers were designed using
Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/), except
for Tnfrsf11b; those were ordered from QIAGEN (catalog no. QT00177170,
QuantiTect Primer Assays). All other primers were synthesized by AlphaDNA
(www.alphadna.com; Montreal, QC).
3.6. Dot blot
First-strand cDNA synthesis was done using 1μg total RNA, random
primers (Invitrogen), 10mM dNTP mix (Invitrogen), and SuperScriptTM III RT
(Invitrogen). The synthesized cDNA was then used as a template for PCR
amplification using primers for Tnfrsf11b (forward 5’-
TGAGACGTCATCGAAAGCAC-3’; reverse 5’-
CTGGCAGCTTTGCACAATTA-3’) and 18S rRNA (forward 5’-
AAACGGCTACCACATCCAAG-3’; reverse 5’-
120
AGTCGGCATCGTTTATGGTC-3’) designed using Primer3 software and
synthesized by AlphaDNA. The cycling conditions were as follow: 2 min at 940C,
40 cycles of 30 sec at 940C, 1 min at 560C, and 1 min at 720C, followed by 5 min
at 720C, and 40C O/N. For dot blot analysis, PCR samples were prepared by
adding 0.5M EDTA, 6N NaOH, and 2M NH4OAc. Samples were loaded into a
dot-blot manifold (Bio-Rad, Mississauga, ON) to be transferred onto a
nitrocellulose membrane (Bio-Rad). Filter was removed and soaked for 15 sec in
6X SSC+0.1% SDS. The membrane was cross-linked under UV light for 4 min.
Membranes were soaked for 2-4h at 420C in pre-hybridization solution [20X SSC,
50X Denhardt’s, 20mg/ml tRNA (Roche Applied Science), 20% SDS, and
ddH2O]. The internal oligonucleotide probe for Tnfrsf11b
(TGGGAATGAAGATCCTCCAG) and 18S rRNA
(CGCGGTTCTATTTTGTTGGT) were designed using Primer3 software and
synthesized by AlphaDNA. Fifty ng of oligonucleotide probe was labeled using
γP32 (PerkinElmer), kinase buffer (Roche Applied Science), and T4 kinase
(Roche Applied Science). It was incubated for 1-2h at 370C and passed trough a
G-25 sephadex column. An activity of 104-105 cpm/ng was considered good.
Labeled oligonucleotide was added to the hybridization solution (20X SSC, 20%
SDS, and ddH2O) at a concentration of 6x106cmp/ml.
3.7. Western blot analysis
Whole cell extracts (n=5/group) were prepared in RIPA buffer (150mM
NaCl, 1% NP-40 substitute, 0.5% sodium deoxycholate/DOC, 0.1% SDS, 50mM
TRIS pH 7.4). For each ml of RIPA buffer, the following proteinase inhibitors
were added: 4µl bestatin (10mg/ml), 1µl PMSF (24mg/ml), 2µl leupeptin
(5mg/ml), and 3µl aprotinin (2mg/ml). Protein concentrations were determined by
the Bradford method using the Bio-Rad protein assay (Bio-Rad Laboratories,
Mississauga, ON) following the manufacturer’s protocol. For each sample, 20μg
protein per lane was separated on a 12% acrylamide SDS-PAGE gel; a testis
sample was used as a positive control. Prestained All Blue Precision Plus Protein
Standards (Bio-Rad Laboratories) were used as molecular weight markers.
121
Separated proteins were transferred to a PVDF Hybond-P membrane (GE
Healthcare). Blots were blocked in 5% non-fat dried milk in TBS-T (137 mM
NaCl, 20 mM Tris, 0.5% Tween 20, pH 7.6) for 1h at room temperature and then
incubated overnight at 4°C with a primary rabbit antibody against human
TNRSF11B (1:500, AB2125P, Millipore, Billerica, MA). The membrane was
then probed with a donkey anti-rabbit IgG horseradish peroxidase linked whole
antibody (1:10 000, NA934V, GE Healthcare). Constant loading was assessed by
probing the membrane with a primary goat antibody against ACTIN (1:10 000,
sc-1616, Santa Cruz Biotechnology, Santa Cruz, CA) and detecting it with a
donkey anti-goat IgG horseradish peroxidase conjugated antibody (1:10 000, sc-
2056, Santa Cruz Biotechnology).There was no blocking peptide for the
TNFRSF11B antibody available from Millipore. Signals were detected with the
Enhanced Chemiluminescence Plus kit (GE Healthcare) and visualized on
Hyperfilm enhanced chemiluminescence (GE Healthcare). Quantification of
western blot data was done by densitometry analysis using a Chemilmager 4000
imaging system (Cell Biosciences, Santa Clara, CA) with AlphaEase (version 5.5
software, Cell Biosciences). Expression of TNFRSF11B was expressed relative to
the corresponding expression of ACTIN for all groups.
3.8. Immunohistochemistry
Tissue preparation (n=5) for immunohistochemistry was done as described
elsewhere (12). Sections (5 μm thick) were incubated overnight at 4°C with a
primary rabbit antibody against human TNFRSF11B (1:250, AB2125P,
Chemicon International) and stained using the Rabbit Vectastain Elite ABC Kit
(Vector Laboratories, Burlington, ON). The DAB substrate kit for peroxidase
(SK-4100, Vector Laboratories) was used to reveal staining. The negative control
was obtained by incubating the slides with no primary antibody against
TNFRSF11B followed by incubation with the secondary antibody. Slides were
counterstained with a 0.005% methylene blue solution and examined under a light
microscope (Laborlux D, Leica, Allendale, NJ). Micrographs were taken with a
CoolSnap camera (Roper Scientific, Tucson, AZ).
122
3.9. Statistical analysis
Parametric data were analyzed by one-way ANOVA followed by
Dunnet’s post hoc test, whereas non-parametric data were analyzed by Kruskal-
Wallis one-way ANOVA on ranks followed by Dunn’s post hoc test. Serum T
concentrations were log transformed before being analyzed. Statistical differences
between time (0.5 day or 1 day) across treatment (-T and +T) were determined by
unpaired t-tests. If normality could not be assumed, data were analyzed using the
Mann-Whitney Rank Sum test. Significance was set at p<0.05.
4. Results
4.1. Orchidectomy, with or without testosterone replacement, changed serum
testosterone concentration and sex accessory tissue weights
Previous studies on the effects of orchidectomy on the structure of the
epididymis had been conducted in the Sprague-Dawley (SD) rat model system
(10-12). However, the outbred SD rat strain was inappropriate to conduct
genomic studies and hence we chose to work with Brown Norway (BN) rats.
In order to assess if the BN rat was a suitable model for the study of the
effects of androgen withdrawal on the epididymis, we evaluated the consequences
of orchidectomy with or without testosterone replacement on serum T levels
(fig.1A) and on weights of ventral prostate (fig.1B), empty seminal vesicles
(fig.1C) and epididymis (fig.1D). We found that by 0.5 day after orchidectomy,
serum T levels had decreased below the detection limit of the assay, i.e., by more
than 97%, whereas the presence of T implant maintained serum T concentrations
in the normal physiological range (fig.1A). At 0.5 day, the seminal vesicles were
the first tissues to show a significant change in tissue weight between the (-T) and
(+T) groups (p<0.05) (fig. 1C), whereas the epididymis showed the first
significant effect of treatment at 1 day (p<0.05) (fig. 1D). The prostate only
showed a significant difference between the (-T) and (+T) groups at 7 days
(p<0.05) (fig. 1B). For all tissues, androgen withdrawal significantly decreased
their weights at 7 days (p<0.05). These results were similar to the ones found for
SD rats (data not shown). In order to assess how androgen withdrawal or
123
replacement after orchidectomy affects gene transcription, we selected the 0.5 and
1.0 day time points, thus optimizing the identification of early response genes
while minimizing the direct impact of apoptosis, as this process is minimal at
these early times (12).
4.2. Testosterone differentially affected transcription of genes in the different
regions of the epididymis
Out of the 96 apoptotic and survival probe sets expressed on the arrays, 43
probe sets were known to be pro-apoptotic, 17 anti-apoptotic, 12 were involved in
repair, and 16 had apoptosis-related functions. Overall, combining all treatment
groups and regions, 53 transcripts were increased or decreased by at least 1.5 fold
in the epididymis.
When we compared the number of transcripts that were up- and down-
regulated in the different regions of the epididymis (fig. 2), we found that T
replacement greatly decreased the number of affected transcripts at 0.5 day after
orchidectomy in the IS (up-regulated: 5 to 1; down-regulated: 7 to 4; fig. 2A) and
Co (up-regulated: 5 to 1; down-regulated: 10 to 3; fig. 2C). In the Ca (fig. 2B), T
replacement slightly increased the number of down-regulated transcripts (from 3
to 6), but had no effect in the Cd (fig. 2D). At 1 day after orchidectomy, T
replacement caused the largest decrease in the number of affected transcripts in
the Cd (up-regulated: 10 to 5; down-regulated: 7 to 1; fig. 2D), whereas the Co
(fig. 2C) had only a decrease in down-regulated transcripts from 10 to 3 genes.
Without T replacement, four transcripts (Mcl1, Tnfrsf11b, Cd40lg, and Birc5)
were differentially affected in all regions of the epididymis (table 3). Six
transcripts (Bad, Bnip3, Bnip3l, Rad52, Birc3, and Traip) were specifically
affected in the distal regions of the epididymis, whereas 3 transcripts (Casp4,
Ltbr, and Tnfrsf26) were specifically affected in the IS (table 3). Bmf was the only
transcript that was affected in all regions, except in the Cd (table 3). With T
replacement, 5 transcripts were specifically affected in the IS (Bcl2l10, Bmf,
Mcl1, Casp8, Tnfrsf11b), whereas 11 transcripts (Bax, Bik, Casp11, Tnfrsf1a,
Tnfrsf1b, CD70, Tnfsf10, Birc3, Dapk3, Traip, and Cntnap1), 4 transcripts (Bak1,
124
Bcl2l2, Casp7, and Dffa), and 9 transcripts (Bcl2l1, Tnfrsf4, Tnfrsf12a, Cd40lg,
Tnfsf9, Tnfsf15, Rad50, Rad52, and Tnfaip2) were affected in the Ca, Co, and Cd,
respectively (table 4). Together, these data suggested that each epididymal region
responded differently to orchidectomy with or without T replacement.
4.3. Testosterone and androgen receptor regulation of gene transcription
We used PathwayStudio software to query Pubmed to determine known
regulatory relationships between androgens, either as T or through the androgen
receptor (AR), and the affected transcripts. Only 7 transcripts (Bax, Bcl2, Bmf,
Birc5, Casp6, Tnfrsf1a, and Tnfrsf11b) had been previously shown to be directly
regulated by T; only 2 transcripts, Bcl2 and Cflar, showed a direct regulation by
AR (fig. 3A). We then identified potential proteins (kinases and transcription
factors) that could act as mediators of AR and T action (fig. 4A and B,
respectively). We found that 12 transcripts could be indirectly regulated by AR
through the action of TERT, CDKN1A, MAPK1, MYC, CTNNB1, KRAS, and
PTK2, whereas 19 transcripts could be indirectly regulated by T through 17
different potential mediators. Out of the 12 transcripts indirectly regulated by AR,
only 8 could also be regulated by T. Most transcripts had only one potential
mediator of AR or T action; Mcl1 and Birc3 were the two transcripts with the
highest number of potential mediators, 7 and 5, respectively (fig. 4B).
A search for putative androgen response elements (AREs) up to 3kb
upstream of differentially affected transcripts (table 5) revealed that out of the 53
transcripts that were affected by orchidectomy with or without T replacement,
only 28 had published promoter sequences; all of those 28 genes showed putative
AREs (fig. 3B). All apoptotic and cell survival gene families showed genes with
potential AREs in their promoter sequences. Cntnap1 had the lowest number of
putative AREs (5 AREs), whereas Bmf had the highest number (22 AREs).
Sixteen genes had more than 15 putative AREs whereas 12 genes had less than 15
putative AREs. All the putative AREs were scattered in the 3kb upstream
promoter sequences. These results demonstrate that AR could directly regulate the
transcription of a proportion of pro- and anti-apoptotic genes in the epididymis.
125
At 0.5 day and 1 day after orchidectomy, although serum T concentrations
had decreased below detection limit, we could not exclude the participation of
luminal factors, in particular growth factors, still present in the epididymis (31) to
contribute to changes seen at the transcriptional level. We then determined which
growth factors known to be present in the epididymis (EGFR, FGF2, IGF1,
IGF1R, VEGFA, VEGFB, and TGFA) (32) could affect gene transcription and
found that 23 out of the 53 transcripts affected in any condition could be regulated
by growth factors (fig. 5). In fact, 7 genes were known to be regulated by EGFR,
10 by FGF2, 10 by IGF1/IGF1R, 8 by VEGFA, 5 by VEGFB, and 6 by TGFA
(fig. 5).
4.4. Orchidectomy with or without testosterone replacement affected the
transcription of Bmf, Mcl-1, Rad52, and Tnfrsf11b
We focused on four transcripts (Bmf, Mcl1, Rad52, and Tnfrsf11b), that
showed region-specific changes in transcription after orchidectomy with or
without T replacement (tables 2 and 3) and that belonged to three major apoptotic
and cell survival gene families: Bcl2 family (Bmf and Mcl1), ATM and p53
family (Rad52), and TNFR (Tnfrsf11b). They also participated in promoting
either cell death (Bmf), survival (Mcl1 and Tnfrsf11b) or DNA repair (Rad52) (fig.
6).
Rad52. Rad52 showed the highest basal level of expression in the Ca
(0.68±0.07 fig. 7B) and the lowest in the Cd (0.008±0.001; fig. 7D). In all
regions, at 1d after orchidectomy with T replacement, Rad52 expression was
undetectable (fig. 7). In addition, Rad52 mRNA expression was significantly
different from sham-operated levels in all regions and treatments (p<0.05) (fig. 7).
Interestingly, at 1 day after orchidectomy without T replacement, the IS was the
only region to show a significant increase in Rad52 mRNA (p<0.05). In all
regions and all time points, except at 0.5 day in the Cd (fig. 7D), T replacement
significantly repressed Rad52 mRNA expression (p<0.05). This indicated that T
was repressing Rad52 expression in the epididymis.
126
Mcl1. Mcl1 showed the highest basal level of expression in the IS and Co
(1.66±0.23 and 1.92±0.41, respectively; fig. 8A and 8C) and the lowest in the Ca
and Cd (0.86±0.24 and 0.98±0.07, respectively; fig. 8B and 8D). At 0.5 day after
orchidectomy, T replacement significantly repressed Mcl1 mRNA expression in
all regions except Cd (p<0.05) (fig. 8). At 1 day after orchidectomy, in the
proximal regions, T replacement repressed Mcl1 mRNA expression (fig. 8A-B),
whereas in the distal regions, T replacement significantly increased Mcl1
expression (p<0.05) (fig. 8C-D). This indicated that T was repressing Mcl1
expression in the proximal regions of the epididymis, whereas T was activating
Mcl1 expression in the distal regions.
Bmf. In general, the proximal regions showed the highest basal levels of
Bmf expression (2.22±0.47 and 1.06±0.13 for IS and Ca, respectively) and the
distal regions the lowest (0.43±0.05 and 0.37±0.05 for Co and Cd, respectively)
(fig. 9). In addition, the IS showed the highest induction of Bmf mRNA after
orchidectomy with or without T replacement (fig. 9A). In all regions, except Ca,
at 0.5 day after orchidectomy, T replacement repressed Bmf mRNA expression.
On the other hand, at 1 day after orchidectomy, T replacement increased Bmf
expression in the proximal regions, but had little effects on the distal regions (fig.
9). This indicated that Bmf was differentially regulated by T in the proximal and
distal regions of the epididymis.
Tnfrsf11b. Compared to other reproductive tissues, the epididymis
expressed Tnfrsf11b at an average level (fig. 10). The IS had the highest basal
level of Tnfrsf11b mRNA expression (2.37±0.63, fig. 11A) and the Ca the lowest
(0.55±0.14; fig. 11B). For all regions at 0.5 day after orchidectomy, T
replacement significantly repressed Tnfrsf11b mRNA expression (p<0.05) as
compared to orchidectomy without T replacement. Compared to control, T
replacement also repressed Tnfrsf11b expression at 0.5 day after orchidectomy in
the proximal regions, but increased Tnfrsf11b expression in the Cd. At 1 day,
orchidectomy without T replacement significantly (p<0.05) repressed Tnfrsf11b
expression in all regions, except Ca (fig. 11). This indicated that Tnfrsf11b was
repressed by T in the epididymis. However, at the protein level, there were no
127
significant differences between the treatment groups, although T seemed to
repress TNFRSF11B protein expression in all regions at 0.5 day after
orchidectomy (fig. 11).
We also assessed whether Tnfsf11 (Receptor Activator of NF-κB Ligand -
RANKL) and Tnfrsf11a (RANK), two proteins involved in osteogenesis (33) and
differentiation of the immune system (34), two processes affected by
TNFRSF11B (33;35), were expressed in the epididymis. We found that they were
both expressed in the epididymis. Interestingly, both Tnfsf11 (fig. 12A) and
Tnfrsf11a (fig. 12B) had the highest mRNA expression in the Co epididymidis.
Immunolocalization of TNFRSF11B in the epididymis revealed that in all
regions, this protein was expressed specifically in principal cells (fig. 13).
Interestingly, in the proximal regions, TNFRSF11B immumolocalized throughout
the cytoplasm, whereas, in the distal regions, TNFRSF11B was apically localized
(fig. 13F-I).
5. Discussion
In the control epididymis, only 5 probe sets (Blk, Cideb, Lyst, Rem2, and
Xiap) present on the arrays were not expressed. One of them, XIAP (X-linked
inhibitor of apoptosis) is the most characterized and potent inhibitor of apoptosis
protein (IAP) (36). XIAP is not only up-regulated in cancers, but is also expressed
in normal tissues, in particular the testis, where it is highly expressed (37). Given
its ubiquitous expression, the lack of expression of Xiap in the epididymis would
not have been predicted. This highlights the particular nature of the epididymis.
In the epididymis, expression of Tp53, a central regulator of many
biological processes, including apoptosis (38), was not changed after
orchidectomy with or without testosterone replacement. Although it has been
shown that TP53 is not involved in the response of the IS to testicular factors
removal by efferent duct ligation (14), one could have expected removal of both
testicular factors and androgens by orchidectomy to trigger a decreased
expression of Tp53 to prevent apoptosis. Unfortunately, the arrays did not contain
a probe for another central regulator of apoptosis, the tumor suppressor
128
retinoblastoma 1 (Rb1) (39); expression of this marker might have been changed
in the epididymis after androgen orchidectomy with or without T replacement.
Two thirds of the probe sets present on the arrays showed a 1.5 fold
increase or decrease in expression in at least one treatment and/or region. The
finding that apoptotic and cell survival genes are expressed in a region-specific
manner is similar to previous reports on the region-specific expression profiles of
genes in the epididymis (17;19;40-42). For example, Ezer and Robaire (17) have
identified Tnfrsf1a as a transcript specifically expressed in the Ca epididymidis, a
finding reproduced in this study. However, they have also shown that transcripts
involved in metabolism, calcium-binding proteins (CABPs), and heat shock
proteins (Hsps) are affected across all regions after orchidectomy (17). In this
study, we also identified 4 transcripts (Birc5, Cd40lg, Mcl1, and Tnfrsf11b) that
were affected across all regions after androgen withdrawal; these four transcripts
will be discussed in more detail in the next paragraphs.
Birc5. BIRC5 is an inhibitor of apoptosis protein (IAP), which is known as
a protein highly expressed in cancers, but not in terminally-differentiated tissues
(43). The epididymis is a terminally-differentiated tissue with very rare cases of
cancers (1) making Birc5 presence in the epididymis unexpected. BIRC5 can act
as an anti-apoptotic protein or regulate cell division (44). Given that the
epididymis has a very low mitotic index (45), one can assume that BIRC5 would
be acting as an anti-apoptotic protein in the epididymis.
Cd40lg. CD40 ligand is a transmembrane TNF ligand expressed in non-
inflammatory conditions by activated T lymphocytes, activated B lymphocytes,
and platelets; during inflammation, monocytes, natural killer cells, mast cells, and
basophils also express it (46). CD40 ligand could be expressed by halo cells, the
immune cells of the epididymis that comprise helper T lymphocytes, cytotoxic T
lymphocytes, and monocytes (47). The expression of Cd40lg after androgen
withdrawal suggests the involvement of an immune response, which could be
triggered by damaged cells in the lumen.
Mcl1. Mcl-1 is an anti-apoptotic Bcl2 family member that acts by directly
binding pro-apoptotic Bcl2 members and thereby inhibiting cytochrome c release
129
from the mitochondria. Contrary to other Bcl2 member, Mcl-1 has a short half-life
and can be up-regulated rapidly (48) making Mcl-1 a good target for
transcriptional control. This suggests an involvement of the intrinsic
mitochondrial pathway in the response of the epididymis to androgen withdrawal.
We found that T regulated Mcl1 expression in opposite ways in the proximal and
distal epididymides: T repressed Mcl1 expression in the proximal regions,
whereas it increased Mcl1 expression in the distal regions. These results highlight
the differences in gene regulation between the different regions of the epididymis
(17;19;40-42).
Tnfrsf11b. TNFRSF11B is a soluble TNFR that has been first discovered
as an inhibitor of osteoclast formation (49). TNFRSF11B prevents the binding
between TNFRSF11A (receptor activator of NF-kappaB; RANK) expressed by
osteoclasts and its ligand TNFSF11 (RANKL) found in osteoblasts; binding of
TNSF11 to TNFRSF11A on osteoclasts triggers the maturation of osteoclasts
hence maintaining bone homeostasis (33;50). TNFRSF11A/TNFSF11 are also
important for differentiation of the immune system (34), whereas TNFRSF11B
increases humoral immune response (35). In fact, we have identified Tnfrsf11a
and Tnfsf11 as being expressed in the epididymis. Furthermore, during apoptosis,
TNFRSF11B, which lacks a transmembrane domain and hence cannot signal, acts
by binding to TNFSF10 (TNF-related apoptosis-inducing ligand, TRAIL), thereby
preventing the activation of TNFRSF10A/B and the caspase cascade (49;51).
TNFRSF11B is also a survival factor for human prostate cancer cells (52). In our
arrays, Tnfsf10 expression was not changed after orchidectomy with or without T
replacement. At 0.5 day after orchidectomy, we found that Tnfrsf11b mRNA
expression is repressed by T replacement. This result is consistent with the study
by Hofbauer et al. (53) where they demonstrate that androgens decrease Tnfrsf11b
mRNA expression. However, Hofbauer et al. (53) also show that androgens
decrease TNFRS11B protein expression, which we have not found. This suggests
that, although TNFRSF11B can be regulated at the transcriptional level by T,
other mechanisms are probably in place to regulate its protein expression in the
epididymis. Taken together, the multiple roles of
130
TNFRS11A/TNFRSF11B/TNFSF11, the expression of Tnfrsf11a, Tnfrsf11b, and
Tnfsf11 in the epididymis and the changes in expression of Tnfrsf11b after
androgen withdrawal, one can assume a dual role of TNFRSF11B in immunity in
the control epididymis and as an anti-apoptotic protein after androgen withdrawal.
In the epididymis, TNFRSF11B was localized in the cytoplasm of principal cells,
the androgen-responsive and major secretory cells of the tissue (54). However,
halo cells are the primary immune cells (47). It is possible that principal cells
secrete TNFRSF11B to regulate functions of immune cells and/or protect
spermatozoa from degradation by immune cells (1). It is also tempting to
speculate that TNFRSF11A and TNFSF11 would localize to halo cells.
We further characterized changes in expression for Rad52 and Bmf, two
transcripts that showed region-specific changes in expression.
Rad52. RAD52 is involved in DNA double strand break repair through
homologous recombination. In fact, RAD52 is essential for the formation of the
DNA repair complex and the recruitment of downstream effectors (55;56). Failure
of the RAD52 complex to repair DNA damage will lead to apoptosis, whereas
success will lead to cell survival (55). Rad52 expression was repressed by T in the
epididymis. This is the first time that androgens are shown to regulate the
expression of a repair protein. We also found that the IS was the only region to
show a significant increase in Rad52 mRNA expression at 1 day after
orchidectomy without T replacement. This suggests a higher sensitivity of the IS
to the effects of androgen withdrawal and perhaps an attempt to counteract these
effects. It is well established that the IS is particularly sensitive to androgen
withdrawal by orchidectomy (12).
Bmf. BMF is a pro-apoptotic BH3-only Bcl2 family member that is linked
to the actin cytoskeleton. When the cell detaches from the basal lamina, BMF is
released from the cytoskeleton, allowing it to bind and inhibit the anti-apoptotic
Bcl2 triggering a very specific form of cell death called anoikis (57-59). In
addition, BMF has been localized to the subacrosomal space of postmeiotic
spermatids from step 4 to 16 of spermiogenesis in the testis (60). We found that
the IS showed the highest induction of Bmf mRNA in all treatments suggesting
131
that it is more sensitive to cell death by anoikis. In addition, at 0.5 day after
orchidectomy without T replacement, we showed that there was an increase in
Bmf expression. On the other hand, Show et al. (60) have demonstrated that
decreased T in the testis causes a decrease in Bmf mRNA expression. At 1 day
after orchidectomy, we found that T replacement increased Bmf expression in the
proximal regions, but had little effect in the distal ones; this highlights the
differences in gene regulation between the different regions of the epididymis
(17;19;40-42).
This study demonstrates that androgens regulate the expression of both
pro- and anti-apoptotic transcripts in a region-specific manner in the epididymis,
some of which could potentially be transcriptionally-regulated by androgens. This
suggests an ability of the epididymis to maintain a balance between pro- and anti-
apoptotic responses and hence explain why although there are some apoptotic
cells in the epididymis after androgen withdrawal by orchidectomy, their number
is limited (12).
6. Acknowledgements
We would like to thank Ludovic Marcon for the perfusions and Chunwei Huang
for her help with GeneSpring. We are also very grateful to Trang Luu for her
continuous technical assistance and Dr. Eddy Rijntjes for his critical review of the
manuscript.
132
References
1. Robaire B, Hinton BT, Orgebin-Crist MC 2006 The Epididymis. In:
Jimmy D.Neill, ed. Knobil and Neill's Physiology of Reproduction. Third
Edition ed. Elsevier; 1071-1148
2. Hermo L, Robaire B 2002 Epididymal cell types and their functions. In:
Robaire, Hinton, eds. The Epididymis: From Molecules to Clinical Practice.
Kluwer Academic-Plenum Publishers; 81-97
3. Reid B, Clewland K 1957 The structure and function of the epididymis. 1.
The histology of the rat epididymis. Aust J Zool223-246
4. Orgebin-Crist MC, Tichenor PL 1973 Effect of testosterone on sperm
maturation in vitro. Nature 245:328-329
5. Blaquier JA, Cameo MS, Burgos MH 1972 The role of androgens in the
maturation of epididymal spermatozoa in the guinea pig. Endocrinology
90:839-842
6. Lan ZJ, Labus JC, Hinton BT 1998 Regulation of gamma-glutamyl
transpeptidase catalytic activity and protein level in the initial segment of
the rat epididymis by testicular factors: role of basic fibroblast growth
factor. Biol Reprod 58:197-206
7. Robaire B, Zirkin BR 1981 Hypophysectomy and simultaneous
testosterone replacement: effects on male rat reproductive tract and
epididymal delta 4-5 alpha-reductase and 3 alpha-hydroxysteroid
dehydrogenase. Endocrinology 109:1225-1233
8. Fawcett DW, Hoffer AP 1979 Failure of exogenous androgen to prevent
regression of the initial segments of the rat epididymis after efferent duct
ligation or orchidectomy. Biol Reprod 20:162-181
133
9. Holland MK, Vreeburg JT, Orgebin-Crist MC 1992 Testicular regulation
of epididymal protein secretion. J Androl 13:266-273
10. Delongeas JL, Gelly JL, Leheup B, Grignon G 1987 Influence of
testicular secretions on differentiation in the rat epididymis: ultrastructural
studies after castration, efferent duct ligation and cryptorchidism. Exp Cell
Biol 55:74-82
11. Moore HD, Bedford JM 1979 Short-term effects of androgen withdrawal
on the structure of different epithelial cells in the rat epididymis. Anat Rec
193:293-311
12. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
13. Jara M, Esponda P, Carballada R 2002 Abdominal temperature induces
region-specific p53-independent apoptosis in the cauda epididymidis of the
mouse. Biol Reprod 67:1189-1196
14. Turner TT, Riley TA 1999 p53 independent, region-specific epithelial
apoptosis is induced in the rat epididymis by deprivation of luminal factors.
Mol Reprod Dev 53:188-197
15. Suzuki A, Matsuzawa A, Iguchi T 1996 Down regulation of Bcl-2 is the
first step on Fas-mediated apoptosis of male reproductive tract. Oncogene
13:31-37
16. Sugihara A, Yamada N, Tsujimura T, Iwasaki T, Yamashita K, Takagi
Y, Tsuji M, Terada N 2001 Castration induces apoptosis in the male
accessory sex organs of Fas-deficient lpr and Fas ligand-deficient gld
mutant mice. In Vivo 15:385-390
17. Ezer N, Robaire B 2003 Gene expression is differentially regulated in the
epididymis after orchidectomy. Endocrinology 144:975-988
134
18. Dube E, Hermo L, Chan PT, Cyr DG 2008 Alterations in gene expression
in the caput epididymides of nonobstructive azoospermic men. Biol Reprod
78:342-351
19. Thimon V, Koukoui O, Calvo E, Sullivan R 2007 Region-specific gene
expression profiling along the human epididymis. Mol Hum Reprod 13:691-
704
20. Thimon V, Calvo E, Koukoui O, Legare C, Sullivan R 2008 Effects of
vasectomy on gene expression profiling along the human epididymis. Biol
Reprod 79:262-273
21. Jervis KM, Robaire B 2001 Dynamic Changes in Gene Expression along
the rat Epididymis. Biol Reprod 65:696-703
22. Johnston DS, Turner TT, Finger JN, Owtscharuk TL, Kopf GS,
Jelinsky SA 2007 Identification of epididymis-specific transcripts in the
mouse and rat by transcriptional profiling. Asian J Androl 9:522-527
23. Sipila P, Pujianto DA, Shariatmadari R, Nikkila J, Lehtoranta M,
Huhtaniemi IT, Poutanen M 2006 Differential endocrine regulation of
genes enriched in initial segment and distal caput of the mouse epididymis
as revealed by genome-wide expression profiling. Biol Reprod 75:240-251
24. Jervis KM, Robaire B 2004 The effects of long-term vitamin E treatment
on gene expression and oxidative stress damage in the aging Brown Norway
rat epididymis. Biol Reprod 71:1088-1095
25. Jervis KM, Robaire B 2003 Effects of caloric restriction on gene
expression along the epididymis of the Brown Norway rat during aging. Exp
Gerontol 38:549-560
26. Jervis KM, Robaire B 2002 Changes in gene expression during aging in
the Brown Norway rat epididymis. Exp Gerontol 37:897-906
135
27. Turner TT, Johnston DS, Finger JN, Jelinsky SA 2007 Differential gene
expression among the proximal segments of the rat epididymis is lost after
efferent duct ligation. Biol Reprod 77:165-171
28. Stratton IG, Ewing LL, Desjardins C 1973 Efficacy of testosterone-filled
polydimethylsiloxane implants in maintaining plasma testosterone in
rabbits. J Reprod Fertil 35:235-244
29. Seenundun S, Robaire B 2007 Time-dependent rescue of gene expression
by androgens in the mouse proximal caput epididymidis-1 cell line after
androgen withdrawal. Endocrinology 148:173-188
30. Palladino MA, Hinton BT 1994 Expression of multiple gamma-glutamyl
transpeptidase messenger ribonucleic acid transcripts in the adult rat
epididymis is differentially regulated by androgens and testicular factors in a
region-specific manner. Endocrinology 135:1146-1156
31. Tomsig JL, Turner TT 2006 Growth Factors and the Epididymis. Journal
of Andrology 27:348-357
32. Jelinsky SA, Turner TT, Bang HJ, Finger JN, Solarz MK, Wilson E,
Brown EL, Kopf GS, Johnston DS 2007 The rat epididymal
transcriptome: comparison of segmental gene expression in the rat and
mouse epididymides. Biol Reprod 76:561-570
33. Boyce BF, Xing L 2007 Biology of RANK, RANKL, and osteoprotegerin.
Arthritis Res Ther 9:
34. Dougall WC, Glaccum M, Charrier K, Rohrbach K, Brasel K, De
Smedt T, Daro E, Smith J, Tometsko ME, Maliszewski CR, Armstrong
A, Shen V, Bain S, Cosman D, Anderson D, Morrissey PJ, Peschon JJ,
Schuh J 1999 RANK is essential for osteoclast and lymph node
development. Genes Dev 13:2412-2424
136
35. Stolina M, Guo J, Faggioni R, Brown H, Senaldi G 2003 Regulatory
effects of osteoprotegerin on cellular and humoral immune responses.
Clinical Immunology 109:347-354
36. Dean EJ, Ranson M, Blackhall F, Dive C 2007 X-linked inhibitor of
apoptosis protein as a therapeutic target. Expert Opin Ther Targets 11:1459-
1471
37. Verhagen AM, Coulson EJ, Vaux DL 2001 Inhibitor of apoptosis proteins
and their relatives: IAPs and other BIRPs. Genome Biol
2(7):REVIEWS3009
38. Farnebo M, Bykov VJ, Wiman KG 2010 The p53 tumor suppressor: a
master regulator of diverse cellular processes and therapeutic target in
cancer. Biochem Biophys Res Commun 396:85-89
39. Du W, Searle JS 2009 The rb pathway and cancer therapeutics. Curr Drug
Targets 10:581-589
40. Zhang JS, Liu Q, Li YM, Hall SH, French FS, Zhang YL 2006 Genome-
wide profiling of segmental-regulated transcriptomes in human epididymis
using oligo microarray. Mol Cell Endocrinol 250:169-177
41. Turner TT, Johnston DS, Jelinsky SA 2006 Epididymal genomics and the
search for a male contraceptive. Mol Cell Endocrinol 250:178-183
42. Johnston DS, Jelinsky SA, Bang HJ, DiCandeloro P, Wilson E, Kopf
GS, Turner TT 2005 The mouse epididymal transcriptome: transcriptional
profiling of segmental gene expression in the epididymis. Biol Reprod
73:404-413
43. Ambrosini G, Adida C, Altieri DC 1997 A novel anti-apoptosis gene,
survivin, expressed in cancer and lymphoma. Nat Med 3:917-921
137
44. Altieri DC 2008 New wirings in the survivin networks. Oncogene 27:6276-
6284
45. Clermont Y, Flannery J 1970 Mitotic Activity in the Epithelium of the
Epididymis in Young and old Adult Rats. Biol Reprod 3:283-292
46. Elgueta R, Benson MJ, de Vries VC, Wasiuk A, Guo Y, Noelle RJ 2009
Molecular mechanism and function of CD40/CD40L engagement in the
immune system. Immunol Rev 229:152-172
47. Serre V, Robaire B 1999 Distribution of immune cells in the epididymis of
the aging Brown Norway rat is segment-specific and related to the luminal
content. Biol Reprod 61:705-714
48. Zhuang J, Brady HJ 2006 Emerging role of Mcl-1 in actively
counteracting BH3-only proteins in apoptosis. Cell Death Differ 13:1263-
1267
49. Feige U 2001 Osteoprotegerin. Ann Rheum Dis 60 Suppl 3:iii81-iii84
50. Aoki S, Honma M, Kariya Y, Nakamichi Y, Ninomiya T, Takahashi N,
Udagawa N, Suzuki H 2010 Function of OPG as a traffic regulator for
RANKL is crucial for controlled osteoclastogenesis. J Bone Miner Res
25:1907-1921
51. Aggarwal BB, Bhardwaj U, Takada Y 2004 Regulation of TRAIL-
induced apoptosis by ectopic expression of antiapoptotic factors. Vitam
Horm 67:453-483
52. Holen I, Croucher PI, Hamdy FC, Eaton CL 2002 Osteoprotegerin
(OPG) is a survival factor for human prostate cancer cells. Cancer Res
62:1619-1623
138
53. Hofbauer LC, Hicok KC, Chen D, Khosla S 2002 Regulation of
osteoprotegerin production by androgens and anti-androgens in human
osteoblastic lineage cells. Eur J Endocrinol 147:269-273
54. Robaire B, Hermo L 1988 Efferent Ducts, Epididymis, and Vas Deferens:
Structure, Functions, and Their Regulation. In: E.Knobil and J.Neill et al.,
ed. The Physiology of Reproduction. Raven Press, Ltd.; 999-1080
55. Skorski T 2002 Oncogenic tyrosine kinases and the DNA-damage response.
Nat Rev Cancer 2:351-360
56. Plate I, Hallwyl SC, Shi I, Krejci L, Muller C, Albertsen L, Sung P,
Mortensen UH 2008 Interaction with RPA is necessary for Rad52 repair
center formation and for its mediator activity. J Biol Chem 283:29077-
29085
57. Cory S, Adams JM 2002 The Bcl2 family: regulators of the cellular life-or-
death switch. Nat Rev Cancer 2:647-656
58. Puthalakath H, Villunger A, O'Reilly LA, Beaumont JG, Coultas L,
Cheney RE, Huang DC, Strasser A 2001 Bmf: a proapoptotic BH3-only
protein regulated by interaction with the myosin V actin motor complex,
activated by anoikis. Science 293:1829-1832
59. Cory S, Huang DC, Adams JM 2003 The Bcl-2 family: roles in cell
survival and oncogenesis. Oncogene 22:8590-8607
60. Show MD, Folmer JS, Anway MD, Zirkin BR 2004 Testicular expression
and distribution of the rat bcl2 modifying factor in response to reduced
intratesticular testosterone. Biol Reprod 70:1153-1161
139
Table 1: Description of genes represented on the apoptosis-focused arrays Position Gene symbol Description Gene family RefSeq UniGene Entrez Gene ID 1 Ppia Peptidylprolyl isomerase A (Cyclophilin A) Other genes family NM_017101 Rn.1463 25518 2 Apaf1 Apoptotic peptidase activating factor 1 CARD family NM_023979 Rn.64522 78963 3 Pycard Apoptosis-associated speck-like protein containing a CARD CARD family NM_172322 Rn.64522 282817 4 Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM pathway XM_236275 Rn.7817 300711 5 Bad Bcl2-associated death promoter Bcl2 family NM_022698 Rn.98962 64639 6 Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other genes family NM_057196 Rn.36696 117542 7 Bak1 Bcl2-antagonist/killer 1 Bcl2 family NM_053812 Rn.95155 116502 8 Bax Bcl2-associated X protein Bcl2 family NM_017059 Rn.14598 24887 9 Bcl10 B-cell CLL/lymphoma 10 Bcl2 family NM_031328 Rn.10668 83477 10 Bcl2 B-cell leukemia/lymphoma 2 Bcl2 family NM_016993 Rn.13007 24224 11 Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 family NM_133416 Rn.9996 170929 12 Bcl2l1 Bcl2-like 1 Bcl2 family NM_031535 Rn.19770 24888 13 Bcl2l10 Bcl2-like 10 Bcl2 family NM_053733 Rn.10323 114552 14 Bcl2l11 Bcl2-like 11 (apoptosis facilitator) Bcl2 family NM_022612 Rn.67084 64547 15 Bcl2l2 Bcl2-like 2 Bcl2 family NM_021850 Rn.82709 60434 16 Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 family NM_053739 Rn.44267 114558 17 Hrk BH3 interacting (with Bcl2 family) domain, apoptosis agonist Bcl2 family NM_057130 Rn.2776 117271 18 Bik Bcl2-interacting killer-like Bcl2 family NM_053704 Rn.89639 114496 19 Naip2 Baculoviral IAP repeat-containing 1b IAP family XM_226742 Rn.38487 191568 20 Birc3 Inhibitor of apoptosis protein 1 IAP family NM_023987 Rn.92423 78971 21 Xiap X-linked inhibitor of apoptosis IAP family NM_022231 Rn.64578 63879 22 Birc5 Baculoviral IAP repeat-containing 5 IAP family NM_022274 Rn.91239 64041 23 Blk B lymphoid kinase (predicted) IAP family XM_344419 Rn.54471 364403 24 Bmf Bcl-2 modifying factor Bcl2 family NM_139258 Rn.20030 246142 25 Bnip1 Bcl2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 family NM_080897 Rn.72585 140932 26 Bnip3 Bcl2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 family NM_053420 Rn.16757 84480 27 Bnip3l Bcl2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 family NM_080888 Rn.2060 140923 28 Bok Bcl-2-related ovarian killer protein Bcl2 family NM_017312 Rn.827 29884
140
Position Gene symbol Description Gene family RefSeq UniGene Entrez Gene ID 29 Casp11 Caspase 11 Caspase family NM_053736 Rn.44461 114555 30 Casp12 Caspase 12 Caspase family NM_130422 Rn.16195 156117 31 Casp2 Caspase 2 Caspase family NM_022522 Rn.81078 64314 32 Casp6 Caspase 6 Caspase family NM_031775 Rn.1438 83584 33 Casp7 Caspase 7 Caspase family NM_022260 Rn.88160 64026 34 Casp8 Caspase 8 Caspase family NM_022277 Rn.53995 64044 35 Casp8ap2 Caspase 8 associated protein 2 Death domain family XM_232860 Rn.54474 313128 36 Casp9 Caspase 9 Caspase family NM_031632 Rn.9052 58918 37 Cflar CASP8 and FADD-like apoptosis regulator Death domain family NM_057138 Rn.32199 117279 38 Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM pathway NM_080400 Rn.28010 140583 39 Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector
A (predicted) CIDE domain family XM_214551 Rn.33267 291541
40 Cideb Cell death-inducing DNA fragmentation factor, alpha subunit-like effector B (predicted)
CIDE domain family XM_344410 Rn.8171 364388
41 Cntnap1 Contactin associated protein 1 Other genes family NM_032061 Rn.91559 84008 42 Cradd CASP2 and RIPK1 domain containing adaptor with death domain
(predicted) Death domain family XM_235061 Rn.88654 314756
43 Dap3 Death associated protein 3 (predicted) Death domain family XM_215627 Rn.85739 295238 44 Dapk2 Similar to Death-associated protein kinase 2 (DAP kinase 2) (DAP-like
kinase) (Dlk) (ZIP-kinase) Death domain family NM_022546 Rn.1566 64391
45 Dffa DNA fragmentation factor, alpha subunit CIDE domain family NM_053679 Rn.60353 114214 46 Dffb DNA fragmentation factor, beta subunit CIDE domain family NM_053362 Rn.48799 84359 47 E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM pathway XM_214476 Rn.67077 291105 48 E2f5 E2F transcription factor 5 p53 and ATM pathway XM_574892 Rn.73967 116651 49 E2f6 E2F transcription factor 6 p53 and ATM pathway XM_233986 Rn.127928 313978 50 Fadd Fas (TNFRSF6)-associated via death domain Death domain family NM_152937 Rn.79506 266610 51 Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM pathway NM_024127 Rn.16183 25112 52 Card9 Caspase recruitment domain protein 9 CARD family NM_022303 Rn.10250 64171 53 Cd40lg Tumor necrosis factor (ligand) superfamily, member 5 (CD40 ligand) TNF ligand family NM_053353 Rn.64486 84349 54 Ltb Lymphotoxin B TNF ligand family NM_212507 Rn.44218 361795 55 Ltbr Lymphotoxin B receptor (predicted) TNFR family NM_001008315 Rn.128906 297604 56 Lyst Lysosomal trafficking regulator Other genes family NM_053518 Rn.19329 85419
141
Position Gene symbol Description Gene family RefSeq UniGene Entrez Gene ID 57 Mcl1 Myeloid cell leukemia sequence 1 Bcl2 family NM_021846 Rn.44274 60430 58 Myd88 Myeloid differentiation primary response gene 88 Death domain family NM_198130 Rn.4067 301059 59 Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR family NM_053401 Rn.37341 117089 60 Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM pathway XM_215497 Rn.3126 294800 61 Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A)
(LOC361381), mRNA p53 and ATM pathway XM_341660 Rn.140834 361381
62 Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM pathway NM_022246 Rn.51136 64012 63 Rad52 Similar to Rad52 protein p53 and ATM pathway NM_001106617 Rn.8154 297561 64 Chek2 Protein kinase Chk2 p53 and ATM pathway NM_053677 Rn.18487 114212 65 Rem2 Rad and gem related GTP binding protein 2 Other genes family NM_022685 Rn.48804 64626 66 Rfng Radical fringe gene homolog (Drosophila) Other genes family NM_021849 Rn.44231 60433 67 Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain family XM_342810 Rn.139983 362491 68 Rrad Ras-related associated with diabetes Other genes family NM_053338 Rn.11189 83521 69 Tank TRAF family member-associated Nf-kappa B activator TRAF family NM_145788 Rn.89906 252961 70 Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene
product Other genes family XM_216791 Rn.34387 299339
71 Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR family XM_341968 Rn.138243 361685 72 Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420),
mRNA TNFR family XM_344431 Rn.105558 364420
73 Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
TNFR family NM_012870 Rn.9792 25341
74 Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR family NM_181086 Rn.105040 302965 75 Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR family NM_013091 Rn.11119 25625 76 Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR family NM_130426 Rn.83633 156767 77 Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR family NM_013049 Rn.48883 25572 78 Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR family NM_019135 Rn.11322 25069 79 Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand family NM_145681 Rn.83627 246775 80 Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand family NM_001001513 Rn.3211 360548 81 Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand family NM_001009623 Rn.19955 287437 82 Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand family NM_145765 Rn.84873 252878 83 CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand family XM_217320 Rn.103013 301132 84 Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand family NM_181384 Rn.46783 353218
142
Position Gene symbol Description Gene family RefSeq UniGene Entrez Gene ID 85 Tnip2 TNFAIP3 interacting protein 2 (predicted) Other genes family NM_001024771 Rn.17607 305451 86 Tp53 Tumor protein p53 p53 and ATM pathway NM_030989 Rn.54443 24842 87 Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) Other genes family XM_215101 Rn.259 360216 88 Tradd TNFRSF1A-associated via death domain TRAF family XM_341671 Rn.18545 246756 89 Traf2 Tnf receptor-associated factor 2 (predicted) TRAF family XM_231032 Rn.105232 311786 90 Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF family XM_220640 Rn.3219 303285 91 Traip TRAF-interacting protein (predicted) TRAF family XM_345981 Rn.8891 367167 92 Uba3 Ubiquitin-activating enzyme E1C Other genes family NM_057205 Rn.2141 117553 93 Uba1 Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other genes family NM_001014080 Rn.11800 314432 94 Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other genes family NM_031001 Rn.114675 79435 95 Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other genes family NM_031237 Rn.2778 81920 96 Ube2i Ubiquitin-conjugating enzyme E2I Other genes family NM_013050 Rn.2274 25573 97 Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other genes family NM_053928 Rn.101834 116725 98 Blank Blank N/A N/A N/A N/A 99 PUC18 PUC18 plasmid DNA N/A L08752 N/A N/A 100 Luc1 Luciferase probe 1 N/A N/A N/A N/A 101 Luc2 Luciferase probe 2 N/A N/A N/A N/A 102 AS1R2 Artificial sequence 1 related 2 (80% identity) (48/60) N/A N/A N/A N/A 103 AS1R1 Artificial sequence 2 related 1 (90% identity) (56/60) N/A N/A N/A N/A 104 AS1 Artificial sequence 1 N/A N/A N/A N/A 105 Rpl32 Ribosomal protein L32 N/A NM_013226 Rn.110966 28298 106 Ldha Lactate dehydrogenase A N/A NM_017025 Rn.107896 24533 107 Aldoa1 Aldolase A N/A NM_012495 Rn.1774 24189 108 Aldoa2 Aldolase A N/A NM_012495 Rn.1774 24189 109 Gapd1 Glyceraldehyde-3-phosphate dehydrogenase N/A NM_017008 Rn.91450 24383 110 Gapd2 Glyceraldehyde-3-phosphate dehydrogenase N/A NM_017008 Rn.91450 24383 111 BAS2C1 Biotinylated artificial sequence 2 complementary sequence N/A N/A N/A N/A 112 BAS2C2 Biotinylated artificial sequence 2 complementary sequence N/A N/A N/A N/A
143
Table 2: Real-Time RT-PCR primers
Gene name Gene symbol
Accession no.
Forward primer sequence (5’ 3’)
Reverse primer sequence (5’ 3’)
Peptidylprolyl isomerase A (Cyclophilin A)
Ppia NM_017101 GTGGTCTTTGGGAAGGTGAA
GTTGTCCACAGTCGGAGATG
RAD52 homolog (S. cerevisiae)
Rad52 XM_216230 CAAACCTCTGTCACCCGAAC
TCCACGAACCTCTGCTACCT
Myeloid cell leukemia sequence 1
Mcl1 NM_021846
TCTTTTGGTGCCTTTGTGG
CCATCCCAGCCTCTTTGTT
Bcl2 modifying factor
Bmf NM_139258 TTGTGGGGTGACAGAGGAA
TATGAAGCCGATGGAACTGG
Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 QuantiTect Primer Assays (Qiagen Inc.) QT00177170
Tumor necrosis factor (ligand) superfamily, member 11 (RANKL)
Tnfsf11 NM_057149 QuantiTect Primer Assays (Qiagen Inc.) QT00195125
Tumor necrosis factor receptor superfamily, member 11a (RANK)
Tnfrsf11a XM_573424 QuantiTect Primer Assays (Qiagen Inc.) QT01689905
144
Table 3: Transcripts up- or down-regulated by at least 1.5 fold at 0.5 and/or 1 day after orchidectomy without testosterone replacement
Common gene name Gene symbol
RefSeq ccession no.
Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Initial Segment Bcl2 Bcl2-modifying factor Bmf NM_139258 0.40934043 0.054239 0.789424 0.167924 1.031204 0.051191 Myeloid cell leukemia sequence 1 Mcl1 NM_021846 0.37085665 0.060043 0.570475 0.11591 0.397362 0.046517 Caspase Caspase 4 Casp4 NM_053736 0.48801043 0.075825 0.690645 0.194611 0.669297 0.194153 Caspase 12 Casp12 NM_130422 0.15114109 0.042499 0.226997 0.086834 0.15187 0.074924 TNFR Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 1.78893458 0.332313 1.142863 0.395951 0.828257 0.206559
Lymphotoxin B receptor Ltbr NM_001008315 0.10107365 0.022974 0.143557 0.064115 0.140888 0.028291 Tumor necrosis factor receptor superfamily, member 26
Tnfrsf26 XM_341968 0.26014051 0.050132 0.167951 0.05687 0.476541 0.086893
TNF ligand Tumor necrosis factor (ligand) supefamily, member 5
Cd40lg NM_053353 0.12102131 0.035183 0.047314 0.012696 0.278893 0.051197
p53 and ATM pathway Rad50 homolog (S. cerevisiae) Rad50 NM_022246 0.32456447 0.020979 0.181667 0.066575 0.518392 0.034832 IAP Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.7717686 0.378798 0.406471 0.088167 0.299685 0.118111 Other related genes Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse
Uba1 XM_234520 3.70594412 0.790705 2.073322 0.58954 2.93136 0.354547
Ubiquitin-conjugating enzyme E2D 2 Ube2d2 NM_031001 1.78672549 0.82728 0.588141 0.164307 0.62278 0.157824 Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)
Ube2n NM_053928 2.54147794 0.394155 1.261239 0.365329 1.141944 0.297575
Caput Bcl2 Myeloid cell leukemia sequence 1 Mcl1 NM_021846 0.321628 0.032479 0.501661 0.097503 0.434955 0.066995
145
Common gene name Gene
symbol RefSeq
ccession no. Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Caput Caspase Caspase 2 Casp2 NM_022522 0.909961 0.1789 1.344735 0.288303 1.289438 0.159017 Caspase 6 Casp6 NM_031775 0.866245 0.20476 1.309098 0.237492 1.301303 0.161052 Caspase 7 Casp7 NM_022260 0.137724 0.049584 0.135561 0.040675 0.20962 0.057518 TNFR Tumor necrosis factor receptor superfamily, member 1a
Tnfrsf1a NM_013091 2.50914 0.42541 4.074626 0.979213 2.995805 0.257133
Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 0.769079 0.125149 1.32231 0.314527 0.738478 0.150291
TNF ligand Tumor necrosis factor (ligand) supefamily, member 5
Cd40lg NM_053353 0.265458 0.047244 0.155737 0.033577 0.133152 0.055813
IAP Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.965077 0.404256 0.322728 0.076115 0.440603 0.120408 CIDE domain Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Cidea XM_214551 1.058603 0.112453 0.7288 0.105002 0.691197 0.112754
DNA fragmentation factor, alpha subunit Dffa NM_053679 0.160563 0.040715 0.103453 0.010754 0.07765 0.006382 Other related genes Contactin associated protein 1 Cntnap1 NM_032061 0.315036 0.100303 0.380396 0.050984 0.570146 0.095345 Ubiquitin-conjugating enzyme E2D 2 Ube2d2 NM_031001 2.282172 0.890252 0.681419 0.124342 0.729433 0.099234 Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)
Ube2n NM_053928 2.555367 0.458624 1.800853 0.397431 1.298846 0.160252
Corpus Bcl2 Bcl2-associated death promoter Bad NM_022698 5.3308382 1.8032903 3.2062952 0.8756033 3.47862088 0.82938844 B-cell leukemia/lymphoma 2 Bcl2 NM_016993 0.9716471 0.1288422 0.5991197 0.0314996 0.63368987 0.07806264 Bcl2-modifying factor Bmf NM_139258 0.0978459 0.0133886 0.1267606 0.0215375 0.21856063 0.07740242 Bcl2/adenovirus E1B 19 kDa-interacting protein 3
Bnip3 NM_053420 5.0056228 1.4611783 3.1709671 0.7874351 3.21834374 0.70533985
Bcl2/adenovirus E1B 19 kDa-interacting protein 3-like
Bnip3l NM_080888 5.3632147 1.7543086 2.991277 0.7986549 3.29487174 0.70413188
146
Common gene name Gene
symbol RefSeq
ccession no. Control
0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Corpus Bcl2 Bcl2-related ovarian killer protein Bok NM_017312 0.5003537 0.049399 0.3230292 0.0829255 0.29939159 0.09808904 TNFR Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 0.7703931 0.2212263 1.2551548 0.1890399 0.80033398 0.15642697
Tumor necrosis factor receptor superfamily, member 12a
Tnfrsf12a NM_181086 0.2624038 0.0547693 0.4036038 0.0551533 0.38967649 0.10625918
TNF ligand Tumor necrosis factor (ligand) supefamily, member 5
Cd40lg NM_053353 0.3284984 0.1143968 0.2058245 0.0868718 0.25778231 0.07277238
Tumor necrosis factor (ligand) supefamily, member 12
Tnfsf12 NM_001001513 3.6955812 0.6973497 2.0042274 0.259968 2.17746348 0.33715339
p53 and ATM pathway Similar to Rad52 protein Rad52 XM_216230 0.4645132 0.0933588 0.5750735 0.0826803 0.96485882 0.24169737 IAP Baculoviral IAP repeat containing 1b Naip2 XM_226742 0.6585121 0.1139367 0.3987811 0.0971684 0.42945071 0.11802074 Inhibitor of apoptosis protein 1 Birc3 NM_023987 0.5038832 0.127144 0.8044672 0.1380889 0.58024889 0.11953076 Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.6319154 0.227017 0.2992543 0.1227835 0.41559259 0.1917546 Death domain Similar to death-associated protein kinase 3 Dlk NM_022546 0.774055 0.1033771 1.0438983 0.0921475 1.33152326 0.11336774 TRAF TNFRSF1A-associated via death domain Tradd XM_341671 3.9400301 0.6654751 2.7907911 0.5632055 2.43985168 0.38720894 TRAF-interacting protein Traip XM_345981 4.6974083 1.2622602 3.0746429 0.6787619 3.8357509 1.05507702 CARD Apoptotic peptidase activating factor 1 Apaf1 NM_023979 1.6521423 0.1147028 1.3388849 0.1689797 1.09864884 0.16728705 CIDE Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A (predicted)
Cidea XM_214551 1.3807691 0.2498749 0.8771426 0.1095429 1.26181598 0.21580838
Other related genes Ubiquitin-conjugating enzyme E2I Ube2i NM_013050 5.2085371 1.4617699 3.3758484 0.9269434 3.08150866 0.63197458
147
Common gene name Gene
symbol RefSeq
ccession no. Control
0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Cauda Bcl2 Bcl2-associated death promoter Bad NM_022698 5.21315366 1.20808695 3.9156339 1.03681733 3.29775994 1.11484272 BCL2/adenovirus E1B 19 kDa-interacting protein 3
Bnip3 NM_053420 4.35857576 0.9159602 3.7752926 0.92499396 2.8460127 0.80051414
Bcl2/adenovirus E1B 19 kDa-interacting protein 3-like
Bnip3l NM_080888 4.9231564 1.10688026 3.96280222 1.07685546 3.1145131 0.90385031
Myeloid cell leukemia sequence 1 Mcl1 NM_021846 0.3195984 0.05000459 0.45736013 0.08336547 0.63172688 0.10782476 Caspase Caspase 6 Casp6 NM_031775 0.72878328 0.14782277 1.04637876 0.08009275 0.87752878 0.1056822 Caspase 12 Casp12 NM_130422 0.07709069 0.01927363 0.04257377 0.00770932 n/d n/d TNFR Tumor necrosis factor receptor superfamily, member 4
Tnfrsf4 NM_013049 0.25862187 0.06699828 0.33339111 0.03732649 0.56268449 0.11219838
Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 0.53216731 0.13778912 1.41210513 0.15755346 1.01937554 0.18914176
Tumor necrosis factor receptor superfamily, member 12a
Tnfrsf12a NM_181086 0.30653683 0.0837452 0.36228225 0.03117065 0.50315919 0.12659097
Nerve growth factor receptor associated protein 1
Ngfrap1 NM_053401 4.6027577 0.95689212 3.70730262 0.85403306 2.82476324 0.56814126
TNF lignad Tumor necrosis factor (ligand) supefamily, member 5
Cd40lg NM_053353 0.14546239 0.03108485 0.25173048 0.06661363 0.32459246 0.04783272
p53 and ATM pathway Rad50 homolog (S. cerevisiae) Rad50 NM_022246 0.19885073 0.03568353 0.27336273 0.0453464 0.34182224 0.05862731 Similar to Rad52 protein Rad52 XM_216230 0.38358991 0.14034804 0.51761002 0.09661152 0.72248745 0.18221105 IAP Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.70780642 0.19942366 0.53386061 0.18267595 0.39679955 0.14592724 Death domain Similar to receptor-interacting protein 2 Ripk2 XM_342810 0.47223832 0.06337911 0.73078114 0.05605016 0.84593964 0.03207672
148
Transcripts up- or down-regulated by at least 1.5 fold are identified in bold; n/d stands for non-detectable
Common gene name Gene symbol
RefSeq ccession no.
Control
0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Cauda TRAF TRAF family member –associated Nf-kappa B activator
Tank NM_145788 0.36958771 0.03997937 0.55466787 0.09456229 0.65841861 0.08775091
TRAF-interacting protein Traip XM_345981 4.69989904 0.96909914 4.71978772 1.8488873 3.32413358 1.06187451 Other related genes Radical fringe gene homolog (Drosophila) Rfng NM_021849 0.14926334 0.03061862 0.22319633 0.01991499 0.38869603 0.05208173 Ras-related associated with diabetes Rrad NM_053338 0.53649085 0.07495119 0.60912473 0.06880419 0.80291418 0.05889224 Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse
Uba1 XM_234520 3.40950014 0.49078175 2.94092978 0.48397088 2.19792514 0.38929124
149
Table 4: Transcripts up- or down-regulated by at least 1.5 fold at 0.5 and/or 1 day after orchidectomy with testosterone replacement
Common gene name Gene
symbol RefSeq
ccession no. Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Initial Segment Bcl2 Bcl2-like 10 Bcl2l10 NM_053733 0.32874248 0.068308 0.382972 0.053767 0.174795 0.059813 Bcl2-modifying factor Bmf NM_139258 0.40934043 0.054239 0.714838 0.125488 0.642543 0.178543 Bcl2-related ovarian killer protein Bok NM_017312 0.426749 0.011513 0.314023 0.033077 0.231021 0.029642 Myeloid cell leukemia sequence 1 Mcl1 NM_021846 0.37085665 0.060043 0.470733 0.116133 0.5543 0.064327 Caspases Caspase 8 Casp8 NM_022277 0.86235821 0.100975 0.613806 0.094203 0.521426 0.098404 TNFR Tumor necrosis factor receptor superfamily, member 11b
Tnfrsf11b NM_012870 1.78893458 0.332313 1.254544 0.436622 1.153427 0.206147
p53 and ATM pathway E2F transcription factor 6 E2f6 XM_233986 0.13430787 0.014984 0.182829 0.054708 0.046384 0.004163 IAP Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.7717686 0.378798 0.453868 0.087976 0.249139 0.093363 TRAF TNF-receptor-associated factor 2 Traf2 XM_231032 0.27788451 0.029784 0.126436 0.041348 0.347265 0.143119 CIDE domain Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Cidea XM_214551 0.82618949 0.119574 0.500751 0.10317 0.6724 0.103812
Other related genes Ubiquitin-conjugating enzyme E2D 2 Ube2d2 NM_031001 1.78672549 0.82728 0.571827 0.144049 0.63545 0.050453 Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)
Ube2n NM_053928 2.54147794 0.394155 1.303364 0.230394 1.562261 0.184123
Caput Bcl2 Bcl2-associated X protein Bax NM_017059 3.261147 0.910384 5.60284132 1.936713184 3.7373389 0.823627 Bcl2-interacting killer-like Bik NM_053704 0.674765 0.156344 0.703170416 0.09399545 0.9020971 0.0895715 Caspase Caspase 11 Casp11 NM_053736 0.471132 0.141405 0.324365968 0.078483832 0.2012063 0.0374507 Caspase 12 Casp12 NM_130422 0.228392 0.101024 0.12429134 0.022921861 0.0453879 0.0191903
150
Common gene name Gene
symbol RefSeq
ccession no. Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Caput TNFR Tumor necrosis factor receptor superfamily, member 1a
Tnfrsf1a NM_013091 2.50914 0.42541 3.77729182 0.413842043 3.3499968 0.5107648
Tumor necrosis factor receptor superfamily, member 1b
Tnfrsf1b NM_013091 0.726376 0.168016 1.08112889 0.14622327 1.0285431 0.0814386
TNF ligand Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA
CD70 XM_217320 0.992105 0.231605 1.45572486 0.447748332 1.056433 0.0271561
Tumor necrosis factor (ligand) supefamily, member 10
Tnfsf10 NM_145681 2.215064 0.403791 3.52851214 0.609029946 3.4290664 0.9023652
IAP Inhibitor of apoptosis protein 1 Birc3 NM_023987 0.680104 0.109772 0.450842432 0.065024514 0.7722568 0.1617907 Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.965077 0.404256 0.222522902 0.045682092 0.3426076 0.1051455 Death effector domain CASP8 and FADD-like apoptosis regulator Cflar NM_057138 0.614871 0.144279 0.51081597 0.127109058 0.386857 0.070083 Similar to death-associated protein kinase 3 Dlk NM_022546 1.124439 0.082425 1.2254541 0.214785644 1.8013025 0.1619393 TRAF TRAF-interacting protein Traip XM_345981 3.981135 1.167827 6.16929032 2.008548637 4.7354594 1.5602951 CIDE domain Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Cidea XM_214551 1.058603 0.112453 0.51320383 0.113172024 0.7163516 0.1330793
Other related genes Contactin associated protein 1 Cntnap1 NM_032061 0.315036 0.100303 0.247506749 0.06009225 0.5247461 0.0619264 Radical fringe gene homolog (Drosophila) Rfng NM_021849 0.13559 0.01668 0.22531383 0.083382485 0.2542247 0.0438113 Ubiquitin-conjugating enzyme E2D 2 Ube2d2 NM_031001 2.282172 0.890252 0.87422604 0.133592443 0.57911 0.0574263 Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)
Ube2n NM_053928 2.555367 0.458624 1.36877858 0.127590711 1.6573192 0.1224044
Corpus Bcl2 BCL2-antagonist/killer 1 Bak1 NM_053812 1.4280128 0.2161611 1.80348332 0.25137763 2.287699 0.5510879 Bcl2-like 2 Bcl2l2 NM_021850 0.1096359 0.0234872 0.29967214 0.12357943 0.2882156 0.1266244 Bcl2-related ovarian killer protein Bok NM_017312 0.5003537 0.049399 0.40033829 0.050869 0.304047 0.0792966
151
Common gene name Gene
symbol RefSeq
ccession no. Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Corpus Caspase Caspase 7 Casp7 NM_022260 0.1502441 0.0303747 0.19072327 0.04898823 0.2931508 0.0530957 Caspase 12 Casp12 NM_130422 0.0924266 0.0424318 0.10695932 0.04284573 0.1801705 0.1005149 TNF ligand Tumor necrosis factor (ligand) supefamily, member 5
Cd40lg NM_053353 0.3284984 0.1143968 0.15973511 0.03887752 0.27547 0.0545888
Tumor necrosis factor (ligand) superfamily, member 15
Tnfsf15 NM_145765 0.3092401 0.0662743 0.36258112 0.04533234 0.1917702 0.0559313
p53 and ATM pathway Similar to E2f3 protein (LOC291105), mRNA E2f3 XM_214476 0.1375977 0.0289928 0.1048704 0.03948196 0.1811454 0.0809456 E2F transcription factor 6 E2f6 XM_233986 0.0978354 0.0203553 0.16431959 0.04088362 0.1685533 0.0367578 Death effector domain CASP8 and FADD-like apoptosis regulator Cflar NM_057138 0.6857112 0.067224 0.64714758 0.10932038 0.4283372 0.063359 CIDE domain Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Cidea XM_214551 1.3807691 0.2498749 0.7238651 0.11842147 0.9442768 0.2052631
DNA fragmentation factor, alpha subunit Dffa NM_053679 0.0885367 0.0177638 0.09880605 0.03442712 0.1737388 0.0557716 Cauda Bcl2 Bcl2-like 1 Bcl2l1 NM_031535 0.1897063 0.06413434 0.21776464 0.02620002 0.292752369 0.10149012 TNFR Tumor necrosis factor receptor superfamily, member 4
Tnfrsf4 NM_013049 0.25862187 0.06699828 0.46926169 0.0642675 0.304896006 0.05207210
Tumor necrosis factor receptor superfamily, member 12a
Tnfrsf12a NM_181086 0.30653683 0.0837452 0.45390488 0.14050504 0.20970613 0.06192642
TNF ligand Tumor necrosis factor (ligand) superfamily, member 5
Cd40lg NM_053353 0.14546239 0.03108485 0.20639962 0.03596576 0.243658534 0.04745598
Tumor necrosis factor (ligand) superfamily, member 9
Tnfsf9 NM_181384 0.40851006 0.0535702 0.60935561 0.04594509 0.459303158 0.04571178
Tumor necrosis factor (ligand) superfamily, member 15
Tnfsf15 NM_145765 0.29663853 0.07108684 0.78500072 0.43939574 0.286680282 0.07449125
152
Common gene name Gene
symbol RefSeq
ccession no. Control 0.5 day 1 day
Normalized data
SEM Normalized data
SEM Normalized data
SEM
Cauda p53 and ATM pathway Rad50 homolog (S. cerevisiae) Rad50 NM_022246 0.19885073 0.03568353 0.34221285 0.0325397 0.306989336 0.03633621 Similar to Rad52 protein Rad52 XM_216230 0.38358991 0.14034804 0.53235596 0.08149214 0.5507258 0.07253780 IAP Baculoviral IAP repeat-containing 5 Birc5 NM_022274 0.70780642 0.19942366 0.41173006 0.10105858 0.314875226 0.10642196 TRAF TNF-receptor-associated factor 2 Traf2 XM_231032 0.26672335 0.05671671 0.45896248 0.07433052 0.328456592 0.06471028 Other related genes Radical fringe gene homolog (Drosophila) Rfng NM_021849 0.14926334 0.03061862 0.2380238 0.05917722 0.179882786 0.03740126 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product
Tnfaip2 XM_216791 0.68077352 0.06653726 1.04698491 0.19870733 0.725659288 0.05318787
Transcripts up- or down-regulated by at least 1.5 fold are identified in bold.
153
Table 5: Identification of putative androgen response elements (AREs) up to 3kb upstream of available promoter sequences for the genes affected by orchidectomy with or without replacement in the epididymis. Sequence: AGAACCnnnTGTTCT
Common gene name Gene symbol
Genbank accession no.
Position (upstream)
Sequence
Bcl2-associated death Bad XM_236275 235 GGAAGGAGCTGGTCT promoter 816 GGCTCCCGCTGCTCC 887 CGATGTCAATGTCCT 1876 ACAAGCCTCGGCTCA 2062 AGCCTCCATCTTTCT 2441 AGACCCCAGGGTCAC 2590 AGACAGCACTGCACA 2619 AGGACCCAGGGCTGT 2777 AGCCCCAAGGGTACT 2873 GACACACACTGGTCC Brain-specific Baiap2 NM_022698 159 ACAGCGCCCTGTCCA angiogenesis inhibitor 193 AGGACCCCTTGTTGC 1-associated protein 2 237 AGAAGCCAGGCCTGT 1059 AGGTTCCTGTGTTCT 1389 TAAACTCAGAGATCT 1593 GGTCCCAACTGTCCT 1658 CCAACCCAATATACA 2019 ACTACCCACATTACC 2101 AGACAGCAGTGTCCC 2235 CAGGCCCACTTTTCC 2348 TGGATTCCCTGTTTT 2460 AGAACCCACGGCTTC 2739 AGCACCCAGTTTGTT 2812 GGAACTCACTCTGTA Bcl2-associated X Bax NM_053812 962 AGTGCCAAATGTAGT protein 1150 AGTATCTAGTGTAAT 1329 CCACCCGACTCTTCT 1436 AGTAGCCATGGCTGT 1695 AAACTCTACTCTTCC 1761 AACACTCAGGGTGCT 1850 AGATCTCTATGTTCC 1999 AAGGCCCAGGGTTCG 2076 AAAACCCAACGCTTA 2275 GGCAGTCACTGTCCC 2364 AATCCCAACTTTTCT 2408 GGGACCTACTTACCT 2446 AGACACTCCTCTTCC 2449 TGTAGACACTCCTCT 2708 ACAACCTGCTCTCTT 2711 CCAACAACCTGCTCT 2750 AGCAGTCAGTGCTCT 2752 AGAGCAGTCAGTGCT 2996 AGTACGCAATATTGG B-cell Bcl2 NM_031328 296 AGATCATGCGGTCCT leukemia/lymphoma 2 456 TGAGGACACAATTCT 800 AAAACGCATTGGCCC 892 ACCACACACAGTGCG 1446 GCCACCCACGGTCCC 1711 TGTACACACTTTACA 1793 ACACTACACTGTTTA 1883 ATAACATAATGTTTT 1942 ACCACTCACTACTGT 2061 ACTCACACCTGTTCT 2064 AGCACTCACACCTGT
154
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
B-cell Bcl2 NM_031328 2404 AGGAAAAACTGTTCC leukemia/lymphoma 2 2447 AGCACTCCCTGAGGT 2654 CGAATGAACAGTTTT 2695 AGCAGTCAGTGCTCT 2697 AGAGCAGTCAGTGCT 2880 AGGCCCACCTGGACT Inhibitor of apoptosis Birc3 XM_226742 242 AGAATCTAGTGTTTA protein 1 398 ATAAAGCACAATTTT 461 TAAACCAAAAGTTTT 935 AGAGAAGACAGTTAT 1247 ACAGCCAGCTCTTCT 1443 AGTAACCCGTGCTCC 1793 AGAAACTTAAGTCCT 1892 GGGAACCTCTAGTCT 2518 AGAAGAACTTGGTCT 2727 TGGTCTCAATGTTTT 2808 AGAAGCCCGTGTCTA 2901 AAAACTGTTTGTTGT B lymphoid kinase Blk NM_022274 104 TGCAGCCACTATTTA (predicted) 118 TAAAACAGCGGTTCT 388 AGAGCGCGGAGTTCT 705 AGAGCCCCTAGTCCC 865 AGAGCCCAGTTTACT 904 GGAACCCCAAGTATT 1203 AGATCTTTCTGGTCC 1212 AGACCTGTCAGATCT 1643 CTCACCCAGTTTTTT 1724 GGAACTCACTGTAAA 1832 AAGCCACACTCTTAT 1834 GGAAGCCACACTCTT 2157 AGGACCCAGAGGTAG 2198 AGATACCAGTGAACA 2403 ATCACCTATTCTTCG 2406 CCAATCACCTATTCT 2411 ATACCCCAATCACCT 2717 GAAGCCCCCTCTTCA Bcl-2 modifying factor Bmf NC_001025751 203 AGCTCCAATTGCGCT 228 GGAACCGAATCCTCA 260 GGGACTCTCTGTCAT 268 AGAACCCAGGGACTC 375 ATCTCCCAGTCTCCT 416 AGCAACTCCTTTTTT 554 GGATCCAAATGTCAT 668 ACAGCCCTCTGATGC 895 ATTCCCCATTCTTCA 898 AAAATTCCCCATTCT 951 AGCTCCCTGCCTTCT 1230 AGGACCCACGTGGCA 1469 AGAGACCACTGAGCC 1485 ACAGCACACTGTAGG 1572 AGAAACCTAAGTAAT 2047 ACAGAGCACAGCTCT 2054 AGCAACCACAGAGCA 2293 CTAAGCTACTGGTCC 2485 AGTGCTTTCTGTTGT 2661 AAACCAATCTGTTCT 2715 AGGAAGAACTGTTTG 2963 AGAAACCAATCTGTT
155
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
BCL2/adenovirus E1B Bnip3 NM_080897 208 CGCGCCCCTTGTTCC 19 kDa-interacting 282 AAAAACAACCGCCCT protein 3 615 ACCACGCATGCTTCT 975 ACACGCCCCTTCTCT 1011 CTGACCCACTGCTGC 1331 AAAACGAAAGGTTCA 1638 AGACCATTCTGTTTC 1837 AGATCTCTGAGTTCG 2147 AGACCCAGCTGGCCT 2486 AGACTCCTGTTTTAT 2806 CCAGCCCAGCGTGCT BCL2/adenovirus E1B Bnip3l NM_053420 176 AGACCCTATAGTCCG 19 kDa-interacting 1085 AGAAGGCAACTTTGT protein 3-like 1242 AGAGCTATCTGATAT 1301 AGGACCTGATTTTCA 1428 AGAATCCACATGTAC 1863 AGTAACCAATGTGCT 1612 AGACCAGACTGTACT 1937 AGAAGACAGTGTTGA 2114 AAAACCCACAGAAGA 2303 AGCCCCTTCTTTTCA 2359 CGAACCCAGGGCCTT 2461 ATAAGACTCTGTTAC 2628 GGAATCCAGTGCCCT 2655 ATAGCCATCTGTGAT Bcl-2-related ovarian Bok NM_080888 283 AGAACCCAAAATGAA killer protein 353 AGAACCTATTGCCGC 531 ACAAACACTGGTTCT 1011 AGAGCTGGTTGTTCT 1110 AGAATCCAGGATCTT 1258 AGAACCCAGACTCTA 1573 TGGACCAGCTGGTCA 1700 CTACCACACTGTTCA 1768 AGAACGGAGTCTAGT 1812 AAATCCCATTGCTTG 1960 AGATCCAATGCTTCT 2046 AACACTGACTGCTCT 2197 GGAACCGCCTCTTCT 2333 AGACCCCTCACTTTA 2405 AGAATAAACTGTCTG 2448 GGAAGCCTTTTTCCT 2691 ACAGCCTGGTGATCT 2749 AAAAAGACCTGTTCT 2793 AGAAACCAGGAGTGT Caspase 6 Casp6 NM_022522 100 GGAAGCCACAGTGGC 496 GGTCATCATTGTTCT 506 ATCACCTACAGGTCA 738 AGCCTGCCCTGTCCT 979 CCAACCCTCTTTACT 1144 ACAACTCACCTATTT 1112 GAAAAGCACGGTTCT 1734 ACAACCCTTTCATCT 1738 AGAAACAACCCTTTC 2367 AGAGCCTGCTGCTCT 2857 GGTAACAACTCTTCT Caspase 7 Casp7 NM_031775 44 AGACGCCCCTTTGCA 954 AGGATCCACATATCC 996 GGAATTCCCAGTTCA 1204 AGAAACAAGTGGGCC 1411 AGCACCTTCTGTGTG 1705 AGACTCCACCTTCTT 1730 GGAACGCAGAGTATT 2116 AGACCACAAACTGCT 2151 TGATGACCCTGTACT 2953 TCCATCCACTGCTCT
156
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
Caspase 8 Casp8 NM_022260 177 GGAACTTCCTGTTTT 323 AAGAACTGCTTTTCT 341 TGTATGCACTTTTCC 402 CCAACAATCCGTTCT 486 AGTGTCCAGTGGTAT 646 AGAACCCTCAGGACC 892 GGAAGGCCCTGCTCA 1033 CGAACCCAGGGCCTT 1111 AGAATTCTTTCTTTT 1548 AAAACACTATGTAAT 1630 AGCAACCATAGTTTT 1647 ACAATCTAATGTCTT 1678 CAAATAGACTGGTCT 1778 GGAGCCCATAGCTTT 1966 TGTACCCAAAGTGTT 2289 AGAGGAAACAGTTTT 2303 GGAAGCAAGTCTTCA 2329 TGAGCTAGCTGTTCT 2720 TATACCCCCTTTCCT 2891 AGGACGAAAGGGTCT 2971 ATAACCATGAGTTCC CASP8 and FADD-like Cflar NM_031632 373 ATCACCGAGTTCTCT apoptosis regulator 692 AGAATCCACAAAGCC 718 CGAGCTCAAGGTCCT 935 AGAATAGACAGTGCT 1195 AGATCAGAGTGGTTT 1235 ATAACTAACAGTTGG 1245 TGAAACCACTATAAC 1480 TTAAAGCACTGTTCT 1827 AGAAGGCACAGTAGG 2021 AGAACTGACCGCGCT 2101 AAAACTGACTATTTT 2163 CGAACCCAGGGCCTT 2214 AAAACTGACTATTTT 2498 GCAACCCAGTGATTT 2532 AAACCACAGGCTTCT 2912 AGGATCCACAGTCTC Contactin associated Cntnap1 XM_344410 2030 ACTCCCACCTGTTCT protein 1 2193 AGAACTCAGACATAT 2339 ATAAATCTCAGCTCT 2511 AGCAGCCACTGACTC 2684 AGAACTCCCAGTTCT DNA fragmentation Dffa NM_022546 125 AGAACCCCCTGTGGT factor, alpha subunit 151 AGAAACTACAACTCC 424 TAAACCCTCTCTTCA 942 TTTACCCACTGAGCT 443 TGTACCCTATTTTCT 952 AGCAAGCACTTTTAC 1320 TGAACTCACAGAGAT 1335 AGACCAGGCTGGCCT 1349 GGAACTCACTCTGCA 1451 GCAACGAACTGTACT 1520 AAAAAACACCGTTAA 1721 GAAAATCAACGTTCT 1953 AGTACTACCTGCTCT 2021 ACGCCCTCCTGTTAT 2067 TTAATCCAATTTGCT 2433 AGAAAGGAGTTTTTT 2471 GGAAAAGATTGATCT
157
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
DNA fragmentation Dffa NM_022546 2506 ATAAAATACTGTTGA factor, alpha subunit 2568 AGGACAAACTTTTTA 2694 AAAACAGACTTGTAT 2798 ACAACCATCTCTAAT 2856 AGCACTGACTGCTCT 2857 GGTAACAACTCTTCT 2924 AGCAATCACAATTCT Growth arrest and 45 Gadd45a NM_152937 156 CGGACCCTTTGTCCT DNA-damage-inducible 230 ATGACCCAATGACCT alpha 409 AAAGCCCTCTGCACC 760 ACACACAAATGTGCT 1016 AGAAGGCAGTGTCAT 1332 ACTGCCCAGTGACCT 1648 GACAGCCAGTGTGCT 1864 CAATCCCAATGTTGG 1903 CTAGGCAACTGCTCT 2036 ATTACACAATGTCCA 2388 GGAACACAGTTTATT 2405 GAATCCCAGAGTTCT 2545 GACACCCACTGTACT 2704 AGATCACGAGGTTTT 2754 ATGTTCCACTAGTCT 2980 AGAGCCTACTTCATT Ras-related associated Rrad XM_342810 75 TGACTCCAGGGTCCT with diabetes 267 ATTCCCCAGTGGTCT 1075 AGACCTAATTTTTCT 1369 TGCACCCCCTGAACC 1991 CGCGCCCAATCTTCA 2194 ACAGCCCACTGAGGT 2291 CTTAGCCACTTTCCT 2325 AGAACCCTGCATCAT 2480 AGAAGTCTCTGATTC 2612 ACACCTCAAGGTTCT 2739 AAGATACACTGTTGA TRAF family member- Tank NM_053338 177 AGTGAAGACTGTTTT associated Nf-kappa B 331 AGAAGTCCCTTCTCA activator 356 AGGAGTAACTGTCCA 642 AAAACCAAATTACCT 988 AGTCCCAAAAGTTGT 1410 AGAAGCCACACATTA 1532 AGATCCAATGTTACT 1609 TGACACAAATGTTCA 1730 TGCACTTACAGTTCC 1799 AGCACTGACTATGCT 2173 AGTAAGGTCTCTTCT 2527 ATTACCCTTTTGTCT 2254 AGTACCTACACTTAT 2977 AGAAGGGGCTGTCCC Tumor necrosis factor Cd40lg NM_022303 2 AGCACTAATTGTGTT (ligand) superfamily, 28 AGAAGACACCATTTC member 5 (CD40 265 AGAAGAAACTCGTTT ligand) 613 AGAGCCCTATGTTTT 820 CGAAGCCACACATCA 1470 AGAACCAATGCTTCT 2185 AGAAACCATTCTAAG 2392 AGACAAGACTGACCT 2464 ATAACTCTCAGGTCT
2621 GGTACCCAGTTTAGT Tumor necrosis factor Tnfsf10 NM_019135 165 ATAACCTCCTCCCCT (ligand) superfamily, 300 TGCTCCAGCAGTTCT member 10 341 AGATCCTGCAGCTTT 358 ATTGCCCTGTGCTCT 489 CTATCCCTCTGTCCA
158
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
Tumor necrosis factor Tnfsf10 NM_019135 1013 AGCACACACTTTAAT (ligand) superfamily, 1777 ACAGGCTACTCTTCA member 10 1986 ATACCCCACAGATAT 2196 AAAAAGGACTTATCT 2520 AGACTCCCCTGTACC 2757 AGTGCCAAGTGTTAG Tumor necrosis factor, Tnfsf15 NM_001009623 675 ATATCCTTCTGTTTC (ligand) superfamily 711 ACAACCAGATATTCT member 15 758 AGAAGCCCATGTCCT 800 ATAAACCACTGGCAT 866 AAAAGCGAGTGTTTA 1048 CGAAGCCAGTCTGGT 1429 CCACCCCTCTTTTAT 1969 GGAATTCACTTTAAT 1986 AAAAGTCACCCTTCC 2313 AGCAACTACAGCACT 2332 AAAATAAAATATTCT 2773 AGCAAGGACTGATAT 2834 ATCCCCAGATGTTCT 2837 AGAATCCCCAGATGT Tumor necrosis factor Tnfsrf1b NM_013091 115 CCCACCCCCTGGTCT receptor superfamily, 1040 AGTGGCTACAGGTCT member 1b 1244 AGAGACCAGAGCTCT 1380 TGGACTCACTGGACA 1888 CGCAATCACTGTGCA 1903 AGTAACTACTGTTTT 2051 AGAAGCTCCTTGGCT 2296 TGAACTCTCTGAGCT 2340 AGCCCTGGCTGTCCT 2750 TGAAACCTGTGTTGG 2997 TGGAGTCACCGTGCT Tumor necrosis factor Tnfsrf4 NM_130426 23 AAACCCCAGACTCCT receptor superfamily, 80 TCCGCCTACTCTTCT member 4 175 AGGCCCCAGTGGCCC 375 AGCACTCATGGTAAT 566 AGCTTGTACTGTTCT 657 AGAACCCAAATTAGG 1102 TGGGACTTCTGTTCT 1147 AGCCCACTCTGACCT 1303 AGAGACCACGTGTCT 1322 CAAGCCACCTGTCCT 1384 GGACAGCAGAGTTCT 1509 GGGACCTGCTGTCCT 1594 GCCAGCTACTGATCT 1773 AGTAGCAGCTGGACT 1941 AGGTCACACTGCTTT 2011 AGAACTCAGAATGAT 2118 GGAACCTACTTCTAT 2265 TTGGGCCAGTGTTCT 2731 AAAAAAACCTGTTTT 2789 AGGCCAGCCTGGTCT Tumor necrosis factor, Tnfsrf11b XM_344431 57 AGGGCCCAGGGTTCC receptor superfamily 159 AGAAATCAGCCATCT member 11b 438 AAACCCCAGACTTCT 648 AGAATTTATTCTTCT 1700 AGACATAAATGTTTT 1846 AGAACTAATTTATGT 1940 ACACCCCACTCTCTC 2101 AGATCTCTGTGAACT 2211 AGATTCAAATATTCT 2332 TGAGTGCAGTGTTCA
159
Common gene name Gene
symbol Genbank
accession no. Position
(upstream) Sequence
Tumor necrosis factor Tnfsrf12a NM_012870 33 GGAGCAGACCGTTCT receptor superfamily, 404 ATAACTCAGTGCTCG member 12a 1302 ACAACCATCTGTAAT 1361 AGAAATGGCTGCTCT 1454 AGCAGACACTCGTAT 1491 GGACCCCAGGGATCG 1662 AGAATTTACTCAACT 2030 ACACAACACTCTTCT 2346 GGAGACCATTCTCCT 2433 GTTACCCTCTGTTCT 2541 AGACCCCAATGCCTT 2697 AAAGCAGATTTTTCT 2861 AAAAACGACAGCTCT 2904 AAACCCCAAGCTTCC Ubiquitin-conjugating Ube2i NM_031237 223 AGACAGCACTGGTGC enzyme E2I 537 AGTAGTGATTGTCCT 568 GGTGCGGACTTTTCT 714 AGAGGCTGCTGGCCT 940 AAATCCCAGTGCTCT 1005 AACACCTATTGCCCT 1142 AGGAACCTCTGGGAT 1423 AGAACACACAGTAAT 1529 ATGAACAGCTGTGCT 1598 AGCCACCTCTGTCTT 1601 ACAAGCCACCTCTGT 1715 AGGAAAAAGTGGTCT 1791 AGGCCAGCCTGGTCT 1867 AGTCCCAGCCTTTCT 2161 TAAACCAGGTATTCT 2441 TGTACACTTTGTGCT 2495 TGGACCCTGTGTTTT 2652 CAAACTGCCTGTCCT 2670 AGCAGCCCCTGTGGC 2882 AGAAGCTAGAGTGCT Ubiquitin-conjugating Ube2n NM_013050 1 GGTCTCCAGTTTTCT enzyme E2N 592 AGAAGCCCCTTTTTA (homologous to yeast 686 AGGCCCCCCCCTTTT UBC13) 955 CGAACCCAGGGCTTT 1047 AAAACACTCTTTGCG 1049 ACAAAACACTCTTTG 1052 AGAACAAAACACTCT 1077 AGACCCCAGCATGCT 1207 CGAACCCAGGGCCTT 1272 AGATCACCCTCCCCT 1680 ATAACCTACAACTTT 1771 ACGATTCATTGCTCT 1914 AGAAGGCACCAGCCT 2081 GGAACTGTGTGTGCT 2223 AGATGCCCCTGTCTC 2349 ACATGGCTCTTTTCT 2368 TAATCTGACTGTTTT 2502 GGGAGCCATTGTTAG 2676 TGGGAACAGTGTTCT 2906 ACAAGACCCGGGTCT 2959 AGAACCGTCTGTAAC
Letters highlighted in grey are conserved from the consensus sequence
(AGAACCnnnTGTTCT) used to complete the analysis. Only sequences with at
least 6 conserved nucleic acids have been kept.
160
Figure 1: Effects of orchidectomy with and without testosterone replacement
on serum testosterone concentration and weights of prostate, empty seminal
vesicles, and epididymis. Rats were orchidectomized with empty (grey bars) or
testosterone-filled implants (black bars) and sacrificed 0.5, 1, 2, 3, or 7 days after
surgery. Serum testosterone concentration (A) was measured by ELISA, whereas
weights of prostate (B), empty seminal vesicles (C), and epididymis (D) were
recorded. Day 0 corresponds to sham-operated animals. Data are presented as
mean ± SEM (n=5-6/group). Significant effects (P<0.05) of treatment on serum
testosterone concentration and tissue weights are depicted by (*), whereas
significant effects (P<0.05) of time on serum concentration and tissue weights are
depicted by (**).
161
Figure 2: Number of transcripts changing in the different regions of the
epididymis after orchidectomy with or without testosterone replacement. The
number of transcripts changing by at least 1.5 fold in either direction (50%
increase or decrease) (vertical axis) was determined for the IS (A), Ca (B), Co
(C), and Cd (D). Fold change was determined at 0.5 and 1d after orchidectomy
without (-T) or with testosterone replacement (+T) (horizontal axis) relative to
sham-operated. The white bars indicate the number of transcripts increasing in
expression (above x-axis), whereas the grey bars indicate transcripts decreasing in
expression (below the x-axis). Each number was obtained independently at each
treatment time relative to sham-operated.
162
Figure 3: Direct relationships between the androgen receptor, testosterone,
and the affected transcripts. Using PathwayStudio, we identified genes that
were known to be directly regulated by testosterone (T) and/or the androgen
receptor (AR) (A). After promoter sequence analysis to uncover putative AREs,
we identified new genes that could be transcriptionally regulated by AR. Genes
that could not be linked either directly or indirectly to AR and/or T were
represented and grouped according to their family (B). Interactions are
expression, regulation or promoter binding; genes with putative AREs are
connected to AR by two-head arrows. Genes known to be regulated by either AR
or testosterone are in pink, genes with putative AREs are in blue, and genes not
known to be regulated by T and/or AR are in yellow. Arrows in T indicate
negative regulation, arrows with (+) sign indicate positive regulation, and simple
arrows indicate regulation.
163
164
Figure 4: Potential pathways through which the androgen receptor and/or
testosterone could regulate gene expression. Using PathwayStudio, we
determined possible pathways through which the androgen receptor (AR) (A)
and/or testosterone (T) (B) could regulate the expression of affected transcripts.
The potential mediators of AR action were not present on the array, but are
present in the epididymis. Interactions are expression, regulation or promoter
binding. Potential mediators are in grey, genes with putative AREs and potentially
indirectly regulated by AR and/or T are in blue, and genes potentially indirectly
regulated by AR and/or T are in purple. Arrows in T indicate negative regulation,
arrows with (+) sign indicate positive regulation, and simple arrows indicate
regulation.
TERT: telomerase reverse transcriptase; KAT5: K(lysine) acetyltransferase 5;
PPARGC1A: peroxisome proliferator-activated receptor gamma, coactivator 1
alpha; KIT: v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog;
CDKN1A: cyclin-dependent kinase inhibitor 1A (p21, Cip); RAF1: v-raf-1
murine leukemia viral oncogene homolog 1; MAPK1: mitogen-activated protein
kinase 1; MYC: v-myc myelocytomatosis viral oncogene homolog (avian);
AKT1: v-akt murine thyoma viral oncogene homolog 1; CREB1: cAMP
responsive element binding protein 1; HIF1A: hypoxia inducible factor 1, alpha
subunit (basic helix-loop-helix transcription factor); MAPK14: mitogen-activated
protein kinase 14; CTNNB1: catenin (cadherin-associated protein), beta 1, 88kDa;
PRKCD: protein kinase C; RPS6KB1: ribosomal protein S6 kinase, 70kDa,
polypeptide 1; ABL1: c-abl oncogene 1, receptor tyrosine kinase; GATA4:
GATA binding protein 4; KRAS: v-Ki-ras 2 Kirsten rat sarcoma viral oncogene
homolog; CEPBA: CCAAT/enhancer binding protein (C/EBP), alpha; RB1:
retinoblastoma 1.
165
166
Figure 5: Potential interactions between growth factors and affected genes.
Using PathwayStudio, we determined the possible regulation by growth factors
and growth factor receptors (EGFR, FGF2, IGF1, IGF1R, VEGFA, VEGFB,
TGFA) (orange) known to be present in the epididymis to transcription of affected
genes. Genes not known to be regulated by testosterone (T) and/or the androgen
receptor (AR) are in yellow, genes known to be directly regulated by T and/or AR
are in pink, genes potentially indirectly regulated by T and/or AR are in purple,
and genes with putative AREs and potentially indirectly regulated by AR and/or T
are in blue.
EGFR: epidermal growth factor receptor; FGF2: basic fibroblast growth factor;
IGF1: insulin-like growth factor 1; IGF1R: insulin-like growth factor 1 receptor;
VEGFA: vascular endothelial growth factor A; VEGFB: vascular endothelial
growth factor B; TGFA: transforming growth factor alpha.
167
168
Figure 6: Roles of BMF, Mcl-1, TNFRSF11B, and Rad52 in the apoptotic,
survival and repair responses. BMF is a pro-apoptotic Bcl-2 family member
that is linked to the actin cytoskeleton. When the cell detaches from the basal
lamina, BMF is released from the cytoskeleton causing anoikis (a form of cell
death associated with detachment from the basal lamina) (55). Mcl-1 is an anti-
apoptotic Bcl-2 family member that sits on the mitochondrial membrane. Upon
death stimuli and/or DNA damage, Mcl-1 inhibits pro-apoptotic proteins leading
to cell survival (44). TNFRSF11B is a soluble TNFR. It binds to TNFSF10,
thereby preventing the activation of TNFRSF10A/B and the caspase cascade (47).
Rad52 is involved in the repair of double-strand breaks after DNA damage.
Failure or success in repairing breaks dictates cell fate (51).
169
Figure 7: Effects of orchidectomy with or without testosterone replacement
on Rad52 expression. Rats were orchidectomized with empty (grey bars) or
testosterone-filled (black bars) implants and sacrificed 0.5 day and 1 day after
surgery. Changes in expression for Rad52 were assayed by Real-Time RT-PCR
for IS (A), Ca (B), Co (C), and Cd (D). Day 0 corresponds to sham-operated
animals (white bars). Rad52 expression was normalized to Ppia (cyclophilin A)
expression. Data are presented as mean ± SEM (n=4-5/group). Significant effects
(p<0.05) of treatment on transcript expression are depicted by (*) and significant
changes as compared to sham-operated are depicted by (**).
170
Figure 8: Effects of orchidectomy with or without testosterone replacement
on Mcl-1 expression. Rats were orchidectomized with empty (grey bars) or
testosterone-filled (black bars) implants and sacrificed 0.5 day and 1 day after
surgery. Changes in expression for Mcl-1 were assayed by Real-Time RT-PCR
for IS (A), Ca (B), Co (C), and Cd (D). Day 0 corresponds to sham-operated
animals (white bars). Mcl-1 expression was normalized to Ppia (cyclophilin A)
expression. Data are presented as mean ± SEM (n=4-5/group). Significant effects
(p<0.05) of treatment on transcript expression are depicted by (*) and significant
changes as compared to sham-operated are depicted by (**).
171
Figure 9: Effects of orchidectomy with or without testosterone replacement
on Bmf expression. Rats were orchidectomized with empty (grey bars) or
testosterone-filled (black bars) implants and sacrificed 0.5 day and 1 day after
surgery. Changes in expression for Bmf were assayed by Real-Time RT-PCR for
IS (A), Ca (B), Co (C), and Cd (D). Day 0 corresponds to sham-operated animals
(white bars). Bmf expression was normalized to PPia (cyclophilin A) expression.
Data are presented as mean ± SEM (n=4-5/group). Significant effects (p<0.05) of
treatment on transcript expression are depicted by (*) and significant changes as
compared to sham-operated are depicted by (**).
172
Figure 10: Identification of Tnfrsf11b in different rat tissues. Presence of
Tnfrsf11b in IS, Ca, Co, Cd, coagulating gland, heart, kidney, liver, dorsal
prostate, lateral prostate, ventral prostate, seminal vesicles, testis, and vas
deferens was assessed quantitatively by Real-Time RT-PCR (A) and qualitatively
by dot blot (B). To confirm equal loading of RNA in the dot blot experiment,
membranes were probed with an 18S probe. Tnfrsf11b expression for the Real-
Time RT_PCR experiment was normalized to Ppia (cyclophilin A) expression.
Data are presented as mean ± SEM (n=3/group). 1: whole epididymis; 2: IS; 3:
Ca; 4: Co; 5: Cd; 6: heart; 7: kidney; 8: ventral prostate; 9: testis; 10: coagulating
gland; 11: dorsal prostate; 12: lateral prostate; 13: seminal vesicles; 14: vas
deferens.
173
Figure 11: Effects of orchidectomy with or without testosterone replacement
on TNFRSF11B transcript and protein expression. Rats were orchidectomized
with empty (grey bars) or testosterone-filled (black bars) implants and sacrificed
0.5 day and 1 day after surgery. Changes in expression for Tnfrsf11b were
assayed by Real-Time RT-PCR for IS (A), Ca (C), Co (E), and Cd (G). Day 0
corresponds to control (white bars). Tnfrsf11b expression was normalized to Ppia
(cyclophilin A) expression. Amounts of TNFRSF11B were quantified and
normalized relative to ACTIN in the IS (B), Ca (D), Co (F), and Cd (H)
epididymides. Data are presented as mean ± SEM (n=4-5/group). Significant
effects (p<0.05) of treatment on expression are depicted by (*) and significant
changes as compared to sham-operated are depicted by (**). (I) are representative
western blots with images for IS, Ca, Co, and Cd. The (+) sign indicates the
positive control.
174
175
Figure 12: Identification of Tnfsf11 and Tnfrsf11a in the different regions of
the epididymis. Expression of Tnfsf11 (A) and Tnfrsf11a (B) in the different
regions of the epididymis was determined by Real-Time RT-PCR using
Quantitect primers. Tnfsf11 and Tnfrsf11a expressions were normalized to Ppia
(cyclophilin A) expression. Data are presented as mean ± SEM (n=4-5/group).
176
Figure 13: Immunolocalization of TNFRSF11B in the different regions of the
epididymis. Epididymides of control animals were fixed by Bouin’s fixation,
stained with an anti-TNFRSF11B antibody, and counterstained with methylene
blue. Principal cells stained only in the cytoplasm in IS (B-C), Ca (D-E), Co (F-
G), and Cd (H-I). (A) shows a slide incubated with only secondary antibody. E:
epithelium; L: lumen; I: interstitium; P: principal cells; arrows indicate clear cells.
The bar represents 2µm.
177
178
179
CONNECTING TEXT
In the previous chapter, orchidectomy with or without testosterone replacement in
the epididymis changed the expression of many apoptotic and cell survival transcripts,
many of which could be regulated by IGF1, an important regulator of cell survival. In
addition, Seenundun and Robaire (Endocrinology 2007 148(1):173-188) had previously
shown that IGF1 was central to the response of the PC-1 mouse epididymal cell line to
androgen withdrawal. The previous chapter also identified BIRC5, a downstream effector
of the IGF1 signaling pathway, as being changed after orchidectomy with or without
testosterone replacement in the epididymis. Therefore, the next chapter will determine the
potential involvement of the IGF1 and BIRC5 survival signaling pathway in the response
of the epididymis to androgen withdrawal.
180
181
CHAPTER 3
Androgen Withdrawal Regulates IGF1 and BIRC5 Expression in the
Rat Epididymis
Sophie-Anne Lamour1, Trang Luu1, Bernard Robaire1,2 1Departments of Pharmacology & Therapeutics and 2Obstetrics & Gynecology
McGill University, QC, Canada
182
1. Abstract
The epididymis is responsible for the proper maturation and storage of
spermatozoa. Despite its dependence on androgens to maintain its functions,
androgen withdrawal by orchidectomy causes little apoptosis. To investigate the
potential involvement of the IGF1 and BIRC5 survival signaling pathway in the
response of the epididymis to androgen withdrawal, we assessed changes in gene
expressions for Igf1, Igf1r, Birc5, Ide, Igfbp3, Bax, Bid, and Diablo within a week
after androgen withdrawal and/or replacement in the epididymis using qRT-PCR.
Changes in protein expression for IGF1, IGF1R, and BIRC5 were also assessed
by ELISA and western blots. We determined that orchidectomy with or without
testosterone (T) replacement increased Igf1 expression in all regions, but
decreased Igf1r in the IS and Cd. We found that orchidectomy increased Birc5
expression, whereas T replacement maintained it at control levels. Orchidectomy
increased Igfbp3 and Bid expressions, but decreased Bax expression, whereas Ide
mRNA was transiently increased. In most regions, T replacement repressed
Igfbp3 and Bax expressions. Diablo showed region-specific changes in expression
after orchidectomy with or without T replacement. Together, these results indicate
that members of the IGF1 signaling pathway participate in the response of the
epididymis to androgen withdrawal.
183
2. Introduction
The epididymis is a long coiled tubule that not only transports
spermatozoa from the efferent ducts of the testis to the vas deferens but also
provides optimal microenvironments for their proper maturation and storage (1).
It is morphologically and functionally divided into four regions: initial segment
(IS), caput (Ca), corpus (Co), and cauda (Cd). At the structural level, it comprises
two compartments, a lumen where spermatozoa bathe and an epithelium
composed of four major cell types (principal, basal, halo, and clear cells) (2;3).
Epididymal functions are regulated by androgens, in particular testosterone (T)
and its more active 5α –reduced metabolite dihydrotestosterone (DHT) (4), as
well as by testicular factors that may include basic fibroblast growth factor
(FGF2) (5) and androgen binding protein (ABP) (6).
Androgen withdrawal by orchidectomy causes a decrease in epididymal
weight due to the loss of spermatozoa and luminal fluid, as well as a decrease in
cell height (7;8); however, it triggers very little apoptosis (9). Despite the
identification of apoptotic and cell survival genes affected in a region-specific
manner in the epididymis after orchidectomy (chapter 2), little is known on the
survival pathways activated after androgen withdrawal. A potential survival
pathway that could be activated after androgen withdrawal is the IGF1 signaling
pathway. We have shown that IGF1/IGF1R could regulate the expression of
apoptotic and cell survival genes after orchidectomy with or without testosterone
replacement (chapter 2). In addition, in the PC-1 mouse epididymal cell line,
genes affected by androgen withdrawal have been directly linked to IGF1 by
pathway analysis suggesting that it is central to the response of the PC-1 cells to
androgen withdrawal (10). Hamzeh and Robaire (11) have also shown that in the
regressed epididymis, IGF1 is a potential regulator of the expression of many
affected genes.
IGF1/IGF1R promote cell survival through the activation of the
phosphatidylinositol 3-kinase (PI3K)/Akt pathway and the inhibition of pro-
apoptotic proteins such as BAX and BID (12;13). IGF1 bioavailability is
regulated by IGF binding proteins (IGFBPs). The most abundant one, IGFBP3
184
forms a ternary complex with IGF1 and the acid-labile subunit (ALS) that
prolongs IGF1 half-life and prevents it from reaching its receptor (13). Once
internalized, IGF1 is degraded by the insulin-degrading enzyme (IDE) leading to
signal termination (14). Activation of IGF1R and the PI3K signaling cascade
leads to increased androgen receptor (AR) expression (15). In addition, interaction
between IDE and AR enhances AR DNA binding (16;17). On the other hand, AR
regulates IGF1, IGF1R (18), and IGFBP3 (19) expression. IGF1 can promote
survival in an AR-independent manner by increasing BIRC5 expression (20).
BIRC5, an inhibitor of apoptosis protein (IAP), is known to be highly expressed
in cancers, but not in terminally-differentiated tissues (21). However, we have
identified Birc5 as being expressed in the epididymis, a terminally-differentiated
tissue (chapter 2). BIRC5 activity is inhibited by the binding of second
mitochondria-derived activator of caspase/direct IAP binding protein with low pI
(Smac/Diablo); its release from mitochondria is regulated by BID (22;23).
The objective of this study was to determine the involvement of members
of the IGF1 signaling pathway in the response of the epididymis to androgen
withdrawal. We assessed changes in expression for Igf1, Igf1r, Birc5, Ide, Igfbp3,
Bax, Bid, and Diablo during a week after orchidectomy with or without T
replacement using qRT-PCR.
3. Materials and Methods
3.1. Chemicals
T (4-Androsten-17β-ol-3-one) was purchased from Steraloids Inc.
(Newport, RI). Bovine serum albumin (Fraction V) (BSA) was bought from
Sigma-Aldrich Canada Ltd. (Oakville, ON). Normal saline (0.9% w/v NaCl in
water) was bought from Roche Applied Science (Laval, QC), whereas sodium
azide was bought from Thermo Fisher Scientific (Waltham, MA). Medical
adhesive (Silicone type A, cat. no. 891) and tubing (cat. no. 602-305) to make the
polydimethylsiloxane (Silastic) implants were purchased from Dow Corning
Silicones (Midland, MI). NP-40 substitute and sodium deoxycholate/DOC were
bought from Sigma-Aldrich Canada Ltd., whereas NaCl, SDS, and TRIS were
185
bought from Invitrogen Canada Inc. (Burlington, ON). Bestatin, PMSF, leupeptin,
and aprotinin were bought from Roche Applied Science (Laval, QC). Ketamine
was bought from Bioniche (Belleville, ON), acepromazine from Wyeth-Ayerst
(St-Laurent, QC), xylazine from Novopharm (Montreal, QC), and buprenorphine
from Reckitt & Cloman (Bristol, UK). All cell culture reagents were purchased
from Wisent Inc. (St-Brunon, QC).
3.2. Animals
Adult male Brown Norway (BN) rats (3-4 months old) were obtained from
Charles River Canada (St-Constant, QC) and housed at the McIntyre Animal
Resources Centre of McGill University. Rats (3 per cage) were kept under
controlled light (14-h light, 10-h dark) and temperature (22°C) and had access to
regular rat chow and water ad libitum. All animal studies were conducted in
accordance with the principles and procedures outlined in the Guide to the Care
and use of Experimental Animals prepared by the Canadian Council on Animal
Care (Animal Use Protocol no. 206).
Rats were separated into 11 groups (n=5/group): sham-operated;
orchidectomized and implanted sc. with an empty 2.5-cm Silastic capsule (-T
groups) and sacrificed at 0.5, 1, 3 or 7 days after surgery; or orchidectomized and
implanted sc. with a T-filled 2.5-cm Silastic capsule (+T groups) and sacrificed at
0.5, 1, 3 or 7 days after surgery. Rats were anaesthetized by an intramuscular
injection of ketamine, xylazine, and atravet (5:2.5:1) in normal saline (0.1ml/100g
body weight) and received buprenorphine (0.001mg/100g body weight) after
surgery. Bilateral orchidectomy was done as described elsewhere (24) and
capsules were implanted sc. at the time of surgery. Implants were made according
to the method of Stratton et al. (25) and had a T release rate of 30µg/cm/day,
releasing T to an equivalent amount to serum T. To ensure a steady rate of T
release, implants were bathed for 2 days prior to surgery in a solution of normal
saline containing 1% BSA and 0.1% sodium azide. At the time of death,
epididymides were collected, separated into IS, Ca, Co, and Cd regions, frozen in
liquid nitrogen and kept at -80°C.
186
3.3. RNA extraction
RNA was isolated from the IS, Ca, Co and Cd of all treatment groups
using Qiagen Mini-prep (Qiagen Inc., Mississauga, ON) following manufacturer’s
instructions. DNase treatment was done using the RNase-free DNase set (Qiagen
Inc.) following the manufacturer’s instructions. Concentration and quality of
RNA were verified with a nanodrop 2000 spectrophotometer (Thermo Scientific
Scientific). Each RNA sample was extracted from a single epididymal region
from an individual rat; no samples were pooled.
3.4. Quantitative Real-Time RT-PCR
Real-Time RT-PCR was done to quantify expression of Igf1, Igf1r, Birc5,
Igfbp3, Bax, Bid, and Diablo (Table 1) using the QuantiTect RT-PCR SybrGreen
kit (Qiagen Inc.) and the LightCycler system (Roche Applied Science) as
described elsewhere (10). Each sample was assayed in duplicate. Gene
expressions were normalized against peptidylprolyl isomerase A (Ppia,
cyclophilin A) expression. Ppia is a housekeeping gene, its mRNA expression is
not affected by androgen manipulation (26). Gene-specific primers were designed
using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/),
except when primers were ordered from Qiagen Inc. The primers were
synthesized by AlphaDNA (www.alphadna.com, Montreal, QC).
3.5. Western blot analysis
Whole cell extracts (n=5/group) were prepared in RIPA buffer (150mM
NaCl, 1% NP-40 substitute, 0.5% sodium deoxycholate/DOC, 0.1% SDS, 50mM
TRIS pH 7.4). For each ml of RIPA buffer, the following proteinase inhibitors
were added: 4µl bestatin (10mg/ml), 1µl PMSF (24mg/ml), 2µl leupeptin
(5mg/ml), and 3µl aprotinin (2mg/ml). Protein concentrations were determined by
the Bradford method using the Bio-Rad protein assay (Bio-Rad Laboratories,
Mississauga, ON) following the manufacturer’s protocol. For each sample, 20μg
protein per lane was separated on an 8% or 15% acrylamide SDS-PAGE gel to
determine changes in protein expression for IGF1R and BIRC5, respectively.
187
Prestained All Blue Precision Plus Protein Standards (Bio-Rad Laboratories) were
used as molecular weight markers. Separated proteins were transferred to a PVDF
Hybond-P membrane (GE Healthcare, Baie d’Urfe, QC). Blots were blocked in
5% non-fat dried milk in TBS-T (137 mM NaCl, 20 mM Tris, 0.5% Tween 20,
pH 7.6) for 1h at room temperature and then incubated overnight at 4°C with a
primary rabbit antibody against human BIRC5 (1:500, #2808, Cell Signaling
Technology, Danvers, MA) or IGF1R (1: 1000, #3018, Cell Signaling
Technology). Membranes were then probed with a donkey anti-rabbit IgG
horseradish peroxidase linked whole antibody (1:2 000, NA934V, GE
Healthcare). Constant loading was assessed by probing the membranes with a
primary goat antibody against ACTIN (1:10 000, sc-1616, Santa Cruz
Biotechnology, Santa Cruz, CA) and detecting it with a donkey anti-goat IgG
horseradish peroxidase conjugated antibody (1:5 000, sc-2056, Santa Cruz
Biotechnology). Signals were detected with the Enhanced Chemiluminescence
Plus kit (GE Healthcare) and visualized on Hyperfilm enhanced
chemiluminescence (GE Healthcare). Quantification of western blot data was
done by densitometry analysis using a Chemilmager 4000 imaging system (Cell
Biosciences, Santa Clara, CA) with AlphaEase (version 5.5 software, Cell
Biosciences). The expression of IGF1R and BIRC5 was expressed relative to the
corresponding expression of ACTIN for all groups.
3.6. IGF1 ELISA
Quantification of IGF1 expression in the epididymis (n=5/group) was
done using the mouse IGF1 quantikine immunoassay (MG100, R&D Systems
Inc., Minneapolis, MN) following the manufacturer’s instructions. The minimum
detectable dose was 3.5pg/ml. Intra-assay CV was 4.3% and inter-assay CV was
6%.
3.7. Statistical analysis
Significant differences between treatment groups within each epididymal
region were assessed by two-way ANOVA followed by the Holm-Sidak post-hoc
188
test. When the normality test failed, data were transformed by the square root or
log methods and analyzed as previously described. When the two-way ANOVA
could not identify in which treatment group there was a significant difference, two
one-way ANOVAs were done followed by the Dunnett’s post hoc test. In those
cases, comparisons between the (-T) and (+T) groups were done by multiple t-test
with Bonferroni correction. Significance was set at p<0.05.
4. Results
4.1. Effects of orchidectomy with or without testosterone replacement on Igf1
and Igf1r expression
In order to determine if the IGF1 signaling pathway could play a role in
the response of the epididymis to orchidectomy with or without T replacement,
we assessed changes in Igf1 (fig. 1) and Igf1r (fig. 2) mRNA expression.
In all regions, androgen withdrawal triggered an increase in Igf1
expression at 3 and 7 days (fig. 1A-D); in the distal regions, we observed a
significant (p<0.05) decrease at 1 day after orchidectomy (fig. 1C-D). T
replacement also caused a significant (p<0.05) increase in Igf1 expression at 3 and
7 days in all regions. T replacement significantly (p<0.05) increased Igf1
expression as compared to (-T) group in the IS at 3 and 7 days (fig. 1A), as well
as at 1 day in the distal regions (fig. 1C-D). After androgen withdrawal, Igf1r
expression was decreased in all regions, except at 7 days in the IS and at 1 day in
the Ca where it was increased. T replacement was not able to prevent the decrease
in Igf1r expression in the IS (fig. 2A) and Cd (fig. 2D). In the Ca, T replacement
significantly (p<0.05) increased Igf1r mRNA at all time points except at 7 days
(fig. 2B). The Cd was the only region to show significant (p<0.05) decrease in
Igf1r mRNA at all time points and treatments (fig. 2D). T replacement
significantly (p<0.05) increased Ig1r expression in the Ca and Co, but decreased
its expression in the IS and Cd as compared to (-T) group. Together, the data
suggested that IGF1/IGF1R could play a role in the response of the epididymis to
androgen withdrawal.
189
4.2. Effects of orchidectomy with or without testosterone replacement on
upstream regulators of IGF1 signaling
We assessed the effects of orchidectomy with or without testosterone
replacement on two genes known to regulate IGF1 signaling, Ide (fig. 3) and
Igfbp3 (fig. 4). After androgen withdrawal, Ide mRNA expression was
significantly (p<0.05) increased in all regions as early as 0.5 day after
orchidectomy. In the distal regions, this increase was followed by a significant
(p<0.05) decrease from 1 day on (fig. 3C-D). T replacement could not prevent the
significant increase (p<0.05) at 0.5 and 1 day in the proximal regions (fig. 3A-B)
or the significant (p<0.05) decrease at 3 and 7 days in the distal regions (fig. 3C-
D). However, in the IS and Co, T replacement significantly (p<0.05) decreased
Ide expression at 0.5 day. For Igfbp3, androgen withdrawal caused a significant
(p<0.05) increase in expression all time points in the IS (fig. 4A) and Cd (fig.
3D). In the Ca (fig. 3B) and Co (fig. 3C), Igfbp3 was only increased at 7 days
after orchidectomy. T replacement prevented the increase in Igfbp3 mRNA
expression in all regions. In fact, in all regions, T replacement significantly
(p<0.05) repressed Igfbp3 expression as compared to (-T) group from 1 day
onward. This suggested that IDE and IGFBP3 could be involved in regulating
IGF1 signaling after androgen withdrawal.
4.3. Effects of orchidectomy with or without testosterone replacement on
Birc5 and Diablo expression
We determined the effects of orchidectomy with or without testosterone
replacement on Birc5 (fig. 5) and Diablo (fig. 7) mRNA expression in the
different regions of the epididymis (fig. 5); DIABLO is a known regulator of
BIRC5 activity. After androgen withdrawal, Birc5 mRNA was significantly
(p<0.05) increased from 1 day on in the proximal regions (fig. 5A-B). In the distal
regions, Birc5 mRNA was increased at 3 day after orchidectomy (fig. 5C-D). T
replacement prevented the increase in Birc5 expression in all regions, except Co
at 3 days (fig. 5C). This suggested that Birc5 could be transcriptionally-regulated
by androgens. In fact, we found 5 putative androgen-response elements (AREs) in
190
the upstream promoter region of Birc5 (fig. 6). In the proximal regions, androgen
withdrawal caused a significant (p<0.05) increase in Diablo expression at 0.5 day
followed by a decrease in expression at 3 days and a significant (p<0.05) increase
at 7 days (fig. 7A-B). In the distal regions, androgen withdrawal caused a
decrease in Diablo expression (fig. 7C-D). T replacement could not prevent the
increased expression in the proximal regions and the decreased expression in the
distal regions.
4.4. Effects of orchidectomy with or without testosterone replacement on
downstream signaling molecules
We determined the effects of orchidectomy with or without testosterone
replacement on Bax (fig. 8) and Bid (fig. 9) expression, two pro-apoptotic Bcl2
genes targeted by the IGF1 signaling cascade. After androgen withdrawal, in the
IS, Bax was significantly (p<0.05) decreased from 1 day onward (fig. 8A). In the
Co, Bax mRNA was first significantly (p<0.05) increased at 1 day and then
decreased at 3 and 7 days (fig. 8C). T replacement could not prevent the decrease
in Bax expression in the IS (fig. 8A). In the Ca, T replacement could not prevent
the decrease in Bax expression at 0.5 day, but significantly (p<0.05) increased its
expression at 1 and 3 days (fig. 8B). In all regions, except Co at 0.5 and 1 day, T
replacement significantly repressed Bax expression as compared to the (-T) group.
For Bid, androgen withdrawal significantly (p<0.05) increased its expression in
all regions at 3 and 7 days (fig. 9). In the Cd, increased expression was preceded
by a significant (p<0.05) decrease at 0.5 and 1 day (fig. 9D). T replacement could
not prevent the increase in Bid expression in all regions, except Cd at 1 and 3
days. In all regions, T replacement significantly (p<0.05) repressed Bid mRNA
expression as compared to the (-T) group at 3 and 7 days (fig. 9).
191
4.5. Effects of orchidectomy with or without testosterone replacement on
IGF1, IGF1R, and BIRC5 expression
As IGF1 (fig. 10), IGF1R (fig. 11), and BIRC5 (fig. 12) are the main
effectors in the IGF1 signaling pathway, we determined changes in protein
expression after androgen withdrawal and/or replacement in the epididymis.
At the protein level, IGF1 expression increased significantly (p<0.05) at 3
days after orchidectomy without T replacement in the proximal regions and this
increase was prevented by T replacement (fig. 10A-B). However, there were no
significant changes in IGF1R expression after androgen withdrawal and/or
replacement (fig. 11). For BIRC5 orchidectomy significantly (p<0.05) decreased
its expression in the proximal regions (fig. 12A-B). In the IS, this decrease was
observed as early as 1 day and reached a low at 7 days where BIRC5 could not be
detected (fig. 12A). In the Ca, the decrease was observed from 3 days onward
(fig. 12B). T replacement prevented the decreased expression in the Ca, but not in
the IS, except at 7 days (fig. 12A-B). This suggested that BIRC5 could be post-
transcriptionally regulated.
5. Discussion
The epididymis expresses many growth factors, in particular IGF1, which
has been postulated to play important roles in the tissue (27). In fact, IGF1 null
mice have an under-developed distal epididymis, suggesting that IGF1 is
important for the development of this tissue (28). However, little is known on the
exact role of the IGF1 signaling pathway in the epididymis and on its involvement
in the response of the epididymis to androgen withdrawal.
When we assessed the effects of orchidectomy with or without T
replacement on the expression of Igf1, Igf1r, Igfbp3, Ide, Birc5, Bax, Bid, and
Diablo, we observed a bi-phasic response: an early response at 0.5 day and 1 day
and a late response at 3 and 7 days; this response could be associated with the
removal of luminal content. In fact, it takes 1 day for the IS to be emptied of
luminal content after orchidectomy, whereas by 7 days all regions except Cd are
emptied (29).
192
After orchidectomy with or without T replacement, Igf1 mRNA did not
change during the early response, but increased in the late response. On the other
hand, Igf1r mRNA decreased in the early and late responses. The opposite
direction in transcriptional regulation of Igf1 and Igf1r suggests compensatory
mechanisms to maintain the balance between the ligand and the receptor. The
only exception to this pattern is the Ca, where Igf1 increased over time as in the
other regions, but Igf1r also increased. This suggests that the Ca is differentially
regulated by IGF1/IGF1R compared to the other regions. In the early response,
Ide mRNA first increased and then decreased in the late response. The lack of
correlation between Ide and Igf1 mRNA in the early response suggests that IDE
may play another role than regulating IGF1 expression. In fact, interaction
between IDE and AR leads to increased AR DNA binding (16;17). It is tempting
to speculate that during the early response after androgen withdrawal, IDE
expression increases to enhance AR DNA binding in the absence of androgens.
After androgen withdrawal, Igfbp3 mRNA increased over time paralleling the
increase in Igf1 mRNA, whereas with T replacement, Igfbp3 remained around
control levels even when Igf1 increased. This suggests that when high levels of
IGF1 are required such as after androgen withdrawal, IGFBP3 may stabilize IGF1
levels enabling IGF1 to act more efficiently (13) (fig. 13).
Orchidectomy triggered over time an increase in Birc5 mRNA in all
regions that was accompanied by an early increase in Diablo mRNA in the
proximal regions and a decreased expression in the distal regions. With T
replacement, Birc5 mRNA remained around control levels in all regions except
Co, whereas Diablo showed again an increased expression in the proximal regions
and a decreased expression in the distal regions. As DIABLO negatively regulates
BIRC5 activity (22), we can assume that Diablo transcription is negatively
regulated to allow BIRC5 activity (fig. 14).
After an apoptotic stimulus, BID is cleaved to tBID and migrates to the
mitochondrial membrane. Once there, tBID activates BAX leading to cytochrome
c release and apoptosis (30). After orchidectomy with or without T replacement,
as Bid expression increased, Bax expression decreased, which indicated a negative
193
correlation between Bid and Bax levels. This suggests a compensatory mechanism
where two genes involved in the same pathway are inversely regulated, therefore
preventing inappropriate activation (fig. 15).
After orchidectomy with or without testosterone replacement, Igf1 and
Igf1r mRNA expressions were changed, but not their protein expression. This
finding suggests two possibilities: (i) although Igf1 and Igf1r respond at the
transcriptional level to orchidectomy with or without T replacement, they are not
involved in the response of the epididymis to androgen withdrawal; and (ii) there
are post-transcriptional regulatory mechanisms that regulate translation. The
second option seems more probable because of the stability of IGF1 and IGF1R
proteins. IGF1 can exist in three ways: in a ternary complex with IGFBP3 and
ALS, in a binary complex with IGFBP3, or alone. This association within a
complex affects IGF1 half-life such that IGF1 half-life is 10-16hrs in the ternary
complex, 30-60min in the binary complex, and 10min alone (31); these half-lives
are only relevant in vivo because in vitro, IGF1 is only degraded by 5% in 8hrs
(31). The ternary complex is restricted to the circulation, whereas the binary
complex can freely enter tissues, hence IGF1 half-life in the epididymis could
vary from 10min to 60min (32). This rapid turnover of IGF1 in a control situation
could explain why even under stress condition, we could not detect an increase in
IGF1 production. On the other hand, IGF1R has a half-life of 22hrs, making it a
very stable protein and hence less sensitive to changes in protein expression (33).
After orchidectomy, as Birc5 mRNA increased, BIRC5 protein expression
decreased in the proximal regions. With T replacement, both Birc5 mRNA and
BIRC5 remained around control levels in the Ca, while BIRC5 was still decreased
in the IS. The IS and Ca are the two most sensitive regions of the epididymis to
orchidectomy (9); the decreased expression of BIRC5 parallels the increased
sensitivity of these two regions to orchidectomy. The IS also requires testicular
factors to maintain its functions (9;34), which could explain why BIRC5
expression was not back to control levels after T replacement. Furthermore,
BIRC5 expression is regulated by the ubiquitin-proteasome pathway causing a
rapid turnover of BIRC5 with a half-life of 30min (35). We can speculate that in
194
the most sensitive regions, the ubiquitin-proteasome pathway would be more
active leading to decreased expression of BIRC5 protein.
We have shown that members of the IGF1 and BIRC5 signaling pathway
are modulated differently after orchidectomy with or without testosterone
replacement with respect to time, region of the epididymis, and individual
components of the pathway; this could lead to a fine-tuned response of the
epididymis. This study gives insights into the potential involvement of the IGF1
and BIRC5 signaling pathway in the survival response of the epididymis to
androgen withdrawal.
6. Acknowledgements
We would like to thank Dr. Eddy Rijntjes for his help with the IGF1 ELISA
assays.
195
References
1. Robaire B, Hinton BT, Orgebin-Crist MC 2006 The Epididymis. In:
Jimmy D.Neill, ed. Knobil and Neill's Physiology of Reproduction. Third
Edition ed. Elsevier; 1071-1148
2. Robaire B, Hermo L 1988 Efferent Ducts, Epididymis, and Vas Deferens:
Structure, Functions, and Their Regulation. In: E.Knobil and J.Neill et al.,
ed. The Physiology of Reproduction. Raven Press, Ltd.; 999-1080
3. Reid B, Clewland K 1957 The structure and function of the epididymis. 1.
The histology of the rat epididymis. Aust J Zool223-246
4. Orgebin-Crist MC, Tichenor PL 1973 Effect of testosterone on sperm
maturation in vitro. Nature 245:328-329
5. Lan ZJ, Labus JC, Hinton BT 1998 Regulation of gamma-glutamyl
transpeptidase catalytic activity and protein level in the initial segment of
the rat epididymis by testicular factors: role of basic fibroblast growth
factor. Biol Reprod 58:197-206
6. Robaire B, Zirkin BR 1981 Hypophysectomy and simultaneous
testosterone replacement: effects on male rat reproductive tract and
epididymal delta 4-5 alpha-reductase and 3 alpha-hydroxysteroid
dehydrogenase. Endocrinology 109:1225-1233
7. Delongeas JL, Gelly JL, Leheup B, Grignon G 1987 Influence of
testicular secretions on differentiation in the rat epididymis: ultrastructural
studies after castration, efferent duct ligation and cryptorchidism. Exp Cell
Biol 55:74-82
8. Moore HD, Bedford JM 1979 Short-term effects of androgen withdrawal
on the structure of different epithelial cells in the rat epididymis. Anat Rec
193:293-311
196
9. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
10. Seenundun S, Robaire B 2007 Time-dependent rescue of gene expression
by androgens in the mouse proximal caput epididymidis-1 cell line after
androgen withdrawal. Endocrinology 148:173-188
11. Hamzeh M, Robaire B 2010 Identification of early response genes and
pathways activated by androgens in the initial segment and caput regions of
the regressed rat epididymis. Endocrinology 151:4504-4514
12. Gennigens C, Menetrier-Caux C, Droz JP 2006 Insulin-Like Growth
Factor (IGF) family and prostate cancer. Crit Rev Oncol Hematol 58:124-
145
13. Butt AJ, Firth SM, Baxter RC 1999 The IGF axis and programmed cell
death. Immunol Cell Biol 77:256-262
14. Authier F, Posner BI, Bergeron JJ 1996 Insulin-degrading enzyme. Clin
Invest Med 19:149-160
15. Manin M, Baron S, Goossens K, Beaudin C, Jean C, Veyssiere G,
Verhoeven G, Morel L 2002 Androgen receptor expression is regulated by
the phosphoinositide 3-kinase/Akt pathway in normal and tumoral epithelial
cells. Biochem J 366(Pt 3):729-736
16. Kupfer SR, Marschke KB, Wilson EM, French FS 1993 Receptor
accessory factor enhances specific DNA binding of androgen and
glucocorticoid receptors. J Biol Chem 268:17519-17527
17. Kupfer SR, Wilson EM, French FS 1994 Androgen and glucocorticoid
receptors interact with insulin degrading enzyme. J Biol Chem 269:20622-
20628
197
18. Wu Y, Zhao W, Zhao J, Pan J, Wu Q, Zhang Y, Bauman WA, Cardozo
CP 2007 Identification of androgen response elements in the insulin-like
growth factor 1 upstream promoter. Endocrinology 148:2984-2993
19. Peng L, Malloy PJ, Wang J, Feldman D 2006 Growth inhibitory
concentrations of androgens up-regulate insulin-like growth factor binding
protein-3 expression via an androgen response element in LNCaP human
prostate cancer cells. Endocrinology 147:4599-4607
20. Zhang M, Latham DE, Delaney MA, Chakravarti A 2005 Survivin
mediates resistance to antiandrogen therapy in prostate cancer. Oncogene
24:2474-2482
21. Ambrosini G, Adida C, Altieri DC 1997 A novel anti-apoptosis gene,
survivin, expressed in cancer and lymphoma. Nat Med 3:917-921
22. Verhagen AM, Vaux DL 2002 Cell death regulation by the mammalian
IAP antagonist Diablo/Smac. Apoptosis 7:163-166
23. Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, Schlesinger PH
2000 Pro-apoptotic cascade activates BID, which oligomerizes BAK or
BAX into pores that result in the release of cytochrome c. Cell Death Differ
7:1166-1173
24. Ezer N, Robaire B 2003 Gene expression is differentially regulated in the
epididymis after orchidectomy. Endocrinology 144:975-988
25. Stratton IG, Ewing LL, Desjardins C 1973 Efficacy of testosterone-filled
polydimethylsiloxane implants in maintaining plasma testosterone in
rabbits. J Reprod Fertil 35:235-244
26. Palladino MA, Hinton BT 1994 Expression of multiple gamma-glutamyl
transpeptidase messenger ribonucleic acid transcripts in the adult rat
epididymis is differentially regulated by androgens and testicular factors in a
region-specific manner. Endocrinology 135:1146-1156
198
27. Tomsig JL, Turner TT 2006 Growth Factors and the Epididymis. Journal
of Andrology 27:348-357
28. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellve AR, Efstratiadis
A 1996 Effects of an Igf1 gene null mutation on mouse reproduction. Mol
Endocrinol 10:903-918
29. Turner TT 1991 Spermatozoa are exposed to a complex microenvironment
as they traverse the epididymis. In: Robaire B, ed. The male germ cell -
Spermatogonium to fertilization. New York: Annals of the New York
Academy of Sciences; 364-383
30. Billen LP, Shamas-Din A, Andrews DW 2008 Bid: a Bax-like BH3
protein. Oncogene 27:S93-S104
31. Yakar S, Rosen CJ, Beamer WG, Ackert-Bicknell CL, Wu Y, Liu JL,
Ooi GT, Setser J, Frystyk J, Boisclair YR, LeRoith D 2002 Circulating
levels of IGF-1 directly regulate bone growth and density. J Clin Invest
110:771-781
32. Boisclair YR, Rhoads RP, Ueki I, Wang J, Ooi GT 2001 The acid-labile
subunit (ALS) of the 150kDa IGF-binding protein complex: an important
but forgotten component of the circulating IGF system. J Endocrinol
170:63-70
33. Riedemann J, Takiguchi M, Sohail M, Macaulay VM 2007 The EGF
receptor interacts with the type 1 IGF receptor and regulates its stability.
Biochem Biophys Res Commun 355:707-714
199
34. Fawcett DW, Hoffer AP 1979 Failure of exogenous androgen to prevent
regression of the initial segments of the rat epididymis after efferent duct
ligation or orchidectomy. Biol Reprod 20:162-181
35. Zhao J, Tenev T, Martins LM, Downward J, Lemoine NR 2000 The
ubiquitin-proteasome pathway regulates survivin degradation in a cell cycle-
dependent manner. Journal of Cell Science 113:4363-4371
200
Table 1: Real-Time RT-PCR primers
Gene name Gene symbol
Genbank accession
no.
Forward primer sequence (5’ 3’)
Reverse primer sequence (5’ 3’)
Peptidylprolyl isomerase A (Cyclophilin A)
Ppia NM_017101 GTGGTCTTTGGGAAGGTGAA
GTTGTCCACAGTCGGAGATG
Baculoviral IAP repeat-containing 5
Birc5 NM_022274 ACCACCGGATCTACACCTTC
TCCCAGCCTTCCAGTTCCTT
Insulin-like growth factor 1
Igf1 NM_178866 TGTGGATGAGTGTTGCTTCC
CGTGGCATTTTCTGTTCCTC
Insulin-like growth factor 1 receptor
Igf1r NM_052807 GAATGGAGGAGGTGACAGGA
GTGGAGGTGAAACGGAGAAC
Insulin-like growth factor binding protein 3
Igfbp3 NM_012588 QuantiTect Primer Assays (Qiagen Inc.) QT00186669
Insulin-degrading enzyme
Ide NM_013159 TCAAAGGGCTGGGTAAACAC
CCTTGCACTCTTGGAAAACC
Direct IAP-binding protein with low pI
Diablo NM_001008292
QuantiTect Primer Assays (Qiagen Inc.) QT00372995
BH3 interacting domain death agonist
Bid NM_022684 QuantiTect Primer Assays (Qiagen Inc.) QT00189028
BCL2-associated X protein
Bax NM_017059 QuantiTect Primer Assay (Qiagen Inc.) QT01081752
201
Figure 1: Effects of orchidectomy with or without testosterone replacement
on Igf1 mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in Igf1 mRNA were assayed by qRT-PCR in
the IS (A), Ca (B), Co (C), and Cd (D). Igf1 expression was normalized to Ppia
(cyclophilin A) expression. Day 0 corresponds to sham-operated animals (white
bars). Data are presented as mean ±SEM (n=5/group). Significant effects (p<0.05)
of treatment on expression are depicted by (**) and significant changes as
compared to sham-operated are depicted by (*).
202
Figure 2: Effects of orchidectomy with or without testosterone replacement
on Igf1r mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in Igf1r mRNA were assayed by qRT-PCR
in the IS (A), Ca (B), Co (C), and Cd (D). Igf1r expression was normalized to
Ppia (cyclophilin A) expression. Day 0 corresponds to sham-operated animals
(white bars). Data are presented as mean ±SEM (n=5/group). Significant effects
(p<0.05) of treatment on expression are depicted by (**) and significant changes
as compared to sham-operated are depicted by (*).
203
Figure 3: Effects of orchidectomy with or without testosterone replacement
on Ide mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in Ide mRNA were assayed by qRT-PCR for
IS (A), Ca (B), Co (C), and Cd (D). Ide expression was normalized to Ppia
(cyclophilin A) expression. Day 0 corresponds to sham-operated animals (white
bars). Data are presented as mean ±SEM (n=5/group). Significant effects (p<0.05)
of treatment on expression are depicted by (**) and significant changes as
compared to sham-operated are depicted by (*).
204
Figure 4: Effects of orchidectomy with or without testosterone replacement
on Igfbp3 mRNA expression in the epididymis. Rats were orchidectomized
with empty (black bars) or testosterone-filled (grey bars) implants and sacrificed
0.5, 1, 3, and 7 days after surgery. Changes in Igfbp3 mRNA were assayed by
qRT-PCR for IS (A), Ca (B), Co (C), and Cd (D). Igfbp3 expression was
normalized to Ppia (cyclophilin A) expression. Day 0 corresponds to sham-
operated animals (white bars). Data are presented as mean ±SEM (n=5/group).
Significant effects (p<0.05) of treatment on expression are depicted by (**) and
significant changes as compared to sham-operated are depicted by (*).
205
Figure 5: Effects of orchidectomy with or without testosterone replacement
on Birc5 mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in Birc5 mRNA were assayed by qRT-PCR
in the IS (A), Ca (B), Co (C), and Cd (D). Birc5 expression was normalized to
Ppia (cyclophilin A) expression. Day 0 corresponds to sham-operated animals
(white bars). Data are presented as mean ±SEM (n=5/group). Significant effects
(p<0.05) of treatment on expressions are depicted by (**) and significant changes
as compared to sham-operated are depicted by (*).
206
Figure 6: Potential androgen-response elements in the upstream promoter
region of rat Birc5. In silico analysis was done to identify putative androgen-
response elements in the 3kb upstream promoter region of rat Birc5.
207
Figure 7: Effects of orchidectomy with or without testosterone replacement
on Diablo mRNA expression in the epididymis. Rats were orchidectomized
with empty (black bars) or testosterone-filled (grey bars) implants and sacrificed
0.5, 1, 3, and 7 days after surgery. Changes in mRNA were assayed by qRT-PCR
for Diablo in the IS (A), Ca (B), Co (C), and Cd (D). Diablo expression was
normalized to Ppia (cyclophilin A) expression. Day 0 corresponds to sham-
operated animals (white bars). Data are presented as mean ±SEM (n=5/group).
Significant effects (p<0.05) of treatment on expression are depicted by (**) and
significant changes as compared to sham-operated are depicted by (*).
208
Figure 8: Effects of orchidectomy with or without testosterone replacement
on Bax mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in mRNA were assayed by qRT-PCR for Bax
in the IS (A), Ca (B), Co (C), and Cd (D). Bax expression was normalized to Ppia
(cyclophilin A) expression. Day 0 corresponds to sham-operated animals (white
bars). Data are presented as mean ±SEM (n=5/group). Significant effects (p<0.05)
of treatment on expression are depicted by (**) and significant changes as
compared to sham-operated are depicted by (*).
209
Figure 9: Effects of orchidectomy with or without testosterone replacement
on Bid mRNA expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Changes in mRNA were assayed by qRT-PCR for Bid
in the IS (A), Ca (B), Co (C), and Cd (D). Bid expression was normalized to Ppia
(cyclophilin A) expression. Day 0 corresponds to sham-operated animals (white
bars). Data are presented as mean ±SEM (n=5/group). Significant effects (p<0.05)
of treatment on expression are depicted by (**) and significant changes as
compared to sham-operated are depicted by (*).
210
Figure 10: Effects of orchidectomy with or without testosterone replacement
on IGF1 protein expression in the epididymis. Rats were orchidectomized with
empty (black bars) or testosterone-filled (grey bars) implants and sacrificed 0.5, 1,
3, and 7 days after surgery. Concentrations of IGF1 in the IS (A), Ca (B), Co (C),
and Cd (D) were assayed using the quantikine mouse IGF1 ELISA assay where
every sample was assayed in duplicate. Day 0 corresponds to sham-operated
animals (white bars). Data are presented as mean ±SEM (n=5/group). Significant
effects (p<0.05) of treatment on expression are depicted by (**) and significant
changes as compared to sham-operated are depicted by (*).
211
Figure 11: Effects of orchidectomy with or without testosterone replacement
on IGF1R protein expression in the epididymis. Rats were orchidectomized
with empty (black bars) or testosterone-filled (grey bars) implants and sacrificed
0.5, 1, 3, and 7d after surgery. IGF1 expression was determined by western blots
in the IS (A), Ca (B), Co (C), and Cd (D). (E) Representative films for the
different epididymal regions. Expression of IGF1R was quantified and normalized
relative to ACTIN expression. Day 0 corresponds to sham-operated animals
(white bars). Data are presented as mean ±SEM (n=5/group). Significant effects
(p<0.05) of treatment on expression are depicted by (**) and significant changes
as compared to sham-operated are depicted by (*).
212
213
Figure 12: Effects of orchidectomy with or without testosterone replacement
on BIRC5 protein expression in the epididymis. Rats were orchidectomized
with empty (black bars) or testosterone-filled (grey bars) implants and sacrificed
0.5, 1, 3, and 7 days after surgery. BIRC5 expression was determined by western
blots in the IS (A), Ca (B), Co (C), and Cd (D). (E) Representative films for the
different epididymal regions. Expression of BIRC5 was quantified and
normalized relative to ACTIN expression. Day 0 corresponds to sham-operated
animals (white bars). Data are presented as mean ±SEM (n=5/group). Significant
effects (p<0.05) of treatment on expression are depicted by (**) and significant
changes as compared to sham-operated are depicted by (*). n.d. is for non-
detectable.
214
215
Figure 13: Patterns of changes in mRNA expression for Igf1, Igf1r, Igfbp3,
and Ide in the epididymis. Patterns of changes in expression are represented for
Igf1 (black line), Igf1r (purple line), Igfbp3 (light blue line), and Ide (orange line)
after orchidectomy without and with testosterone replacement in the different
epididymal regions.
216
217
Figure 14: Patterns of changes in mRNA expression for Birc5 and Diablo in
the epididymis. Patterns of changes in expression are represented for Birc5 (pink
line) and Diablo (green line) after orchidectomy without and with testosterone
replacement in the different epididymal regions.
218
219
Figure 15: Patterns of changes in mRNA expression for Bax and Bid in the
epididymis. Patterns of changes in expression are represented for Bax (dark blue
line) and Bid (brown line) after orchidectomy without and with testosterone
replacement in the different epididymal regions.
220
221
CONNECTING TEXT
In chapter 3, members of the IGF1 survival signaling pathway showed
time-dependent and region-specific changes in transcription after orchidectomy
with or without testosterone replacement. This suggested an involvement of this
pathway in the response of the epididymis to androgen withdrawal. In order to
confirm the role of this pathway in the response of the epididymis to androgen
withdrawal, the effects of androgen withdrawal and blockade on two epididymal
cell lines will be characterized in the next chapter.
222
223
CHAPTER 4
Effects of Androgen Withdrawal on the PC-1 and DC-3 Mouse
Epididymal Cell Lines
Sophie-Anne Lamour1, Bernard Robaire1,2 1Departments of Pharmacology & Therapeutics and 2Obstetrics & Gynecology
McGill University, QC, Canada
224
1. Abstract
The epididymis, the tissue responsible for the proper maturation and
storage of spermatozoa, is regulated by androgens. However, androgen
withdrawal by orchidectomy causes little apoptosis. The IGF1 signaling pathway
is a candidate survival pathway in the response of the epididymis to androgen
withdrawal. To investigate the signaling cascades activated after androgen
withdrawal, we used the PC-1 and DC-3 mouse epididymal cell lines and assessed
their response to androgen withdrawal and/or blockade. This response was
characterized through evaluation of cell survival, changes in Birc5, Igf1, and Igf1r
mRNA expressions by qRT-PCR, and changes in IGF1 concentrations by ELISA.
We found that androgen withdrawal and/or blockade had no effect on cell survival
or IGF1 concentration in the media for both PC-1 and DC-3 cells. However,
duration of pre-treatment in charcoal-filtered FBS and DHT changed IGF1
concentration in the media; pre-treatment for 24h gave the highest IGF1
concentrations. In addition, PC-1 cells released more IGF1 into the media than
DC-3 cells. In the PC-1 cells, androgen withdrawal and/or blockade did not
change transcript expression of Birc5, Igf1, and Igf1r, whereas it increased Birc5
and Igf1 in the DC-3 cells. These results suggest that DC-3 cells may be a better
model system to study androgen action.
225
2. Introduction
The epididymis, a single highly convoluted tubule that links the efferent
ducts of the testis to the vas deferens, is responsible for the proper maturation and
storage of spermatozoa (1). It is morphologically and functionally divided into
four regions: initial segment (IS), caput (Ca), corpus (Co), and cauda (Cd); at the
epithelial level, it is composed of four major cell types (principal, basal, halo, and
clear cells) (2;3). Although the primary regulators of epididymal structure and
functions are androgens, in particular testosterone (T) and its 5α–reduced
metabolite dihydrotestosterone (DHT), other factors such as estrogens (4), growth
factors (5), and testicular factors [basic fibroblast growth factor (FGF2) (6) and
androgen binding protein (ABP) (7)] are also important for the regulation of the
epididymis (1).
Androgen withdrawal by orchidectomy causes a decrease in epididymal
weight due to the removal of spermatozoa and luminal fluid as well as a decrease
in epididymal cell height (8;9). However, there is little apoptosis associated with
androgen withdrawal (10); this is in sharp contrast with another androgen-
dependent tissue, the prostate, where 80% of the cells are lost by apoptosis within
10 days of castration (11). Despite the identification of apoptotic and cell survival
genes, in particular the anti-apoptotic genes baculoviral IAP repeat-containing 5
(Birc5), insulin-like growth factor 1 (Igf1), Igf1r, and myeloid cell differentiation
protein 1 (Mcl1), that show changes in expression in the epididymis after
orchidectomy with or without testosterone replacement (chapter 2), little is known
regarding the signaling cascades activated after androgen withdrawal. The IGF1
signaling cascade is a candidate survival pathway. IGF1 promotes cell survival
through binding to its receptor, IGF1R, and the activation of the
phosphatidylinositol 3-kinase (PI3K)/Akt pathway (12;13). Activation of this
pathway can lead to the activation of BIRC5, an inhibitor of apoptosis protein
(IAP) that inhibits caspase-3 activity (14).
Determining the signaling cascades activated after androgen withdrawal is
best done using immortalized epididymal cell lines. Although several
immortalized rodent epididymal cell lines have been created (15-19), the PC-1
226
mouse epididymal cell line (18) is the only one that has demonstrated changes in
gene expression after androgen withdrawal (20). In addition to the PC-1 cell line,
Araki et al. (18) have also developed the DC-3 mouse epididymal cell line that
might be more androgen-responsive than the PC-1 cell line (personal
communication). In fact, DC-3 cells arise from cells of the distal Ca, whereas PC-
1 cells have been isolated from cells of the proximal Ca. PC-1 and DC-3 cells
maintain morphological features of epididymal cells in vivo as well as expression
of genes present in the Ca epididymidis and in particular of the androgen receptor
(AR) (18). In addition, Seenundun and Robaire (20) have shown that IGF1 is
central to the response of the PC-1 cells to androgen withdrawal.
The objective of this study was to assess the response of the PC-1 and DC-
3 mouse epididymal cell lines to androgen withdrawal. We found that androgen
withdrawal had no effect on PC-1 and DC-3 cell viability, but that DHT
supplementation increased Birc5 and Igf1r mRNA expression in the DC-3 cells.
3. Materials and Methods
3.1. Chemicals
DHT (5α-androstan-17β-ol-3-one), estradiol (E2, 1,3,5(10)-estrien-3,17β-diol)
were purchased from Steraloids Inc. (Newport, RI). Hydroxyflutamide (HF, CAS
number 52806-53-8) was purchased from Toronto Research Chemicals Inc.
(North York, ON). E2, DHT, and HF were dissolved in ethanol. All cell culture
reagents were purchased from Wisent Inc. (St-Bruno, QC).
3.2. Cell culture
The mouse proximal caput epididymis PC-1 cell line and the mouse distal caput
epididymis DC-3 cell line (kindly provided by Dr. M.-C. Orgebin-Crist,
Department of Obstetrics and Gynecology, Vanderbilt University School of
Medicine, Nashville, TN) (passage number <12) were grown in Iscove modified
Dulbecco medium (IMDM) supplemented with 10% fetal bovine serum (FBS),
1mM sodium pyruvate, 0.1mM nonessential amino acids, 4mM glutamine,
penicillin-streptomycin (25 000 U penicillin G sodium, 25 mg streptomycin
227
sulfate), and 1nM DHT. DHT was used instead of testosterone because
epididymal cells respond to DHT and to bypass the conversion of testosterone to
DHT by 5α-reductase. PC-1 and DC-3 cells were cultured at 330C with 5% CO2.
Cells were plated in 75cm2 flasks in phenol-red negative IMDM where FBS was
replaced by charcoal-filtered FBS (CF-FBS) supplemented with DHT for two
passages (4 days; experiment 1), one passage (48h, experiment 2), or 24h
(experiment 3) before treatment. The cells were then exposed to 4 different
conditions (n=3/group): CF-FBS + vehicle (ethanol) (1), CF-FBS + 1nM DHT
(2), CF-FBS + 1μM HF (3), and CF-FBS + 1nM DHT + 1μM HF (4). After 24h
of treatment, media were collected for IGF1 ELISA analysis. To assess changes in
gene transcription, PC-1 and DC-3 cells were pre-cultured for 24h in CF-FBS +
1nM DHT and then exposed to the 4 previously described conditions.
3.3. Cell viability assay
PC-1 and DC-3 cells were seeded on 96-well plates to determine the effects of
androgen treatment, withdrawal and/or blockade on their viability. Cells to be
collected after 1 day were seeded at a density of 25 000 cells/well, after 2 days at
12 500 cells/well, and after 4 days at 6250 cells/well. These numbers were chosen
because cells double every 48h so that the final number of cells in each well
should be identical if there was no treatment effect on growth. Fresh media were
added every day. Cells were exposed to 4 different conditions (n=5/group): CF-
FBS + vehicle (ethanol) (1), CF-FBS + 1nM DHT (2), CF-FBS + 1μM HF (3),
and CF-FBS + 1nM DHT + 1μM HF (4). After 1, 2, and 4 days of treatment, cell
viability was assessed using the CellTiter-Glo luminescent cell viability assay
(Promega, Madison, WI) following the manufacturer’s instructions.
Luminescence was read with the Orion II microplate luminometer (Berthold
Detection Systems, Huntsville, AL); the value of the instrument background was
subtracted from each obtained measure. Cell numbers from luminescence signals
were determined using a standard curve.
228
3.4. RNA extraction
RNA was extracted from PC-1 and DC-3 cells following treatment (n=3/group)
using Qiagen Plus Mini-prep (Qiagen Inc., Mississauga, ON) following
manufacturer’s instructions. Concentration and quality of RNA were verified with
a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA).
3.5. Quantitative Real-Time RT-PCR
Real-Time RT-PCR was done to quantify changes in expression for Birc5, Igf1,
and Igf1r (Table 1) using the QuantiTect RT-PCR SybrGreen kit (Qiagen Inc.)
and the LightCycler system (Roche Applied Science, Laval, QC) as described
elsewhere (20). Each sample was assayed in duplicate. Expressions were
normalized against peptidylprolyl isomerase A (Ppia, cyclophilin A) expression.
Ppia is a housekeeping gene; its mRNA expression is not affected by androgen
manipulation (21).
3.6. IGF1 ELISA
Quantification of IGF1 concentrations in the media (n=3/group) was done using
the mouse IGF1 quantikine immunoassay (R&D Systems Inc., Minneapolis, MN)
following the manufacturer’s instructions. Every sample was evaluated in
duplicate. The minimum detectable amount was 3.5pg/ml. Intra-assay CV was
4.3% and inter-assay CV was 6%.
3.7. Statistical analysis
Significant differences between the different treatments on mRNA expression,
IGF1 concentration, and cell viability were assessed by two-way ANOVA
followed by the Holm-Sidak post-hoc test. Significance was set at p<0.05.
229
4. Results
4.1. Androgen treatment, withdrawal and/or blockade had no effect on PC-1
and DC-3 cell viability
In order to assess the effects of androgen withdrawal on PC-1 and DC-3
cell viability, cells were cultured in the absence or presence of DHT; effects of
androgen blockade were assessed by culturing the cells in the presence of
hydroxyflutamide (HF), the active metabolite of flutamide, a non-steroidal full
antagonist of the androgen receptor (AR) (22). For both PC-1 (fig. 1A,C) and DC-
3 (fig. 1B,D) cells, androgen treatment, withdrawal and/or blockade had no effect
on the numbers of viable cells.
4.2. Effects of androgen treatment, withdrawal and/or blockade on Igf1,
Igf1r, and Birc5 mRNA expression
Given that Igf1, Igf1r, and Birc5 mRNA expression have been shown to be
regulated by androgens in the epididymis (chapter 3), we determined the effects
of androgen treatment, withdrawal and/or blockade on Igf1, Igf1r, and Birc5
transcription in PC-1 (fig. 2A) and DC-3 (fig. 2B) cells. Cells were cultured in the
absence or presence of DHT and/or HF and changes in mRNA for Igf1, Igf1r, and
Birc5 were assessed by qRT-PCR. The treatments had no effect on transcription
of Igf1, Igf1r, and Birc5 mRNA in the PC-1 cells (fig. 2A). In the DC-3 cells,
presence of DHT significantly (p<0.05) increased Ig1r mRNA expression, even in
the presence of HF. DHT also increased Birc5 mRNA expression, even in the
presence of HF (fig. 2B). This suggested that DC-3 cells were more sensitive to
androgens than PC-1 cells.
4.3. Androgen withdrawal and/or blockade had no effect on IGF1
concentration
In order to determine if the lack of cell death after androgen withdrawal
and/or blockade was associated with an increased expression of IGF1, we
measured IGF1 concentration in media of PC-1 and DC-3 cells. Before the
beginning of the experiment, PC-1 (fig. 3A-C) and DC-3 (fig. 3D-F) cells were
230
cultured in CF-FBS with DHT for different periods of time to assess if the
duration of pre-treatment in CF-FBS and DHT had an effect on IGF1
concentration. Previously, Seenundun and Robaire (20) had pre-treated the cells
for 2 passages (4 days) in CF-FBS (experiment 1; fig. 3A, C). We also pre-treated
the cells for 1 passage (2 days, experiment 2; fig. 3B, D) and 24h (experiment 3;
fig. 3C, E). In general, IGF1 concentrations for PC-1 cells (80-225pg/ml) were
higher than for DC-3 cells (70-120pg/ml). For PC-1 cells, pre-treatment for 1
passage in CF-FBS with DHT (fig. 3B) gave the lowest concentration of IGF1 in
the media (80pg/ml) and pre-treatment for 24h (fig. 3C) the highest concentration
(225pg/ml). For DC-3 cells, pre-treatment for 24h in CF-FBS (fig. 3F) also gave
the highest concentration (120pg/ml), whereas pre-treatment for 2 passages (fig.
3D) or 1 passage (fig. 3E) gave similar concentrations of IGF1 (50-80pg/ml).
There was no effect of treatment on the concentration of IGF1 in the media. These
data showed that PC-1 cells secreted more IGF1 than DC-3 cells. In addition, it
suggested that duration of pre-treatment in CF-FBS and DHT could have an
impact on IGF1 concentration.
5. Discussion
Although mRNA expression of Igf1, Igf1r, and Birc5 are changed after
orchidectomy with or without testosterone replacement, as well as expression of
BIRC5 (chapter 3), suggesting a participation of the IGF1 signaling pathway in
the response of the epididymis to androgen withdrawal, little is known about its
functional involvement in the response of the epididymis to androgen withdrawal.
In order to determine the signaling cascades activated after androgen withdrawal,
the use of immortalized epididymal cell lines was warranted. Two immortalized
epididymal cell lines, PC-1 and DC-3, were assessed for their response to
androgen treatment, withdrawal and/or blockade; androgen blockade was
achieved using HF. Androgen blockade allowed us to distinguish between
transcriptional and potential non-transcriptional effects of androgens.
For both PC-1 and DC-3 cells, androgen treatment, withdrawal and/or
blockade had no effect on the number of viable cells, a lack of effect that has been
231
previously reported for the PC-1 cells (20). These results mimick the lack of cell
death observed in vivo after androgen withdrawal (23), as well as the lack of
cellular proliferation in the epididymis in the presence of T (24). This suggests
that both PC-1 and DC-3 cells were similar to epididymal cells in vivo and hence
they could be good model systems to study the effects of androgen withdrawal on
the epididymis.
After androgen treatment, withdrawal and/or blockade, there was no
change in gene expression for Birc5, Igf1, Igf1r, and Mcl1 in the PC-1 cells,
whereas Birc5 and Igf1r were increased in the presence of DHT in the DC-3 cells;
the latter effect was not prevented by the presence of HF. The lack of effect of
androgen withdrawal on Igf1 expression in the PC-1 cells is different from the
previous increase in Igf1 expression observed 4 days after androgen withdrawal
(20). These differential responses could be explained by differences in treatments
and times of measurement: we pre-cultured the cells for 24h in CF-FBS and DHT
instead of 2 passages and we measured changes in mRNA after 24h of treatments
instead of 2 days, 4 days, and 6 days. In the DC-3 cells, the observed increase in
Igf1r mRNA after DHT supplementation resembles the increase observed in the
Ca epididymidis after T replacement (chapter 3). On the other hand, the increase
in Birc5 mRNA after DHT supplementation does not resemble the decreased
expression observed in the Ca epididymidis after T replacement (chapter 3). This
shows a differential regulation of Birc5 in the DC-3 cells compared to the
epididymis. In addition, these changes in Birc5 and Igf1r mRNA expression by
DHT supplementation were not prevented by the presence of HF suggesting that
these changes are potentially not associated with transcriptional activity of AR. In
fact, AR can activate signaling cascades independently of its transcriptional
activity (25). Alternatively, it has been shown that HF by itself can activate the
Ras/MAPK pathway leading to changes in gene transcription (26). Together,
these data suggest that the DC-3 cells are more sensitive than PC-1 cells to
androgens for the markers studied, making them a potentially better model system
to study androgen actions.
232
Although androgen treatment, withdrawal and/or blockade had no effect
on IGF1 concentration in the media of both PC-1 and DC-3 cultures, which
matched the lack of change in Igf1 transcripts, duration of pre-treatment in CF-
FBS and DHT impacted the total amount of IGF1. This shows that experimental
conditions could have an impact on measured outcomes suggesting that proper
experimental conditions should be carefully determined.
We have shown that androgen treatment, withdrawal and/or blockade have
no effect on PC-1 and DC-3 cell survival as well as on IGF1 concentration.
Although androgen treatment, withdrawal and/or blockade do not change
expression of Birc5, Igf1, and Igf1r in the PC-1 cells, DHT increases Birc5 and
Igf1 expression in the DC-3 cells. This study suggests that DC-3 cells may be a
better model system than PC-1 cells to study androgen actions.
6. Acknowledgements
We would like to thank Dr. Eddy Rijntjes for his help with the collection of
samples and IGF1 ELISA assays. We are very grateful to Dr. Marie-Claire
Orgebin-Crist for providing us with the PC-1 and DC-3 mouse epididymal cell
lines.
233
References
1. Robaire B, Hinton BT, Orgebin-Crist MC 2006 The Epididymis. In:
Jimmy D.Neill, ed. Knobil and Neill's Physiology of Reproduction. Third
Edition ed. Elsevier; 1071-1148
2. Robaire B, Hermo L 1988 Efferent ducts, epididymis, and vas deferens:
structure. functions, and their regulation. In: Knobil E, Neill J, Ewing LL,
Grennswald GS, Markert CL, Pfaff DW, eds. The physiology of
reproduction. New York: Ravel Press, Ltd.; 999-1080
3. Reid B, Clewland K 1957 The structure and function of the epididymis. 1.
The histology of the rat epididymis. Aust J Zool223-246
4. Hess RA, Bunick D, Lubahn DB, Zhou Q, Bouma J 2000 Morphologic
changes in efferent ductules and epididymis in estrogen receptor-alpha
knockout mice. J Androl 21:107-121
5. Tomsig JL, Turner TT 2006 Growth Factors and the Epididymis. Journal
of Andrology 27:348-357
6. Lan ZJ, Labus JC, Hinton BT 1998 Regulation of gamma-glutamyl
transpeptidase catalytic activity and protein level in the initial segment of
the rat epididymis by testicular factors: role of basic fibroblast growth
factor. Biol Reprod 58:197-206
7. Robaire B, Zirkin BR 1981 HYpophysectomy and simultaneous
testosterone replacement: effects on male rat reproductive tract and
epididymal delta 4-5 alpha-reductase and 3 alpha-hydroxysteroid
dehydrogenase. Endocrinology 109:1225-1233
234
8. Delongeas JL, Gelly JL, Leheup B, Grignon G 1987 Influence of
testicular secretions on differentiation in the rat epididymis: ultrastructural
studies after castration, efferent duct ligation and cryptorchidism. Exp Cell
Biol 55:74-82
9. Moore HD, Bedford JM 1979 Short-term effects of androgen withdrawal
on the structure of different epithelial cells in the rat epididymis. Anat Rec
193:293-311
10. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
11. Isaacs JT 1984 Antagonistic effect of androgen on prostatic cell death. The
Prostate 5:545-557
12. Gennigens C, Menetrier-Caux C, Droz JP 2006 Insulin-Like Growth
Factor (IGF) family and prostate cancer. Crit Rev Oncol Hematol 58:124-
145
13. Butt AJ, Firth SM, Baxter RC 1999 The IGF axis and programmed cell
death. Immunol Cell Biol 77:256-262
14. Yamamoto T, Tanigawa N 2001 The role of survivin as a new target of
diagnosis and treatment in human cancer. Med Electron Microsc 34:207-212
15. Britan A, Lareyre JJ, Lefrancois-Martinez AM, Manin M, Schwaab V,
Greiffeuille V, Vernet P, Drevet JR 2004 Spontaneously immortalized
epithelial cells from mouse caput epididymidis. Mol Cell Endocrinol
224:41-53
16. Tabuchi Y, Toyama Y, Toshimori K, Komiyama M, Mori C 2005
Functional characterization of a conditionally immortalized mouse
epididymis caput epithelial cell line MEPC5 using temperature-sensitive
simian virus 40 large T-antigen. Biochem Biophys Res Commun 329:812-
823
235
17. Dufresne J, St Pierre N, Viger RS, Hermo L, Cyr DG 2005
Characterization of a novel rat epididymal cell line to study epididymal
function. Endocrinology 146:4710-4720
18. Araki Y, Suzuki K, Matusik RJ, Obinata M, Orgebin-Crist M.C. 2002
Immortalized epididymal cell lines from transgenic mice overexpressing
temperature-sensitive simian virus 40 large T-antigen gene. J Androl
23:854-869
19. Sipila P, Shariatmadari R, Huhtaniemi IT, Poutanen M 2004
Immortalization of epididymal epithelium in transgenic mice expressing
simian virus 40 T antigen: characterization of cell lines and regulation of the
polyoma enhancer activator 3. Endocrinology 145:437-446
20. Seenundun S, Robaire B 2007 Time-dependent rescue of gene expression
by androgens in the mouse proximal caput epididymidis-1 cell line after
androgen withdrawal. Endocrinology 148:173-188
21. Palladino MA, Hinton BT 1994 Expression of multiple gamma-glutamyl
transpeptidase messenger ribonucleic acid transcripts in the adult rat
epididymis is differentially regulated by androgens and testicular factors in a
region-specific manner. Endocrinology 135:1146-1156
22. Goldspiel BR, Kohler DR 1990 Flutamide: and antiandrogen for advanced
prostate cancer. DICP 24:616-623
23. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
24. Clermont Y, Flannery J 1970 Mitotic Activity in the Epithelium of the
Epididymis in Young and old Adult Rats. Biol Reprod 3:283-292
25. Foradori CD, Weiser MJ, Handa RJ 2008 Non-genomic actions of
androgens. Front Neuroendocrinol 29:169-181
236
26. Lee YF, Lin WJ, Huang J, Messing EM, Chan FL, Wilding G, Chang C
2002 Activation of mitogen-activated protein kinase pathway by the
antiandrogen hydroxyflutamide in androgen receptor-negative prostate
cancer cells. Cancer Res 62:6039-6044
237
Table 1: Real-Time RT-PCR primers
Gene name Gene symbol
Genbank accession no.
Forward primer sequence (5’ 3’)
Reverse primer sequence (5’ 3’)
Peptidylprolyl isomerase A (Cyclophilin A)
Ppia NM_017101 GTGGTCTTTGGGAAGGTGAA
GTTGTCCACAGTCGGAGATG
Baculoviral IAP repeat-containing 5
Birc5 NM-009689 QuantiTect Primer Assay (Qiagen Inc.) QT00113379
Insulin-like growth factor 1
Igf1 NM_010512 TCATGTCGTCTTCACACCTCTTCT
CCACACACGAACTGAAGAGCAT
Insulin-like growth factor 1 receptor
Igf1r NM_010513 GACACTTGGCATCCTGCTCT
CCCAGACCGACAACTCATCT
238
A BA B
Figure 1: Effects of androgen treatment, withdrawal and/or blockade on
PC-1 and DC-3 cell viability. PC-1 (A,C) and DC-3 (B,D) cells were cultured
(n=5/group) in CF-FBS in the absence (-) of DHT without (black bars) or with
(left-sided stripped bars) hydroxyflutamide and in the presence (+) of DHT
without (grey bars) or with (right-sided stripped bars) hydroxyflutamide for 1, 2,
and 4 days and numbers (*104) of viable cells were determined by the CellTiter-
Glo luminescent cell viability assay. Data are presented as mean +SEM. Normal
morphology of PC-1 (A) and DC-3 (B) cells are also shown.
239
Figure 2: Effects of androgen treatment, withdrawal and/or blockade on
Ifg1, Igf1r, and Birc5 mRNA expression. PC-1 (A) and DC-3 (B) cells were
cultured (n=3/group) in CF-FBS in the absence (-) of DHT without (black bars) or
with (left-sided stripped bars) hydroxyflutamide and in the presence (+) of DHT
without (grey bars) or with (right-sided stripped bars) hydroxyflutamide for 1 day.
Changes in Igf1, Igf1r, and Birc5 mRNA expression were assessed by qRT-PCR
and normalized to Ppia (cyclophilin A) expression. Data are presented as mean
+SEM. Significant effects (p<0.05) of treatments on mRNA expression are
depicted by (*).
240
Figure 3: Effects of androgen treatment, withdrawal and/or blockade on
IGF1 concentration. PC-1 (A-C) and DC-3 (D-F) cells were cultured
(n=3/group) in CF-FBS with DHT for 2 passages (4 days, experiment 1; A, D), 1
passage (48h, experiment 2; B, E) or 24h (experiment 3; C, F). Then the cells
were cultured for 24h in CF-FBS in the absence (-) of DHT without (black bars)
or with (left-sided stripped bars) hydroxyflutamide (HF) and in the presence (+)
of DHT without (grey bars) or with (right-sided stripped bars) HF. IGF1
concentrations (pg/ml) in the media were measured using the IGF1 mouse
quantikine ELISA assay; every measure was done in duplicate.
241
CHAPTER 5
Discussion
242
Taking into account that androgen withdrawal by orchidectomy causes
little apoptosis in the epididymis (1), this thesis aimed at understanding the
molecular mechanisms underlying epididymal resistance to apoptosis triggered by
androgen withdrawal. As androgens act through the androgen receptor (AR) to
regulate gene transcription (2), this thesis assessed changes in transcription of
apoptotic and cell survival genes as well as on members of the IGF1 survival
signaling pathway after androgen withdrawal and/or replacement. In addition, in
order to target specific signaling pathways, in particular the IGF1 signaling
pathway, the effects of androgen withdrawal on two in vitro model systems were
investigated.
This chapter will discuss the validity of the models used, some of the key
findings from the studies undertaken in this thesis, and future research directions.
1. Androgen regulation of apoptosis and cell survival in the epididymis
Although in the epididymis, androgens are essential to regulate gene
expression, structure, and functions [reviewed in (3)], androgen withdrawal by
orchidectomy causes little apoptosis (1;4). The few studies that have investigated
the molecular mechanisms triggered after orchidectomy have focused on
explaining the apoptosis (5-7), but no one has examined the molecular
mechanisms explaining the resistance of the epididymis to apoptosis triggered by
androgen withdrawal.
1.1. Regulation of apoptosis and cell survival genes in the epididymis
As mentioned in section 2.4 of the introduction, many studies have been
undertaken to understand changes in gene expression in the epididymis. However,
the studies described in this thesis are the first ones to specifically assess
androgen regulation of apoptosis and cell survival genes.
In chapter 2, apoptosis-focused arrays were used to identify specific
apoptotic and cell survival genes differentially regulated after orchidectomy with
or without testosterone replacement. The presence and regulation by androgens of
Birc5, an IAP, was not expected in the epididymis due to the generally perceived
243
restricted expression pattern of BIRC5 in mitotically active tissues and cancers
(8); the epididymis is a terminally-differentiated tissue with very rare cases of
cancer (3). In the androgen-responsive prostate cancer LNCaP cell line, BIRC5 is
highly expressed and shows increased expression after DHT supplementation (9).
In the epididymis, Birc5 expression was increased after orchidectomy and
repressed by T replacement. The differential regulation of the same gene by
androgens suggests the presence of specific coregulators (2) modulating Birc5
expression differently in the prostate and the epididymis.
In chapter 3, members of the IGF1 signaling pathway were shown to be
differentially regulated in the epididymis after androgen withdrawal and/or
replacement. Androgen withdrawal caused an increase in expression of Igf1,
Igf1r, and Igfbp3, which was prevented for Igf1r and Igfbp3 by T replacement. In
LNCaP cells, IGF1 promotes cell survival in an androgen-deprived state (9),
hence increased expression of members of the IGF1 signaling pathway in the
epididymis parallels changes observed in prostate cancer cells. However, in
prostate cancer, Igfbp3 expression is associated with apoptosis (10). Taking into
account the little apoptosis observed in the epididymis after androgen withdrawal
(1), it is unlikely that increased Igfbp3 expression would be associated with
apoptosis. In fact, IGFBP3 promotes cell survival in breast cancer cells (11) and it
is possible that it has the same role in the epididymis.
1.2. Orchidectomy and testosterone replacement as a model system
All the studies that have specifically assessed the effects of androgen
withdrawal on apoptosis in the epididymis have used orchidectomy with or
without testosterone (T) replacement as their model system (1;4-7), with the
exception of Fan and Robaire (1) who have also used efferent duct ligation. Given
that orchidectomy was the model of choice in preceding studies, its use for the
experiments presented in chapters 2 and 3 of this thesis was justified.
In order to determine the direct effects of androgens on the measured
endpoints, T implants designed to maintain serum T concentration at control
levels were used (12). Testosterone implants were selected instead of DHT
244
implants to mimic the control situation where testosterone is the circulating
androgen. However, the epididymis receives T from both the circulation and the
testis via the lumen (3) and luminal T concentration is ten to twelve times greater
than that of circulation (13). It is then reasonable to ask if using implants that
would mimic the high intraluminal T concentration would differentially affect the
chosen endpoints. Robaire et al. (14) have shown that a higher circulating T
concentration does not increase epididymal weight above the one measured with a
control serum T concentration. In addition, the control T concentration is
sufficient to maintain epididymal structure in all regions except the initial
segment where a ten-fold higher circulating T concentration does not prevent
regressive changes; epididymal 3-alpha hydroxysteroid dehydrogenase activity
that decreases after orchidectomy, is maintained by a circulating T concentration
and is not further increased by a ten-fold higher T concentration (14). This is due
to the dependence of the initial segment on testicular factors to maintain its
functions (3). However, DHT is the main androgen found in the epididymis
(15;16) and arises from the reduction of T by 5α-reductase, the rate-limiting
enzyme in this process (17). In fact, 5α-reductase can convert T to DHT at a rate
of 7.5nmoles/min up to a substrate concentration of 0.5μmoles, after which
production of DHT stays constant (17). Hence, it is fair to assume that different
concentrations of circulating T concentrations could cause different responses
and, in particular, different gene expression profiles. For example, high
circulating T concentration is necessary to maintain control expression of 5α-
reductase type 1 mRNA (18).
1.3. Other models of androgen blockade
As mentioned in section 4.4 of the introduction, other methods exist to
block androgen action in the epididymis; these include treatment with AR
antagonists, 5α-reductase inhibitors, and GnRH antagonists.
AR antagonists. AR antagonists that have been used to study epididymal
functions include cyproterone acetate, flutamide, and bicalutamide (casodex).
Cyproterone acetate, a progestin (19) is not only a potent androgen antagonist, but
245
also a weak antagonist; at a low concentration, it inhibits T-stimulated
transcription, but at high concentrations, it promotes it (20). Cyproterone acetate
has been shown to decrease epididymal weight and affect epididymal functions
(21). From these studies, cyproterone acetate seems to be a potential alternative to
orchidectomy; however, its partial agonist activity can confound results obtained
with that compound. Flutamide and bicalutamide are pure antiandrogens;
however, flutamide causes a compensatory rise of serum androgens (22). Most
studies done on the epididymis with those two compounds show that they have no
effect on the epididymis of the adult rat, except after orchidectomy followed by T
replacement (23-26). However, a recent study by Obregon and Esponda (27)
suggests that flutamide can induce a small degree of apoptosis in the epididymis,
whereas Carvelli et al. (28) have shown that flutamide treatment increases the
cation-dependent mannose-6-phosphate receptor, a similar outcome as observed
when rats are orchidectomized. The main difference between the studies that
show no effect of flutamide and the ones that do is the route of administration;
when flutamide is given orally, there is no effect, whereas there is an effect when
it is injected intraperitoneally. Although the recent studies indicate that flutamide
could be an alternative to orchidectomy, the rise in serum androgens that it
triggers can confound the results.
5α-reductase inhibitors. Finasteride is a 5α-reductase type 2 inhibitor (29),
whereas dutasteride (30), PNU157706 (31), and FK143 (32) are dual 5α-reductase
inhibitors. Although finasteride, dutasteride, and PNU157706 inhibit
intraprostatic DHT concentration, they increase intraprostatic T concentration
(33;34). They also do not decrease ventral prostate weight as efficiently as
castration (34;35). However, PNU157706 decreases epididymal weight (34).
Treatment with PNU157706 and FK143 affects the expression of genes involved
in different cellular processes important for the creation of optimal luminal
microenvironments [(36;37), reviewed in (38)]. PNU157706 and FK143
treatments have no effect on Igf1r expression in the epididymis, but decrease Igf1
expression in the distal regions (37). The latter findings do not correspond to the
findings reported in chapter 3 of this thesis, where orchidectomy increased Igf1
246
expression and decreased Igf1r expression. The discrepancy between the obtained
results can be explained by the mode of action of PNU157706 and FK143, which
inhibit conversion of T to DHT (31;32) and hence do not remove all androgens as
opposed to orchidectomy. Taken together, treatment with 5α-reductase inhibitors
would not be an appropriate model for the type of studies undertaken in this
thesis.
GnRH antagonists. GnRH antagonists decrease serum T concentration to
castrate concentration by inhibiting secretions of LH and FSH (39). Treatment
with a GnRH antagonist decreases epididymal weight (40), but only reduces by
50% androgens present in the epididymis (41) and does not change the nuclear
localization of AR (26). Thus, using GnRH antagonists would not be an
alternative to orchidectomy for the type of studies described in this thesis.
1.4. In vitro model systems
Using in vitro model systems allows the characterization of specific
signaling pathways under controlled conditions. In order to confirm the
involvement of the IGF1 survival signaling pathway in the response of the
epididymis to androgen withdrawal, chapter 4 of this thesis assessed the effects of
androgen treatment, withdrawal and blockade on the PC-1 and DC-3 mouse
epididymal cell lines. PC-1 and DC-3 cells maintain morphological features of
epididymal cells in vivo and expression of genes present in the caput
epididymidis, in particular Ar. Although they are derived from the same region,
PC-1 cells are derived from cells of the proximal caput, whereas DC-3 are derived
from cells of the distal caput (42), which could affect their response to androgen
withdrawal. In fact, as spermatozoa move down the epididymal lumen, they are
exposed to different microenvironments created by the secretion of specific
proteins (43) and hence PC-1 and DC-3 gene expression and protein secretion
profiles are likely to be different. There are other available rodent epididymal cell
lines (44-47), however, the PC-1 cell line is the only one that has shown changes
in gene expression after androgen withdrawal and in particular for Igf1 (48); DC-3
cells were used for the first time, beyond their initial report, in this study.
247
In chapter 4, PC-1 and DC-3 cells were further characterized as model
systems. Androgen treatment, withdrawal and/or blockade did not decrease PC-1
and DC-3 cell viability, an outcome that mimics the low cell death observed in
vivo after orchidectomy (1). However, androgen supplementation only increased
Igf1r and Birc5 expression in DC-3 cells suggesting a higher sensitivity of DC-3
cells to androgens as well as differences in gene expression between the two cell
lines. In addition, DC-3 cells express not only Igf1, Igf1r, and Birc5, but also
Tnfrsf11b (appendix 3), a gene uncharacterized in the epididymis. Together, this
indicates that the DC-3 cell line might be a better model system than the PC-1 cell
line.
2. Future directions
2.1. IGF1 survival signaling pathway in the response of the epididymis to
androgen withdrawal
In chapter 3, the involvement of the IGF1 survival signaling pathway in
the response of the epididymis to androgen withdrawal was suggested. However,
a functional link needs to be established between the IGF1 survival pathway and
the low level of apoptosis observed in the epididymis after androgen withdrawal.
Although, Igf1 null mice have been engineered (49), they are unsuitable for this
type of studies because they already have a low concentreation of T and their
distal epididymis is underdeveloped. An alternative approach would be to block
IGF1R in vivo using an antibody (50) or more recently derived inhibitors (51-53).
In addition, it would be possible to transfer by electroporation small interfering
RNA (siRNA), short hairpin RNA (shRNA) or dominant-negative constructs
targeting IGF1R into a specific epididymal region. This approach has been used
by Fox et al. (54) to introduce dominant-negative plasmids of FGF receptor 1 and
ETS translocation variant 5 (ETV5) into the initial segment to study the effects of
their inhibition on downstream genes. Once IGF1R is blocked or inhibited,
orchidectomy with or without T replacement can be done and the levels of
apoptosis measured.
248
2.2. Developing a good in vitro model system to study the IGF1 signaling
pathway
In chapter 4, androgen withdrawal was obtained by culturing PC-1 and
DC-3 cells in charcoal-stripped FBS medium. This culture condition led to no
increase in IGF1 secretion. Assessment of the IGF1 signaling pathway requires
specific culture conditions, and in particular serum-free conditions; serum is
known to activate the IGF1 signaling pathway. In order to remove the influence of
FBS on the IGF1 pathway, other groups have used serum-starved cells from 4hrs
(55) to 48hrs (56). For PC-1 and DC-3 cells, the number of hours of serum-
starvation to give the best response will need to be determined empirically.
Once the optimal culture conditions will be defined, the involvement of
the IGF1 signaling cascade in the response of the PC-1 and DC-3 cells can be
assessed by inhibiting different members of the signaling cascade. It is possible to
use inhibitors to block PI3K (LY294002 and/or wortmannin), Akt (Akt inhibitor
IV) (57), and IGF1R (IGF1R inhibitor, PPP) (51); IGF1R activation can also be
blocked by an IGF1R antibody (58).
2.3. Assessing the role of BIRC5 in the epididymis
It has been shown that BIRC5 localization in a cell, in the cytoplasm or
the nucleus, indicates its function; when BIRC5 localizes to the cytoplasm, it acts
as an anti-apoptotic protein, whereas in the nucleus, it participates in cell division
(59). In appendix 2, BIRC5 was localized in the cytoplasm of epididymal cells,
which suggested a role as an anti-apoptotic protein (59). In order to determine the
role of BIRC5 in the epididymis, two approaches can be taken. The first one uses
in vitro model systems, PC-1 and/or DC-3 cells, to assess the role of BIRC5 in the
response of the cells to androgen withdrawal. Functions of BIRC5 in apoptosis
and cell division have been assessed using knockdown by siRNA, shRNA (60) or
dominant negative constructs (61). However, these techniques cause BIRC5
knockdown in both the cytoplasm and nucleus rendering the distinction between
BIRC5 anti-apoptotic and proliferative functions difficult. To solve that issue,
249
Colnaghi et al. (62) have designed constructs expressing BIRC5 with point
mutations in its nuclear export signal causing BIRC5 accumulation in the nucleus.
This allows the specific assessment of BIRC5 role as an anti-apoptotic protein.
The second approach uses in vivo knockdown of BIRC5. Since BIRC5 knockout
mice are embryonic lethal (63), BIRC5 has to be specifically knocked down in the
epididymis to assess its functions. It is possible to engineer transgenic mice with
BIRC5 exclusively knocked down in the initial segment (64) or caput (65) and
then assess the effects of orchidectomy on those two regions.
2.4. Androgen-dependence of Birc5 and regulation of BIRC5
In chapter 3, orchidectomy caused an increase in Birc5 mRNA expression,
which was suppressed by T replacement suggesting transcriptional regulation.
This transcriptional regulation could occur through 5 putative androgen response
elements (AREs) identified in the 3kb upstream promoter region of Birc5. In
order to confirm the functionality of these AREs, fragments containing 0 to 5
AREs can be isolated from a rat cDNA library, cloned into vectors, and binding
by AR assessed with a reporter assay. Another method, cloning by PCR
amplification, is not viable because it is impossible to design good primers to
amplify Birc5 promoter region (appendix 2). Alternatively, reporter vectors
containing different lengths of the human Birc5 promoter are available (66); in
silico analysis of this promoter would allow for the localization of putative AREs.
In chapter 3, although orchidectomy with or without T replacement
regulated transcriptionally Birc5 expression in all regions, only the proximal
regions showed a decreaed BIRC5 protein expression after orchidectomy that was
only prevented by T replacement in the Ca epididymidis. As BIRC5 expression is
regulated by the ubiquitin-proteasome pathway (67), it is possible to assess the
amount of BIRC5 bound to ubiquitin using co-immunoprecipitation. Another
possibility is that translation of BIRC5 is decreased after orchidectomy in the
proximal regions. Translation of BIRC5 can be determined by measuring the
amount of BIRC5 bound by either monosomes or polysomes; untranslated
proteins are bound by monosomes, whereas translated proteins are bound by
250
polysomes. Monosomes and polysomes can be isolated by sucrose gradient and
the bound RNA extracted and identified by northern blot (71).
2.5. TNFRSF11B, a protein with a new role in the epididymis?
In chapter 2, Tnfrsf11b, Tnfrsf11a (receptor activator of NF-kappaB;
RANK), and Tnfsf11 (RANKL) were identified in the epididymis. Given the
multiple roles of TNFRS11A/TNFRSF11B/TNFSF11 in osteogenesis (67) and
immunity (68) as well as the inhibition of TNFSF10 (TNF-related apoptosis-
inducing ligand; TRAIL)-induced apoptosis in prostate cancer by TNFRSF11B
(69), one can speculate that there is a dual role of TNFRSF11B in immunity in the
control epididymis and as an anti-apoptotic protein after androgen withdrawal.
In order to assess the role of TNFRSF11B in the epididymis in immunity
and/or cell survival, one can use TNFRSF11B knockout mice (3). First, the
fertility of these mice should be determined by assessing sperm motility by
computer-assisted sperm analysis (CASA), sperm quality by comet assay, and
progeny outcome. In addition, morphology of the epididymis and composition of
the epididymal epithelium should be established. Second, the role of TNFRSF11B
as a survival protein could be determined by assessing the effects of androgen
withdrawal on the epididymis of TNFRSF11B knockout mice.
3. Final conclusions
In this thesis, in vivo and in vitro model systems were used to understand
androgen regulation of apoptosis and cell survival in the epididymis. These
studies not only identified novel androgen-regulated apoptotic and cell survival
genes, but also identified the IGF1 survival signaling pathway as a potential
pathway involved in the response of the epididymis to androgen withdrawal. They
also identified the DC-3 cell line as a better in vitro model system to study
androgen actions.
This thesis, as a whole, provides novel insights into androgen regulation of
apoptotic and cell survival genes in the epididymis as well as into the molecular
mechanisms underlying epididymal resistance to apoptosis triggered by androgen
251
withdrawal. Understanding how androgens regulate survival while maintaining
homeostasis in a tissue with very limited cancer occurrences could help identify
differential regulatory mechanisms by androgens. This, in turn, could offer ways
to modulate disregulated proteins in androgen-associated pathologies such as
prostate cancer.
252
References
1. Fan X, Robaire B 1998 Orchidectomy induces a wave of apoptotic cell
death in the epididymis. Endocrinology 139:2128-2136
2. Li J, Al-Azzawi F 2009 Mechanism of androgen receptor action. Maturitas
63:142-148
3. Robaire B, Hinton BT, Orgebin-Crist MC 2006 The Epididymis. In:
Jimmy D.Neill, ed. Knobil and Neill's Physiology of Reproduction. Third
Edition ed. Elsevier; 1071-1148
4. Takagi-Morishita Y, Kuhara A, Sugihara A, Yamada N, Yamamoto R,
Iwasaki T, Tsujimura T, Tanji N, Terada N 2002 Castration induces
apoptosis in the mouse epididymis during postnatal development. Endocrine
Journal 49:75-84
5. Kuhara A, Yamada N, Sugihara A, Ohyama H, Tsujimura T, Hayashi
S, Terada N 2005 Fos plays no role in apoptosis of epithelia in the mouse
male accessory sex organs and uterus. Endocr J 52:153-158
6. Sugihara A, Yamada N, Tsujimura T, Iwasaki T, Yamashita K, Takagi
Y, Tsuji M, Terada N 2001 Castration induces apoptosis in the male
accessory sex organs of Fas-deficient lpr and Fas ligand-deficient gld
mutant mice. In Vivo 15:385-390
7. Suzuki A, Matsuzawa A, Iguchi T 1996 Down regulation of Bcl-2 is the
first step on Fas-mediated apoptosis of male reproductive tract. Oncogene
13:31-37
8. Fukuda S, Pelus LM 2006 Survivin, a cancer target with an emerging role
in normal adult tissues. Mol Cancer Ther 5:1087-1098
253
9. Zhang M, Latham DE, Delaney MA, Chakravarti A 2005 Survivin
mediates resistance to antiandrogen therapy in prostate cancer. Oncogene
24:2474-2482
10. Gennigens C, Menetrier-Caux C, Droz JP 2006 Insulin-Like Growth
Factor (IGF) family and prostate cancer. Crit Rev Oncol Hematol 58:124-
145
11. Yamada PM, Lee K-W 2009 Perspectives in mammalian IGFBP-3
biology: local vs. systemic action. Am J Physiol Cell Physiol 296:954-976
12. Stratton IG, Ewing LL, Desjardins C 1973 Efficacy of testosterone-filled
polydimethylsiloxane implants in maintaining plasma testosterone in
rabbits. J Reprod Fertil 35:235-244
13. Turner TT, Jones CE, Howards SS, Ewing LL, Zegeye B, Gunsalus GL
1984 On the androgen microenvironment of maturing spermatozoa.
Endocrinology 115:1925-1932
14. Robaire B, Ewing LL, Zirkin BR, Irby DC 1977 Steroid delta4-5alpha-
reductase and 3alpha-hydroxysteroid dehydrogenase in the rat epididymis.
Endocrinology 101:1379-1390
15. Turner TT 1991 Spermatozoa are exposed to a complex microenvironment
as they traverse the epididymis. In: Robaire B, ed. The male germ cell -
Spermatogonium to fertilization. New York: Annals of the New York
Academy of Sciences; 364-383
16. Tindall DJ, French FS, Nayfeh SN 1972 Androgen uptake and binding in
rat epididymal nuclei, in vivo. Biochem Biophys Res Commun 49:1391-
1397
254
17. Shefer S, Hauser S, Mosbach EH 1966 Studies on the biosynthesis of 5α-
cholestab-3β-ol I. Cholestenone 5α-reductase of rat liver. J Biol Chem
241:946-952
18. Viger RS, Robaire B 1991 Differential regulation of steady state 4-ene
steroid 5α-reductase messenger ribonucleic acid levels along the rat
epididymis. Endocrinology 128:2407-2414
19. Sitruk-Ware R 2005 New progestagens for contraceptive use. Human
Reproduction Update 12:169-178
20. Attardi BJ, Koduri S, Hild SA 2010 Relative progestational and
androgenic activity of four progestins used for male hormonal contraception
assessed in vitro in relation to their ability to suppress LH secretion in the
castrate male rat. Molecular and Cellular Endocrinology Article in press:
21. Kaur J, Radhakrishnan B, Rajalakshmi M 1992 Effect of cytoproterone
acetate on structure and function of rhesus monkey reproductive organs.
Anat Rec 234:62-72
22. Furr BJ, Valcaccia B, Curry B, Woodburn JR, Chesterson G, Tucker H
1987 ICI 176,334: a novel non-steroidal, peripherally selective
antiandrogen. J Endocrinol 113:R7-R9
23. Dhar JD, Setty BS 1976 Studies on the physiology and biochemistry of
mammalian epididymis: effect of flutamide, a nonsteroidal antiandrogen, on
the epididymis of the rat. Fertil Steril 27:566-576
24. Dhar JD, Srivastava SR, Setty BS 2010 Flutamide as an androgen
antagonist on epididymal function in the rat. Andrologia 14:55-61
255
25. Chandolia RK, Weinbauer GF, Simoni M, Behre HM, Nieschlag E 1991
Comparative effects of chronic administration of the non-steroidal
antiandrogens flutamide and Casodex on the reproductive system of the
adult male rat. Acta Endocrinol (Copenh) 125:547-555
26. Paris F, Weinbauer GF, Blum V, Nieschlag E 1994 The effect of
androgens and antiandrogens on the immunohistochemical localization of
the androgen receptor in accessory reproductive organs of male rats. J
Steroid Biochem Mol Biol 48:137
27. Obregon EB, Esponda P 2009 Increase in apoptosis and of the stress
protein HSP70 in the mouse epididymis produced by the antiandrogen
flutamide. Int J Morphol 27:463-468
28. Carvelli LF, Bannoud N, Aguilera CA, Morales CR, Sosa MA 2010
Castration induces changes in the cation-dependent mannose-6-phosphate
receptor in rat epididymis: possible implications in secretion of lysosomal
enzymes. J Cell Biochem 110:1101-1110
29. Kolasa A, Marchlewicz M, Wenda-Rozawicka L, Wiszbiewska B 2004
Morphology of the testis and the epididymis in rats with dihydrotestosterone
(DHT) deficiency. Annales Academiae Medicae Bialostocensis 49:117-119
30. Evans HC, Goa KL 2003 Dutasteride. Drugs Aging 20:905-916
31. Zaccheo T, Giudici D, di Salle E 1998 Effect of the dual 5α-reductase
inhibitor PNU 157706 on the growth of dunning R3327 prostatic carcinoma
in the rat. J Steroid Biochem Mol Biol 64:193-198
32. Hirosumi J, Nakayama O, Chida N, Inami M, Fagan T, Sawada K,
Shigematsu S, Kojo H, Notsu Y, Okuhara M 1995 FK143, a novel
nonsteroidal inhibitor of steroid 5α−reductase: (2) In vivo effects on rat and
dog prostates. J Steroid Biochem Mol Biol 52:365-373
256
33. Prahalada S, Rhodes L, Grossman SJ, Heggan D, Keenan KP,
Cukierski MA, Hoe CM, Berman C, van Zwieten MJ 1988
Morphological and hormonal changes in the ventral and dorsolateral
prostatic lobes of rats treated with finasteride, a 5-alpha reductase inhibitor.
Prostate 35:157-164
34. di Salle E, Giudici D, Radice A, Zaccheo T, Ornati G, Nesi M, Panzeri
A, Delos S, Martin PM 1998 PNU 157706, a novel dual type I and II 5α-
reductase inhibitor. J Steroid Biochem Mol Biol 64:179-186
35. Xu Y, Dalrymple SL, Becker RE, Denmeade SR, Isaacs JT 2006
Pharmacologic basis for the enhanced efficacy of dutasteride against
prostatic cancers. Clin Cancer Res 12:4072-4079
36. Henderson NA, Cooke GM, Robaire B 2004 Effects of PNU157706, a
dual 5alpha-reductase inhibitor, on gene expression in the rat epididymis. J
Endocrinol 181:245-261
37. Henderson NA, Cooke GM, Robaire B 2006 Region-specific expression
of androgen and growth factor pathway genes in the rat epididymis and the
effects of dual 5alpha-reductase inhibition. J Endocrinol 190:779-791
38. Robaire B, Henderson NA 2006 Actions of 5α−reductase inhibitors on the
epididymis. Molecular and Cellular Endocrinology 250:190-195
39. Huirne JA, Lambalk CB 2010 Gonadotropin-releasing-hormone-receptor
antagonists. Lancet 358:1793-1803
40. Huang HFS, Pogah L, Giglio W, Nathan E, Seebode J 1992 GnRH-A
induced arrest of spermiogenesis in rats is associated with altered androgen
binding protein distribution in the testis and epididymis. J Androl 13:153-
159
257
41. Yeung CH, Weinbauer GF, Cooper TG 1999 Effect of acute androgen
withdrawal by GnRH antagonist on epididymal sperm motility and
morphology in the cynomolgus monkey. J Androl 20:72-79
42. Araki Y, Suzuki K, Matusik RJ, Obinata M, Orgebin-Crist M.C. 2002
Immortalized epididymal cell lines from transgenic mice overexpressing
temperature-sensitive simian virus 40 large T-antigen gene. J Androl
23:854-869
43. Cornwall GA 2009 New insights into epididymal biology and function.
Hum Reprod Update 15:213-227
44. Britan A, Lareyre JJ, Lefrancois-Martinez AM, Manin M, Schwaab V,
Greiffeuille V, Vernet P, Drevet JR 2004 Spontaneously immortalized
epithelial cells from mouse caput epididymidis. Mol Cell Endocrinol
224:41-53
45. Tabuchi Y, Toyama Y, Toshimori K, Komiyama M, Mori C 2005
Functional characterization of a conditionally immortalized mouse
epididymis caput epithelial cell line MEPC5 using temperature-sensitive
simian virus 40 large T-antigen. Biochem Biophys Res Commun 329:812-
823
46. Dufresne J, St Pierre N, Viger RS, Hermo L, Cyr DG 2005
Characterization of a novel rat epididymal cell line to study epididymal
function. Endocrinology 146:4710-4720
47. Sipila P, Shariatmadari R, Huhtaniemi IT, Poutanen M 2004
Immortalization of epididymal epithelium in transgenic mice expressing
simian virus 40 T antigen: characterization of cell lines and regulation of the
polyoma enhancer activator 3. Endocrinology 145:437-446
258
48. Seenundun S, Robaire B 2007 Time-dependent rescue of gene expression
by androgens in the mouse proximal caput epididymidis-1 cell line after
androgen withdrawal. Endocrinology 148:173-188
49. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellve AR, Efstratiadis
A 1996 Effects of an Igf1 gene null mutation on mouse reproduction. Mol
Endocrinol 10:903-918
50. Kalebic T, Tsokos M, Helman LJ 1994 In vivo treatment with antibody
against IGF-1 receptor suppresses growth of human rhabdomyosarcoma and
down-regulates p34cdc2. Cancer Res 54:5531-5534
51. Menu E, Jernberg-Wiklund H, Stromberg T, De Raeve H, Girnita L,
Larsson O, Axelson M, Asosingh K, Nilsson K, Van Camp B,
Vanderkerken K 2006 Inhibiting the IGF-1 receptor tyrosine kinase with
the cyclolignan PPP: an in vitro and in vivo study in the 5T33MM mouse
model. Blood 107:655-660
52. Wittman M, Carboni J, Attar R, Balasubramanian B, Balimane P,
Brassil P, Beaulieu F, Chang C, Clarke W, Dell J, Eummer J,
Frennesson D, Gottardis M, Greer A, Hansel S, Hurlburt W, Jacobson
B, Krishnananthan S, Lee FY, Li A, Lin T-A, Liu P, Ouellet C, Sang X,
Saulnier MK, Stoffan K, Sun Y, Velaparthi U, Wong H, Yang Z,
Zimmermann K, Zoecker M, Vyas D 2005 Discovery of a 1H-
Benzoimidazol-2-yl-1H-pyridin-2-one (BMS-536924) inhibitor of insulin-
like growth factor I receptor kinase with in vivo antitumor activity. J Med
Chem 48:5639-5643
53. Garcia-Echeverria C, Pearson MA, Marti A, Meyer T, Mestan J,
Zimmermann J, Gao J, Brueggen J, Capraro HG, Cozens R, Evans DB,
Fabbro D, Furet P, Porta DG, Liebetanz J, Martiny-Baron G, Ruetz S,
Hofmann F 2004 In vivo antitumor activity of NVP-AEW541-A novel,
potent, and selective inhibitor of the IGF-IR kinase. Cancer Cell 5:231-239
259
54. Fox SA, Yang L, Hinton BT 2006 Identifying putative contraceptive
targets by dissecting signal transduction networks in the epididymis using an
in vivo electroporation (electrotransfer) approach. Mol Cell Endocrinol
250:196-200
55. Cahuana GM, Tejedo JR, Hmadcha A, Ramirez R, Cuesta AL, Soria B,
Martin F, Bedoya FJ 2008 Nitric oxide mediates the survival action of
IGF-1 and insulin in pancreatic β cells. Cellular Signalling 20:301-310
56. Murray SA, Zheng H, Gu L, Xiao Z-XJ 2003 IGF-1 activates p21 to
inhibit UV-induced cell death. Oncogene 22:1703-1711
57. Bibollet-Bahena O, Almazan G 2009 IGF-1-stimulated protein synthesis in
oligodendrocyte progenitors requires PI3K/mTOR/Akt and MEK/ERK
pathways. J Neurochem 109:1440-1451
58. Hailey J, Maxwell E, Koukouras K, Bishop WR, Pachter JA, Wang Y
2002 Neutralizing anti-insulin-like growth factor receptor 1 antibodies
inhibit receptor function and induce receptor degradation in tumor cells. Mol
Cancer Ther 1:1349-1353
59. Altieri DC 2008 New wirings in the survivin networks. Oncogene 27:6276-
6284
60. Ling X, Li F 2004 Silencing of antiapoptotic survivin gene by multiple
approaches of RNA interference technology. BioTechniques 36:450-460
61. Shen C, Liu W, Buck AK, Reske SN 2009 Pro-apoptosis and anti-
proliferation effects of a recombinant dominant-negative survivin-T34A in
human cancer cells. Anticancer Res 29:1423-1428
62. Colnaghi R, Connell CM, Barrett RMA, Wheatley SP 2006 Separating
the anti-apoptotic and mitotic roles of survivin. J Biol Chem 281:33450-
33456
260
63. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL,
Choo KH 2000 Survivin and the inner centromere protein INCENP show
similar cell-cycle localization and gene knockout phenotype. Curr Biol
10:1319-1328
64. Lareyre JJ, Thomas TZ, Zheng WL, Kasper S, Ong DE, Orgebin-Crist
MC, Matusik RJ 1999 A 5-kilobase pair promoter fragment of the murine
epididymal retinoic acid-binding protein gene drives the tissue-specific, cell-
specific, and androgen-regulated expression of a foreign gene in the
epididymis of transgenic mice. J Biol Chem 274:8282-8290
65. Suzuki A, Araki Y, Zhu MY, Lareyre JJ, Matusik RJ, Orgebin-Crist
MC 2003 The 5'-flanking region of the murine epididymal protein of 17
kilodaltons gene targets transgene expression in the epididymis.
Endocrinology 144:877-886
66. Li F, Altieri DC 1999 Transcriptional analysis of human survivin gene
expression. Biochem J 344 Pt2:311
67. Boyce BF, Xing L 2007 Biology of RANK, RANKL, and osteoprotegerin.
Arthritis Res Ther 9(Suppl 1):S1-S1
68. Dougall WC, Glaccum M, Charrier K, Rohrbach K, Brasel K, De
Smedt T, Daro E, Smith J, Tometsko ME, Maliszewski CR, Armstrong
A, Shen V, Bain S, Cosman D, Anderson D, Morrissey PJ, Peschon JJ,
Schuh J 1999 RANK is essential for osteoclast and lymph node
development. Genes Dev 13:2412-2424
69. Stolina M, Guo J, Faggioni R, Brown H, Senaldi G 2003 Regulatory
effects of osteoprotegerin on cellular and humoral immune responses.
Clinical Immunology 109:347-354
261
70. Zhao J, Tenev T, Martins LM, Downward J, Lemoine NR 2000 The
ubiquitin-proteasome pathway regulates survivin degradation in a cell cycle-
dependent manner. Journal of Cell Science 113:4363-4371
71. Hittel D, Storey KB 2002 The translation state of differentially expressed
mRNAs in the hibernating 13-lined ground squirrel (Spermophilus
tridecemlineatus). Arch Biochem Biophys 401(2):244-254
262
LIST OF ORIGINAL CONTRIBUTIONS
1. Characterized the Brown Norway rat model system in terms of the effects of
androgen withdrawal and/or replacement on serum testosterone concentrations,
weights of empty seminal vesicles, ventral prostate, and epididymis.
2. Adapted an apoptosis-focused microarray experiment, which showed that
apoptotic and cell survival genes are regulated in a region-specific manner after
orchidectomy with or without testosterone replacement.
3. Identified 8 genes with known regulatory relationships with testosterone or the
androgen receptor and uncovered 21 apoptotic and cell survival genes potentially
regulated at the transcriptional level by the androgen receptor through the
identification of putative androgen response elements in their promoter region.
4. Identified a previously uncharacterized gene in the epididymis, Tnfrsf11b, as
well as two interacting proteins, Tnfsf11 and Tnfrsf11a.
5. Testosterone replacement represses Tnfrsf11b expression indicating that it is
regulated by androgens.
6. The epididymis expresses Tnfrsf11b at an average level as compared to other
rat tissues.
7. TNFRSF11B immunolocalizes to epididymal principal cells and shows a
different cellular localization between proximal and distal regions.
8. Rad52 expression decreases after orchidectomy with testosterone replacement.
This is the first study to identify a repair protein as being regulated by androgens.
9. Mcl1 expression is repressed by testosterone replacement in the proximal
regions, but increased in the distal regions.
263
10. Bmf has the highest induction of transcription in the initial segment after
orchidectomy and testosterone replacement first represses Bmf expression, but
then increases it.
11. Igf1 expression increases after orchidectomy in the epididymis and
testosterone replacement potentiates this increase.
12. Igf1r expression is repressed by orchidectomy and testosterone replacement
increases its expression, except in the cauda epididymis where it stays repressed.
13. Ide expression is rapidly increased after orchidectomy and this increase is not
prevented by testosterone replacement.
14. Igbp3 expression increases after orchidectomy and this increase is prevented
by testosterone replacement.
15. Birc5 expression is increased after orchidectomy and repressed by
testosterone replacement indicating that Birc5 is regulated by androgens.
16. There are five putative androgen response elements in the promoter region of
rat Birc5.
17. BIRC5 localizes to the cytoplasm of principal cells suggesting that it plays a
role as an anti-apoptotic protein in the epididymis.
18. BIRC5 expression is decreased after orchidectomy in the proximal regions;
this decrease is prevented by testosterone replacement in the caput epididymidis,
but not in the initial segment. This suggests post-transcriptional regulations of
BIRC5.
264
19. The epididymis has the second highest expression of Birc5 in rat tissues.
20. Diablo expression is increased after orchidectomy in the proximal regions, but
decreased in the distal regions; these changes cannot be prevented by testosterone
replacement.
21. Bax expression is repressed by testosterone replacement.
22. Bid expression increases after orchidectomy and this increase is not prevented
by testosterone replacement.
23. Members of the IGF1 signaling pathway are modulated differently after
orchidectomy with or without testosterone replacement with respect to time,
region of the epididymis and individual components of the pathway; this could
lead to a fine-tuned response of the epididymis.
24. Androgen withdrawal and blockade have no effect on PC-1 and DC-3 cell
viability, an outcome similar to what is observed in vivo.
25. DC-3 cells express both Tnfrsf11b and Birc5, whereas PC-1 cells only express
Birc5.
26. BIRC5 localizes to both the cytoplasm and nucleus of PC-1 cells.
27. PC-1 cells secrete more IGF1 than DC-3 cells under the same conditions.
28. Duration of pre-treatment of cells in charcoal-filtered FBS with DHT
supplementation has an effect on the amount of IGF1 secreted by PC-1 and DC-3
cells.
265
29. DHT supplementation increases Igf1r and Birc5 expression in DC-3 cells, but
not in PC-1 cells. These changes are not prevented by the presence of
hydroxyflutamide suggesting a potential non-transcriptional regulation of
expression.
30. The number of passages has little effect on the survival response of PC-1 cells
to androgen withdrawal.
31. Androgen treatment, withdrawal and blockade have no effect on Mcl1
transcription in PC-1 and DC-3 cells.
32. The DC-3 cell line, a previously uncharacterized in vitro model, is more
sensitive to androgens than PC-1 cells in terms of the markers studied, which
suggests that it could be a better model system to study androgen action.
266
267
APPENDIX 1
268
1. Materials and Methods
All procedures for the animal study were as described in chapter 2 with the
addition of adult male Sprague-Dawley (SD) rats (3-4 months old) obtained from
Charles River Canada (Saint-Constant, QC).
Procedures for orchidectomy, serum testosterone analysis, RNA extraction, and
Real- Time RT-PCR were as described in chapter 2.
1.1. K-means cluster analysis
In order to visualize the expression profiles of transcripts on the same vertical
axis, K-means cluster analysis was done on the total number of normalized probes
as described elsewhere (1). Number of clusters selected varied between 2 to 5
clusters.
2. Results and Discussion
2.1. The Brown Norway rat strain responded similarly to orchidectomy as
the Sprague-Dawley rat strain
To make sure that the Brown Norway (BN) rat strain was a suitable model
to study the effects of orchidectomy, we compared changes in serum T
concentrations and weights of ventral prostate, empty seminal vesicles, and
epididymis between BN rats and SD rats (fig. 1). We found that orchidectomy
caused a significant (p<0.05) decrease in serum T concentrations as early as 0.5
day after surgery in both BN and SD rats (fig. 1A). In terms of changes in ventral
prostate (fig. 1B), empty seminal vesicles (fig. 1C), and epididymis (fig. 1D)
weights both BN and SD followed a similar pattern of decrease. For the ventral
prostate and empty seminal vesicles, the first significant (p<0.05) decreases in
weights were observed at 3 days and 7 days for both strains (fig. 1B-C). However,
epididymal weight for the SD was significantly (p<0.05) decreased from 3 days to
7 days, whereas for the BN, the first significant (p<0.05) decrease was observed at
7 day after orchidectomy (fig. 1D). Together, these data showed that in terms of
serum T concentrations and weights of sex accessory tissues, BN and SD rats
269
behave similarly after orchidectomy. This made the BN strain a suitable model to
study the effects of orchidectomy on the epididymis.
2.2. Treatment- and region-specific changes in the number of affected
transcripts
Comparisons of the numbers of transcripts affected after orchidectomy
with or without testosterone replacement within each epididymal region showed
treatment-specific changes, except in the Cd in the 1 day (+T) group (supp. fig. 2).
The IS and Ca were the only two regions to have 3 and 2 transcripts, respectively,
commonly affected in all treatment groups. The Co had the highest number (total
of 9 transcripts) of commonly affected transcripts, especially between the (-T) 0.5
day and 1 day groups (7 common transcripts), whereas the Cd had the least with 2
common transcripts between (-T) 0.5 day and 1 day (fig. 2).
Comparisons of the numbers of transcripts affected after orchidectomy
with or without testosterone replacement within each treatment group showed
region-specific changes with only 1 transcript commonly affected in all regions at
0.5 day and 1 day without T replacement (fig. 3). At 0.5 day after orchidectomy
without T replacement, all regions had similar numbers of affected transcripts.
With time, there was a decrease in the number of affected transcripts in the IS
(from 11 to 9), but an increase in the Cd (from 12 to 17). T replacement at 0.5 day
decreased the number of affected transcripts in the IS (from 11 to 5) and Co (from
15 to 4), whereas at 1 day, the Co and Cd had decreased numbers of affected
transcripts (from 15 to 8 and from 17 to 5, respectively).
Together, these data showed treatment- and region-specific changes in the
numbers of affected transcripts.
2.3. Effects of tesoterone replacement on the number of affected transcripts
within each region
Numbers of transcripts differentially affected between (-T) and (+T)
groups at 0.5 day and 1 day after orchidectomy were determined for IS (fig. 4A),
Ca (fig. 4B), Co (fig. 4C), and Cd (fig. 4D). At 0.5 day, IS (fig. 4A) and Ca (fig.
270
4B) had similar numbers of up- and down-regulated transcripts (2-3 transcripts),
whereas Co (fig. 4C) had the highest number of down-regulated transcripts (10
transcripts). At 1 day, both IS (fig. 4A) and Co (fig. 4C) had 10 transcripts up-
regulated, whereas Ca (fig. 4B) and Cd (fig. 4D) had similar numbers of up-
regulated transcripts (5 and 6 transcripts, respectively). In addition, the IS (fig.
4A) was the only region with no down-regulated transcripts at 1 day. These data
demonstrated that T replacement changed gene expression in the different regions
of the epididymis.
2.4. Orchidectomy with or without testosterone replacement similarly
affected pro- and anti-apoptotic genes
Using K-means cluster analysis, we grouped changes in gene expression
after orchidectomy without (fig. 5) and with (fig. 6) T replacement in 2 to 5
groups representing different patterns of expression; the names of the affected
genes and their classification can be found in tables 1-8. In all groups and
treatment, the pro-apoptotic genes represented the majority of affected genes.
Without T replacement (fig. 5), the Co had the highest number of classified
affected genes (77 genes), whereas the IS had the lowest (59 genes); the Ca and
Cd showed similar numbers of affected genes with 67 and 66 genes, respectively.
In addition, the IS (fig. 5A) and Co (fig. 5C) had similar number of genes spread
across the different groups. On the other hand, in the group with genes showing a
transient increase of expression, both the Ca (fig. 5B) and Cd (fig. 5D) had the
lowest number of genes. With T replacement (fig. 6), the Cd had the highest
number of classified affected genes (86 genes), whereas the other regions showed
similar numbers (73, 69, and 74 genes for the IS, Ca, and Co, respectively). In all
regions, except the Co (fig. 6C), there were similar numbers of affected genes
spread across the different groups; in the Co, there were less genes increased at 1
day after orchidectomy compared to the other two groups. This demonstrated that
genes with different functions were similarly spread across the different patterns
of expression indicating that specific gene functions did not group into a
particular trend.
271
References 1. Ezer N, Robaire B 2003 Gene expression is differentially regulated in the
epididymis after orchidectomy. Endocrinology 144:975-988
272
Figure 1: Comparisons of the effects of orchidectomy on serum testosterone
concentration and weights of ventral prostate, empty seminal vesicles, and
epididymis between the Brown Norway and Sprague-Dawley rat strains.
Brown Norway (solid line) and Sprague-Dawley (dashed line) rats were
orchidectomized and sacrificed 0.5, 1, 2, 3, and 7 days after surgery. Serum
testosterone concentration (A) was measured by ELISA, whereas weights of
ventral prostate (B), empty seminal vesicles (C), and epididymis (D) were
recorded. Day 0 corresponds to sham-operated animals. Data are presented as
mean ± SEM (n=5-6/group). Significant effects (P<0.05) of time on serum
testosterone concentration and tissue weights are depicted by (*).
273
Figure 2: Numbers of differentially affected transcripts in the different
regions of the epididymis at 0.5 day and 1 day after orchidectomy with or
without testosterone replacement. The number of transcripts changing by at
least 1.5 fold as compared to sham-operated were determined in the IS, Ca, Co,
and Cd at 0.5 day after orchidectomy without testosterone replacement (blue
circle), with testosterone replacement (red circle) and at 1 day after orchidectomy
with testosterone replacement (yellow circle), without testosterone replacement
(green circle).
274
Figure 3: Numbers of differentially affected transcripts at 0.5 day and 1 day
after orchidectomy with or without testosterone replacement in the different
regions of the epididymis. The number of transcripts changing by at least 1.5
fold as compared to sham-operated were determined at 0.5 day and 1 day after
orchidectomy with or without testosterone replacement for the IS (blue circle), Ca
(red circle), Co (yellow circle), and Cd (green circle). Numbers in parentheses are
total numbers of affected transcripts in each region.
275
Figure 4: Number of transcripts changing at 0.5 day and 1 day after
orchidectomy between the without testosterone replacement group and the
with testosterone replacement group in the different regions of the
epididymis. The number of transcripts changing by at least 1.5 fold in either
direction (50% increase or 33% decrease) (vertical axis) was determined for the
IS (A), Ca (B), Co (C), and Cd (D). Fold change was determined at 0.5 day and 1
day after orchidectomy (horizontal axis) between the “without testosterone
replacement group” relative to the “with testosterone replacement group”. The
white bars indicate the number of transcripts increasing in expression (above x-
axis), whereas the grey bars indicate transcripts decreasing in expression (below
the x-axis). Each number was obtained independently at each treatment time.
276
277
Figure 5: Effects of orchidectomy on overall gene expression in the different
regions of the epididymis. Patterns of changes in gene expression were
determined by K-means analysis at 0 day, 0.5 day, and 1 day after orchidectomy
(horizontal axis) in the IS (A), Ca (B), Co (C), and Cd (D). Day 0 corresponds to
sham-operated values. Genes affected in each group were classified as pro-
apoptotic, anti-apoptotic, repair genes or genes with other functions.
278
279
Figure 6: Effects of orchidectomy with testosterone replacement on overall
gene expression in the different regions of the epididymis. Patterns of changes
in gene expression were determined by K-means analysis at 0 day, 0.5 day, and 1
day after orchidectomy with testosterone replacement (horizontal axis) in the IS
(A), Ca (B), Co (C), and Cd (D). Day 0 corresponds to sham-operated values.
Genes affected in each group were classified as pro-apoptotic, anti-apoptotic,
repair genes or genes with other functions.
280
Table 1: IS - K-means analysis: orchidectomy without testosterone replacement
Group 1 Total number of genes: 19 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD domain Pro-apoptotic Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD domain Pro-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Group 2 Total number of genes: 18 Gene symbol Common gene name Family Role in apoptosis Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair E2f5 E2F transcription factor 5 p53 and ATM Repair Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Rad52 Similar to Rad52 protein p53 and ATM Repair Chk2 Protein kinase Chk2 p53 and ATM Repair
281
Group 2 Total number of genes: 18 Gene symbol Common gene name Family Role in apoptosis Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic
Group 3 Total number of genes: 20 Gene symbol Common gene name Family Role in apoptosis Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death Effector domain Pro-apoptotic Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Ltb Lymphotoxin B TNF ligand Pro-apoptotic Rad23a Similar to UV excision repair protein RAD23 homolog A p53 and ATM Repair Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tradd TNFRSF1A-associated via death domain TRAF Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function
Unclassified Total number of genes: 34 Gene symbol Common gene name Family Role in apoptosis Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic
282
Unclassified Total number of genes: 34 Gene symbol Common gene name Family Role in apoptosis Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Cntnap1 Contactin associated protein 1 Other related genes Other related funciton Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Card9 Caspase recruitment domain protein 9 CARD family Pro-apoptotic Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rrad Ras-related associated with diabetes Other related genes Other related funciton Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related funciton Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related funciton Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic
283
Table 2: IS - K-means analysis: orchidectomy with testosterone replacement
Group 1 Total number of genes: 25 Gene symbol Common gene name Family Role in apoptosis Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD domain Pro-apoptotic Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Tp53 Tumor protein p53 p53 and ATM Repair Tradd TNFRSF1A-associated via death domain TRAF Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
Group 2 Total number of genes: 21 Gene symbol Common gene name Family Role in apoptosis Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic
284
Group 2 Total number of genes: 21 Gene symbol Common gene name Family Role in apoptosis E2f5 E2F transcription factor 5 p53 and ATM Repair Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair LOC64171 Caspase recruitment domain protein 9 CARD family Pro-apoptotic Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Ltb Lymphotoxin B TNF ligand Pro-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Rad52 Similar to Rad52 protein p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic
Group 3 Total number of genes: 27 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD domain Pro-apoptotic Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cntnap1 Contactin associated protein 1 Other related genes Other related function Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death Effector domain Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Rrad Ras-related associated with diabetes Other related genes Other related function Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function
285
Group 3 Total number of genes: 27 Gene symbol Common gene name Family Role in apoptosis Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Unclassified Total number of genes: 18 Gene symbol Common gene name Family Role in apoptosis Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic
286
Table3: Ca - K-means analysis orchidectomy without testosterone maintenance
Group 1 Total number of genes: 14 Gene symbol Common gene name Family Role in apoptosis Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Group 2 Total number of genes: 9 Gene symbol Common gene name Family Role in apoptosis Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Rad52 Similar to Rad52 protein p53 and ATM Repair Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic
Group 3 Total number of genes: 17 Gene symbol Common gene name Family Role in apoptosis Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic Card9 Caspase recruitment domain protein 9 CARD Pro-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair
287
Group 3 Total number of genes: 17 Gene symbol Common gene name Family Role in apoptosis Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Rrad Ras-related associated with diabetes Other related genes Other Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tradd TNFRSF1A-associated via death domain TRAF Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function
Group 4 Total number of genes: 20 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD family Pro-apoptotic Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD family Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cntnap1 Contactin associated protein 1 Other related genes Other related function E2f5 E2F transcription factor 5 p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function
Group 5 Total number of genes: 7 Gene symbol Common gene name Family Role in apoptosis Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death Effector domain Pro-apoptotic Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair
288
Group 5 Total number of genes: 7 Gene symbol Common gene name Family Role in apoptosis Ltb Lymphotoxin B TNF ligand Pro-apoptotic Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic
Unclassified Gene symbol Common gene name Family Role in apoptosis Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic
289
Table 4: Ca - K-means analysis orchidectomy with testosterone maintenance
Group 1 Total number of genes: 37 Gene symbol Common gene name Family Role in apoptosis Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD family Pro-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic E2f5 E2F transcription factor 5 p53 and ATM Repair Ltb Lymphotoxin B TNF ligand Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Rad52 Similar to Rad52 protein p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Tradd TNFRSF1A-associated via death domain TRAF Other related function Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
290
Group 2 Total number of genes: 32 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD family Pro-apoptotic Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Cntnap1 Contactin associated protein 1 Other related genes Other related function Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death Effector domain Pro-apoptotic Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Card9 Caspase recruitment domain protein 9 CARD Pro-apoptotic Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Rrad Ras-related associated with diabetes Other related genes Other related function Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Unclassified Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic
291
Unclassified Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic
292
Table 5: Co - K-means analysis orchidectomy without testosterone maintenance
Group 1 Total number of genes: 21 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD family Pro-apoptotic Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic E2f5 E2F transcription factor 5 p53 and ATM Repair Fadd Fas (TNFRSF6)-associated via death domain Death Effector domain Pro-apoptotic Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Group 2 Total number of genes: 26 Gene symbol Common gene name Family Role in apoptosis Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rad52 Similar to Rad52 protein p53 and ATM Repair Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic
293
Group 2 Total number of genes: 26 Gene symbol Common gene name Family Role in apoptosis Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function
Group 3 Total number of genes: 30 Gene symbol Common gene name Family Role in apoptosis Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD domain Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Cntnap1 Contactin associated protein 1 Other related genes Other related function Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Card9 Caspase recruitment domain protein 9 TNF ligand Pro-apoptotic Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 CARD domain Pro-apoptotic Ltb Lymphotoxin B TNF ligand Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Rrad Ras-related associated with diabetes Other related genes Other related function Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic
294
Group 3 Total number of genes: 30 Gene symbol Common gene name Family Role in apoptosis Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Tradd TNFRSF1A-associated via death domain TRAF Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
Unclassified Total number of genes: 14 Gene symbol Common gene name Family Role in apoptosis Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic
295
Table 6: Co - K-means analysis orchidectomy with testosterone maintenance
Group 1 Total number of genes: 25 Gene symbol Common gene name Family Role in apoptosis Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death effector domain Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Cntnap1 Contactin associated protein 1 Other related genes Other related function Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Card9 Caspase recruitment domain protein 9 CARD domain Pro-apoptotic Ltb Lymphotoxin B TNF ligand Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Rrad Ras-related associated with diabetes Other related genes Other related function Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Tradd TNFRSF1A-associated via death domain TRAF Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
Group 2 Total number of genes: 17 Gene symbol Common gene name Family Role in apoptosis Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD family Pro-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic
296
Group 2 Total number of genes: 17 Gene symbol Common gene name Family Role in apoptosis E2f5 E2F transcription factor 5 p53 and ATM Repair Rad52 Similar to Rad52 protein p53 and ATM Repair Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function
Group 3 Total number of genes: 32 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD family Pro-apoptotic Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death effector domain Anti-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death effector domain Pro-apoptotic Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic
297
Group 3 Total number of genes: 32 Gene symbol Common gene name Family Role in apoptosis Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Unclassified Total number of genes: 17 Gene symbol Common gene name Family Role in apoptosis Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNFR Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic
298
Table 7: Cd - K-means analysis orchidectomy without testosterone maintenance
Group 1 Total number of genes: 18 Gene symbol Common gene name Family Role in apoptosis Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death Effector domain Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death Effector domain Anti-apoptotic Card9 Caspase recruitment domain protein 9 CARD Pro-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function
Group 2 Total number of genes: 10 Gene symbol Common gene name Family Role in apoptosis Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic E2f5 E2F transcription factor 5 p53 and ATM Repair Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function
299
Group 2 Total number of genes: 10 Gene symbol Common gene name Family Role in apoptosis Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
Group 3 Total number of genes: 15 Gene symbol Common gene name Family Role in apoptosis Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Rad52 Similar to Rad52 protein p53 and ATM Repair Rfng Radical fringe gene homolog (Drosophila) Othe related genes Other related function Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Rrad Ras-related associated with diabetes Othe related genes Other related function Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function
Group 4 Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD Pro-apoptotic Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bax Bcl2-associated X protein Bcl2 Pro-apoptotic
300
Group 4 Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Bcl10 B-cell CLL/lymphoma 10 CARD Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Tradd TNFRSF1A-associated via death domain TRAF Other related function Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
Unclassified Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp12 Caspase 12 Caspase Pro-apoptotic
301
Unclassified Total number of genes: 22 Gene symbol Common gene name Family Role in apoptosis Casp7 Caspase 7 Caspase Pro-apoptotic Cntnap1 Contactin associated protein 1 Other related genes Other related function Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domain Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domain Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic
302
Table 8: Cd - K-means analysis orchidectomy with testosterone maintenance
Group 1 Total number of genes: 26
Gene symbol Common gene name Family Role in apoptosis Pycard Apoptosis-associated speck-like protein containing a CARD CARD domain Pro-apoptotic Bcl2a1 B-cell leukemia/lymphoma 2 related protein A1 Bcl2 Anti-apoptotic Bcl2l10 Bcl2-like 10 Bcl2 Anti-apoptotic Becn1 Beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) Bcl2 Anti-apoptotic Biklk Bcl2-interacting killer-like Bcl2 Pro-apoptotic Birc1b Baculoviral IAP repeat-containing 1b IAP Anti-apoptotic Birc3 Inhibitor of apoptosis protein 1 IAP Anti-apoptotic Casp4 Caspase 11 Caspase Pro-apoptotic Casp2 Caspase 2 Caspase Pro-apoptotic Casp6 Caspase 6 Caspase Pro-apoptotic Casp8 Caspase 8 Caspase Pro-apoptotic Casp8ap2 Midasin homolog (yeast) (predicted) Death effector domain Pro-apoptotic Casp9 Caspase 9 Caspase Pro-apoptotic Chek1 Checkpoint kinase 1 homolog (S. pombe) p53 and ATM Repair Cidea Cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
(predicted) CIDE domain Pro-apoptotic
Dap3 Death associated protein 3 (predicted) Death domain Pro-apoptotic Dlk Similar to Death-associated protein kinase 3 Death domain Pro-apoptotic E2f5 E2F transcription factor 5 p53 and ATM Repair Gadd45a Growth arrest and DNA-damage-inducible 45 alpha p53 and ATM Repair Card9 Caspase recruitment domain protein 9 CARD domain Pro-apoptotic Ltb Lymphotoxin B TNF ligand Pro-apoptotic Rad1 Similar to Rad1p (LOC294800), mRNA p53 and ATM Repair Rad23a Similar to UV excision repair protein RAD23 homolog A (MHR23A) p53 and ATM Repair Chek2 Protein kinase Chk2 p53 and ATM Repair Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10 TNF ligand Pro-apoptotic Tnfsf13 Tumor necrosis factor ligand superfamily, member 13 TNF ligand Pro-apoptotic
303
Group 2 Total number of genes: 27
Gene symbol Common gene name Family Role in apoptosis Bak1 BCL2-antagonist/killer 1 Bcl2 Pro-apoptotic Bcl2 B-cell leukemia/lymphoma 2 Bcl2 Anti-apoptotic Bcl2l1 Bcl2-like 1 Bcl2 Anti-apoptotic Bid3 BH3 interacting (with BCL2 family) domain, apoptosis agonist Bcl2 Pro-apoptotic Bok Bcl-2-related ovarian killer protein Bcl2 Pro-apoptotic Cflar CASP8 and FADD-like apoptosis regulator Death effector domain Anti-apoptotic Fadd Fas (TNFRSF6)-associated via death domain Death effector domain Pro-apoptotic Mcl1 Myeloid cell leukemia sequence 1 Bcl2 Anti-apoptotic Rad50 RAD50 homolog (S. cerevisiae) p53 and ATM Repair Rad52 Similar to Rad52 protein p53 and ATM Repair Rfng Radical fringe gene homolog (Drosophila) Other related genes Other related function Ripk2 Similar to receptor-interacting protein 2 (LOC362491), mRNA Death domain Pro-apoptotic Rrad Ras-related associated with diabetes Other related genes Other related function Tank TRAF family member-associated Nf-kappa B activator TRAF Pro-apoptotic Tnfaip2 Similar to [Mouse primary response gene B94 mRNA, 3end.], gene product Other related genes Other related function Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) TNFR Anti-apoptotic Tnfrsf1b Tumor necrosis factor receptor superfamily, member 1b TNFR Anti-apoptotic Tnfrsf4 Tumor necrosis factor receptor superfamily, member 4 TNFR Anti-apoptotic Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 TNFR Pro-apoptotic Tnfsf15 Tumor necrosis factor (ligand) superfamily, member 15 TNF ligand Pro-apoptotic CD70 Similar to CD70 protein (CD27 ligand) (LOC301132), mRNA TNF ligand Pro-apoptotic Tnfsf9 Tumor necrosis factor (ligand) superfamily, member 9 TNF ligand Other related function Tnfaip3 TNFAIP3 interacting protein 2 (predicted) Other related genes Other related function Zranb1 Zinc finger, RAN-binding domain containing 1 (predicted) TRAF Other related function Traf2 Tnf receptor-associated factor 2 (predicted) TRAF Anti-apoptotic Traf4 Similar to TNF receptor associated factor 4 (LOC303285), mRNA TRAF Anti-apoptotic Ube2n Ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13) Other related genes Other related function
304
Group 3 Total number of genes: 23
Gene symbol Common gene name Family Role in apoptosis Apaf1 Apoptotic peptidase activating factor 1 CARD family Pro-apoptotic Atm Ataxia telangiectasia mutated homolog (human) p53 and ATM Repair Bad Bcl2-associated death promoter Bcl2 Pro-apoptotic Baiap2 Brain-specific angiogenesis inhibitor 1-associated protein 2 Other related genes Other related function Bax Bcl2-associated X protein Bcl2 Pro-apoptotic Bcl10 B-cell CLL/lymphoma 10 CARD family Pro-apoptotic Bcl2l2 Bcl2-like 2 Bcl2 Anti-apoptotic Bnip1 BCL2/adenovirus E1B 19kDa-interacting protein 1 Bcl2 Anti-apoptotic Bnip3 BCL2/adenovirus E1B 19 kDa-interacting protein 3 Bcl2 Pro-apoptotic Bnip3l BCL2/adenovirus E1B 19 kDa-interacting protein 3-like Bcl2 Pro-apoptotic Myd88 Myeloid differentiation primary response gene 88 Death domain Pro-apoptotic Ngfrap1 Nerve growth factor receptor associated protein 1 TNFR Pro-apoptotic Tnfrsf12a Tumor necrosis factor receptor superfamily, member 12a TNFR Pro-apoptotic Tnfrsf1a Tumor necrosis factor receptor superfamily, member 1a TNFR Pro-apoptotic Tnfsf12 Tumor necrosis factor ligand superfamily member 12 TNF ligand Pro-apoptotic Tp53 Tumor protein p53 p53 and ATM Repair Tradd TNFRSF1A-associated via death domain TRAF Other related function Traip TRAF-interacting protein (predicted) TRAF Pro-apoptotic Ube1c Ubiquitin-activating enzyme E1C Other related genes Other related function Ube1x Similar to ubiquitin-protein ligase (EC 6.3.2.19) E1 - mouse Other related genes Other related function Ube2d2 Ubiquitin-conjugating enzyme E2D 2 Other related genes Other related function Ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Other related genes Other related function Ube2i Ubiquitin-conjugating enzyme E2I Other related genes Other related function
Unclassified Total number of genes: 15
Gene symbol Common gene name Family Role in apoptosis Bcl2l11 BCL2-like 11 (apoptosis facilitator) Bcl2 Pro-apoptotic Birc5 Baculoviral IAP repeat-containing 5 IAP Anti-apoptotic Bmf Bcl-2 modifying factor Bcl2 Pro-apoptotic
305
Unclassified Total number of genes: 15
Gene symbol Common gene name Family Role in apoptosis Casp12 Caspase 12 Caspase Pro-apoptotic Casp7 Caspase 7 Caspase Pro-apoptotic Cntnap1 Contactin associated protein 1 Other related genes Other related function Cradd CASP2 and RIPK1 domain containing adaptor with death domain (predicted) Death domain Pro-apoptotic Dffa DNA fragmentation factor, alpha subunit CIDE domaine Pro-apoptotic Dffb DNA fragmentation factor, beta subunit CIDE domaine Pro-apoptotic E2f3 Similar to E2f3 protein (LOC291105), mRNA p53 and ATM Repair E2f6 E2F transcription factor 6 p53 and ATM Repair Tnfsf5 Tumor necrosis factor (ligand) superfamily, member 5 TNF ligand Pro-apoptotic Ltbr Lymphotoxin B receptor (predicted) TNFR Pro-apoptotic Tnfrsf26 Tumor necrosis factor receptor superfamily, member 26 (predicted) TNFR Other related function Tnfrsf10b Similar to TRAIL receptor2 KILLER/DR5 homologue (LOC364420), mRNA TNFR Pro-apoptotic
306
307
APPENDIX 2
308
1. Materials and Methods
RNA extraction, Real-Time RT-PCR, and immunohistochemistry were done as
described in chapter 3.
1.1. Dot blot
First-strand cDNA synthesis was carried out using 1μg total RNA, random
primers (Invitrogen, Mississauga, ON), 10mM dNTP mix (Invitrogen), and
SuperScriptTM III RT (Invitrogen). The synthesized cDNA was then used as a
template for PCR amplification using primers for Birc5 (forward 5’-
CTGATTTGGCCCAGTGTTTT -3’; reverse 5’-
TCCATTACCCCATGGTAGGA -3’) and 18S rRNA (forward 5’-
AAACGGCTACCACATCCAAG-3’; reverse 5’-
AGTCGGCATCGTTTATGGTC-3’) designed using Primer3 software
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/) and synthesized by
AlphaDNA (www.alphadna.com, Montreal, QC). The cycling conditions were as
follow: 2 min at 940C, 40 cycles of 30 sec at 940C, 1 min at 560C, and 1 min at
720C, followed by 5 min at 720C, and 40C O/N. For dot blot analysis, PCR
samples were prepared by adding 0.5M EDTA, 6N NaOH, and 2M NH4OAc.
Samples were loaded into a dot-blot manifold (Bio-Rad, Mississauga, ON) to be
transferred onto a nitrocellulose membrane (Bio-Rad). Filter was removed and
soaked for 15 sec in 6X SSC+0.1% SDS. The membrane was cross-linked under
UV light for 4 min. Membranes were soaked for 2-4h at 420C in pre-hybridization
solution [20X SSC, 50X Denhardt’s, 20mg/ml tRNA (Roche Applied Science,
Laval, QC), 20% SDS, and ddH2O]. The internal oligonucleotide probe for Birc5
(GCGCCTTCCTTACAGTCAAG) and 18S rRNA
(CGCGGTTCTATTTTGTTGGT) were designed using Primer3 software and
synthesized by AlphaDNA. Fifty ng of oligonucleotide probe was labeled using
γP32 (PerkinElmer, Woodbridge, ON), kinase buffer (Roche Applied Science),
and T4 kinase (Roche Applied Science). It was incubated for 1-2h at 370C and
passed trough a G-25 sephadex column. An activity of 104-105 cpm/ng was
309
considered good. Labeled oligonucleotide was added to the hybridization solution
(20X SSC, 20% SDS, and ddH2O) at a concentration of 6x106cmp/ml.
1.2. Cloning of the 3kb-upstream promoter region of Birc5
Genomic DNA was extracted from rat testis using the Wizard Genomic DNA
purification kit (Promega, Madison, WI) following the manufacturer’s
instructions. Concentration and quality of extracted DNA were assessed using a
nanodrop 2000 spectrophotometer (Thermo Scientific, Mississauga, ON).
Different sets of primers covering no ARE or all 5 AREs in the 3kb-upstream
promoter of Birc5 were designed using Primer3 software and synthesized by
AlphaDNA. PCR amplification was done using 50ng to 500ng of genomic DNA ,
10mM dNTP mix (Invitrogen) and Taq DNA polymerase (Invitrogen) using the
following cycling conditions: 2min at 940C, 40 cycles of 1min at 940C, 1min at
550C, 3min at 720C, then 10min at 720C. Efficiency of amplification was checked
by running the amplified products on 1% agarose gels. Products were cleaned
using the Wizard SV Gel and PCR Clean-Up System (Promega) following the
manufacturer’s instructions. PCR inserts were cloned into vectors using the
pBlue-TOPO reporter kit (Invitrogen) following the manufacturer’s instructions.
Competent TOP10 cells were then transformed with vectors and plated onto LB
plates O/N. When colonies formed, 10 of them were selected and amplified into
LB medium. Vectors were extracted from cells using the Qiaprep Spin Miniprep
(Qiagen Inc.) following the manufacturer’s instructions. Potential positive clones
were identified by restriction analysis using BanHI, BsaAI, and SspI (New
England BioLabs Inc., Pickering, ON).
2. Results
2.1. Birc5 was highly expressed in the epididymis
We assessed the presence of Birc5 in different rat tissues qualitatively by
dot blot and quantitatively by qRT-PCR (fig. 1). We found that Birc5 was
expressed in all tissues examined with very low expression observed in the
coagulating gland, heart, kidney, liver, dorsal prostate, lateral prostate, ventral
310
prostate, and vas deferens. The testis had the highest expression of Birc5,
followed by the different epididymal regions and seminal vesicles. This suggested
that BIRC5 may play a role in the epididymis.
2.2. BIRC5 localized in the cyptoplasm of principal cells
We determined the immunolocalization of BIRC5 in the different regions
of the epididymis (fig. 2). In all regions, BIRC5 was localized to the cytoplasm of
most cell types, except the clear cells of the Cd (fig. 2E). This data pointed to a
role of BIRC5 as an anti-apoptotic protein in the epididymis.
2.3. Effects of orchidectomy with or without testosterone replacement on
Birc5 mRNA expression in the ventral prostate and seminal vesicles
We assessed the effects of orchidectomy with or without testosterone
replacement on Birc5 mRNA expression in the ventral prostate (fig. 3A) and
seminal vesicles (fig. 3B). After orchidectomy, Birc5 mRNA was significantly
(p<0.05) increased at 3 and 7 days in the ventral prostate (fig. 3A), whereas it was
significantly (p<0.05) decreased in the seminal vesicles (fig. 3B). Testosterone
(T) replacement could not prevent the increase in Birc5 mRNA in the ventral
prostate, although it decreased its extent (fig. 3A). In the seminal vesicles, T
replacement significantly (p<0.05) increased Birc5 mRNA at only 3 days (fig.
3B).
2.4. Cloning the 3kb-upstream promoter region of rat Birc5
Using the pBlue-TOPO reporter kit, we could not clone the proper inserts for the
promoter regions covering no ARE and 5AREs of the rat Birc5 gene. To
optimize, we tried different amounts of starting genomic DNA, different sets of
primers, different PCR conditions including varying MgCl2 concentrations, and
different insert to vector molar ratio for transformation.
311
3. Discussion
It is widely accepted that BIRC5 is absent in terminally differentiated
tissues, but highly expressed in most known cancers. This idea is derived from a
study by Ambrosini et al. (2) that could not detect Birc5 expression in a wide
variety of adult tissues, but could in many cancers and lymphomas. It was later
shown that Birc5 was expressed in thymocytes (2), CD34+ bone-marrow-derived
stem cells (3), basal colonic epithelial cells (4), placenta (2), ovaries (5), and testis
(6), all mitotically-active cells and tissues. Here, we report low expression of
Birc5 in most adult rat tissues examined with high expression in testis and the
terminally-differentiated epididymis, using dot blot and qRT-PCR. Previously,
heart, liver, kidney were shown to be negative for Birc5 using northern blot (2).
The fact that we could detect Birc5 in those tissues, whereas others could not, is
due to the higher sensitivity of the two techniques we used as compared to
northern blot.
BIRC5 not only acts as an anti-apoptotic protein, but also as a regulator of
mitosis by associating with the inner centromere protein (INCENP) and Aurora B
thereby targeting the complex to kinetochores. It also corrects misaligned
chromosomes, works to properly form the central spindle, and completes
cytokinesis (7;8). In fact, function of BIRC5 in apoptosis or cell division has been
associated with specific subcellular compartment; anti-apoptotic BIRC5 localizes
to the cytoplasm, whereas mitotic BIRC5 resides in the nucleus (9). We have
shown that in the epididymis, BIRC5 localizes to the cytoplasm of epithelial cells
indicating a role as an anti-apoptotic protein.
The ventral prostate and seminal vesicles are androgen-sensitive tissues
used as biomarkers of serum androgen concentrations (10). It is therefore
interesting to assess their response to orchidectomy with or without T
replacement. After orchidectomy, Birc5 mRNA expression was increased in the
ventral prostate, but decreased in the seminal vesicles; T replacement increased
Birc5 expression in both ventral prostate and seminal vesicles. The pattern
observed in the ventral prostate was similar to the one observed for the
epididymis. It is noteworthy that orchidectomy had opposite effects in the ventral
312
prostate and seminal vesicles, whereas T replacement caused a similar trend in
both tissues. These results highlight differences in transcriptional regulation in
two androgen-dependent tissues.
Changes in Birc5 mRNA expression after orchidectomy with or without
testosterone replacement suggested that Birc5 could be regulated at the
transcriptional level by androgens. In fact, we found 5 putative AREs in the
upstream promoter region of Birc5. However, our attempts at cloning the regions
covering no ARE and 5AREs using the pBlue-TOPO reporter kit were
unsuccessful due to the difficulty to amplify the proper inserts. This problem was
caused by the difficulty at designing primers with the right length, %GC content,
and 3’ sequence to amplify the desired regions; these 3 parameters are essential
for proper amplification (11). An alternative method to clone the desired promoter
regions would be to use genomic library screening. In addition, pLuc vectors
containing up to 6270bp upstream of the human Birc5 promoter are available and
could be used to carry out reporter assays (11).
313
References 1. Seenundun S, Robaire B 2007 Time-dependent rescue of gene expression
by androgens in the mouse proximal caput epididymidis-1 cell line after
androgen withdrawal. Endocrinology 148:173-188
2. Ambrosini G, Adida C, Altieri DC 1997 A novel anti-apoptosis gene,
survivin, expressed in cancer and lymphoma. Nat Med 3:917-921
3. Fukuda S, Pelus LM 2001 Regulation of the inhibitor-of-apoptosis family
member survivin in normal cord blood and bone marrow CD34(+) cells by
hematopoietic growth factors: implication of survivin in normal
hematopoiesis. Blood 98:2091-2100
4. Gianani R, Jarboe E, Orlicky D, Frost M, Bobak J, Lehner R, Shroyer
KR 2001 Expression of survivin in normal, hyperplastic, and neoplastic
colonic mucosa. Hum Pathol 32:119-125
5. Johnson AL, Langer JS, Bridgham JT 2002 Survivin as a cell cycle-
related and antiapoptotic protein in granulosa cells. Endocrinology
143:3405-3413
6. Weikert S, Schrader M, Christoph F, Schulze W, Krause H, Müller M,
Miller K 2005 Quantification of survivin mRNA in testes of infertile
patients and in testicular germ cell tumours: high levels of expression
associated with normal spermatogenesis. Int J Androl 28:224-229
314
7. Honda R, Korner R, Nigg EA 2003 Exploring the functional interactions
between aurora B, INCENP, and survivin in mitosis. Mol Biol Cell 14:3325-
3341
8. Wheatley SP, Carvalho A, Vagnarelli P, Earnshaw WC 2001 INCENP is
required for proper targeting of survivin to the centromeres and the
anaphase spindle during mitosis. Curr Biol 11:886-890
9. Altieri DC 2008 New wirings in the survivin networks. Oncogene 27:6276-
6284
10. Chen H, Luo L, Liu J, Brown T, Zirkin BR 2005 Aging and caloric
restriction: Effects on Leydig cell steroidogenesis. Experimental
Gerontology 40:498-505
11. Abd-Elsalam KA 2003 Bioinformatic tools and guideline for PCR primer
design. African Journal of Biotechnology 2:91-95
315
Figure 1: Identification of Birc5 in different rat tissues. Presence of Birc5 in
IS, Ca, Co, Cd, coagulating gland, heart, kidney, liver, dorsal prostate, lateral
prostate, ventral prostate, seminal vesicles, testis, and vas deferens was assessed
by dot blot (A) and qRT-PCR (B). To confirm equal loading of RNA in the dot
blot experiment, membranes were probed with an 18S probe. Birc5 mRNA
expression for the qRT-PCR experiment was normalized to Ppia (cyclophilin A)
expression. Data are presented as mean ± SEM (n=3/group).
316
Figure 2: BIRC5 immunolocalization in the different regions of the
epididymis. Epididymides of control animals (n=5) were fixed by Bouin’s
fixation, stained with an anti-BIRC5 antibody, and counterstained with methylene
blue. Immunolocalization was determined in the IS (B), Ca (C), Co (D), and Cd
(E). (A) shows a slide incubated with only secondary antibody. The insert in (B)
shows a higher magnification of the labelled narrow cell. E: epithelium; L: lumen;
I: interstitium; P: principal cells; N: narrow cells; C: clear cells. The bar
represents 2µm.
317
Figure 3: Effects of orchidectomy with or without testosterone replacement
on Birc5 mRNA expression in the ventral prostate and seminal vesicles. Rats
were orchidectomized with empty (black bars) or testosterone-filled (grey bars)
implants and sacrificed 0.5, 1, 3, and 7 days after surgery. Changes in Birc5
mRNA expression were assayed by qRT-PCR in the ventral prostate (A) and
seminal vesicles (B). Birc5 expression was normalized to Ppia (cyclophilin A)
expression. Day 0 corresponds to sham-operated animals (white bars). Data are
presented as mean ±SEM (n=5/group). Significant effects (p<0.05) of treatment
on expression are depicted by (**) and significant changes as compared to sham-
operated are depicted by (*).
318
319
APPENDIX 3
320
1. Materials and Methods
RNA extraction, Real-Time PCR, cell viability, and IGF1 ELISA were done as
described in chapter 4.
Primers for Mcl1 were forward 5’-TTCTTTCGGTGCCTTTGTG-3’ and reverse
5’-CATCCCAGCCTCTTTGTTTG-3’.
1.1. Cell culture
The mouse proximal caput epididymis PC-1 cell line (passage #15) and the mouse
distal caput epididymis DC-3 cell line (passage #10) (kindly provided by Dr. M.-
C. Orgebin-Crist, Department of Obstetrics and Gynecology, Vanderbilt
University School of Medicine, Nashville, TN) were grown as described in
chapter 4. PC-1 cells passage #15 were treated as described in chapter 4; media
and cells for RNA extraction were collected after 3h, 6h, 12h, 24h, and 48h of
treatment. The experiment was repeated 3 times; values were the means of the 3
individual experiments.
1.2. One-step PCR
Presence of Tnfrsf11b (QT00177170, Qiagen Inc., Mississauga, ON) and Birc5
(QT00113379, Qiagen Inc.) in the PC-1 cells was determined by one-step PCR
under the following cycling conditions: 500C for 30min, 950C for 15min, 40
cycles of 1min at 940C, 1min at 550C, 1min at 720C, followed by 10min at 720C,
and 40C O/N. Amplified PCR samples were run on 1% agarose gels.
1.3. Two-steps RT-PCR
Two-steps RT-PCR was done to determine if Tnfrsf11b was expressed in the DC-
3 cells. First, RNA was reverse transcribed into cDNA using 1μg total RNA,
random primers (Invitrogen Canada Inc., Burlington, ON), 10mM dNTP mix
(Invitrogen Canada Inc.), and SuperScriptTM II RT (Invitrogen Canada Inc.) under
the following cycling conditions: 650C for 2min, 40C for 2min, 250C for 5min,
500C for 60min, 700C for 15min, then samples were kept at 40C. The synthesized
cDNA was then used as a template for PCR amplification using primers for
321
Tnfrsf11b (QT00177170, Qiagen Inc.). The cycling conditions were as follow: 2
min at 940C, 40 cycles of 30 sec at 940C, 1 min at 560C, and 1 min at 720C,
followed by 5 min at 720C, and 40C O/N. Amplified PCR samples were run on a
1% agarose gel.
1.4. Immunofluorescence
PC-1 cells were fixed with 1% formalin in PBS and slides were incubated
overnight at 4°C with a primary rabbit antibody against BIRC5 (1:1500, #2808,
Cell Signaling Technology, Danvers, MA). Slides were then probed with a FITC-
conjugated goat anti-rabbit secondary antibody (Jackson ImmunoResearch
Laboratories Inc., West Grove, PA) and mounted using DAPI-containing
Vectashield (#H-1200, Vector Laboratories Inc., Burlington, CA).
2. Results and Discussion
2.1. Birc5 was expressed in both PC-1 and DC-3 cells and Tnfrsf11b only in
DC-3 cells
Presence of Birc5 and Tnfrsf11b transcripts was assessed in the PC-1 and DC-3
cell lines before any experiment was conducted. PC-1 cells expressed Birc5
transcripts (fig. 1A), but not Tnfrsf11b (data not shown); the amplified fragment
was expected to be below 250bp. On the other hand, DC-3 cells were shown to
express Birc5 (chapter 4) and Tnfrsf11b (fig. 1B); the amplified fragment was
expected to be between 100bp and 200bp. This suggested that PC-1 and DC-3
cells were good model systems to study Birc5, but only DC-3 cells could be used
to study Tnfrsf11b.
2.2. BIRC5 localized to both cytoplasm and nucleus in the PC-1 cells
BIRC5 function as a protein involved in cell division and/or cell survival is
associated with its cellular localization. In fact, when BIRC5 is localized in the
cytoplasm, it acts as an anti-apoptotic protein, whereas in the nucleus, it is
involved in cell division (1). To assess the potential roles of BIRC5 in the PC-1
cells, we determined its cellular localization (fig. 2). We found that BIRC5 was
322
localized in both the nucleus and cytoplasm of PC-1 cells (fig. 2) as well as in the
midbody of dividing cells (fig. 2D-F). This suggested that BIRC5 was involved in
cell division and potentially cell survival in the PC-1 cells.
2.3. Androgen treatment, withdrawal and/or blockade had no effect on Birc5,
Igf1, and Igf1r mRNA expression over time in the PC-1 cell line
Changes in mRNA expression for Birc5 (fig. 3A), Igf1 (fig. 3B), and Igf1r (fig.
3C) were assessed for passage #15 PC-1 cells. Over time, there was no change in
Birc5 (fig. 3A), Igf1 (fig. 3B), and Igf1r (fig. 3C) mRNA expression among the
different treatment groups.
2.4. Androgen treatment, withdrawal and/or blockade had no effect on IGF1
concentration
Although, Igf1 mRNA expression did not change over time in the PC-1 cells, it
was still possible that concentration of IGF1 in the media would increase over
time after androgen withdrawal and/or blockade. Concentration of IGF1 in the
media over time did not change after androgen withdrawal and/or blockade (fig.
4).
2.5. Passage number did not affect viability of PC-1 cells after androgen
treatment, withdrawal and/or blockade
In order to assess if the passage number could have an effect on the response of
the PC-1 cells to androgen withdrawal and/or blockade, we determined the cell
viability of passage #20 PC-1 cells. Viability of passage #20 PC-1 cells was not
affected by the different treatment conditions (fig. 5) and they responded similarly
to passage #10 PC-1 cells (chapter 4). This suggested that at least to passage #20,
viability of PC-1 cells after androgen withdrawal and/or blockade was similar to
earlier passages PC-1 cells.
323
2.6. Androgen treatment, withdrawal and/or blockade had no effect on Mcl1
mRNA expression
We assessed changes in mRNA expression for Mcl1 in the PC-1 and DC-3 cells
after androgen withdrawal and/or blockade (fig. 6). Mcl-1 is a Bcl2 family
member that prevents apoptosis by binding and inactivating pro-apoptotic Bcl2
members (2). Mcl1 has also been shown to be differentially regulated after
orchidectomy in the epididymis (unpublished data) (3). We found that treatments
had no effect on Mcl1 expression in both PC-1 and DC-3 cells (fig. 6).
324
References
1. Altieri DC 2006 The case of survivin as a regulator of microtubule
dynamics and cell-death decisions. Curr Opin Cell Biol 18:609-615
2. Hogarty MD 2010 Mcl1 becomes ubiquitin-ous: new opportunities to
antagonize a pro-survival protein. Cell Res 20:391-393
3. Ezer N, Robaire B 2003 Gene expression is differentially regulated in the
epididymis after orchidectomy. Endocrinology 144:975-988
325
Figure 1: Presence of Birc5 and Tnfrsf11b in the PC-1 and DC-3 cell lines.
PC-1 (A) and DC-3 (B) cells were cultured in FBS-containing medium with DHT.
Cells were collected for RNA extraction (n=3-5). Presence of Birc5 and Tnfrsf11b
in the PC-1 cells was determined by one-step PCR, whereas presence of Tnfrsf11b
in the DC-3 cells was determined by two-step PCR.
326
Figure 2: Localization of BIRC5 in the PC-1 cell line. PC-1 cells were fixed
with 1% formalin and slides were probed with an antibody against BIRC5
followed by a FITC-conjugated secondary antibody.
327
Figure 3: Effects of androgen treatment, withdrawal and/or blockade on
Birc5, Igf1, and Igf1r mRNA expression in the PC-1 cell line. PC-1 cells were
cultured (n=3/group) in CF-FBS in the absence (-) of DHT without (black bars) or
with (left-sided stripped bars) hydroxyflutamide and in the presence (+) of DHT
without (grey bars) or with (right-sided stripped bars) hydroxyflutamide for 3h,
6h, 12h, 24h, and 48h. Changes in expression for Birc5 (A), Igf1 (B), and Igf1r
(C) were assessed by qRT-PCR and normalized to Ppia (cyclophilin A)
expression. Data are presented as mean +SEM.
328
Figure 4: Effects of androgen treatment, withdrawal and/or blockade on
IGF1 concentration in the PC-1 cell line. PC-1 cells were cultured (n=3/group)
in CF-FBS in the absence of DHT (diamond), the presence of DHT (square), the
presence of hydroxyflutamide (HF) (triangle) or the presence of DHT and HF
(cross) for 3h, 6h, 12h, 24h, and 48h. IGF1 concentrations (pg/ml) in the media
were measured using the IGF1 mouse quantikine ELISA assay; every measure
was done in duplicate. Data are presented as mean ± SEM.
329
Figure 5: Effects of androgen treatment, withdrawal and/or blockade on PC-
1 cell viability. PC-1 cells passage #20 were cultured (n=5/group) in CF-FBS in
the absence (-) of DHT without (black bars) or with (left-sided stripped bars)
hydroxyflutamide and in the presence (+) of DHT without (grey bars) or with
(right-sided stripped bars) hydroxyflutamide for 1, 2, and 4 days and numbers
(*104) of viable cells were determined by the CellTiter-Glo luminescent cell
viability assay. Data are presented as mean +SEM.
330
Figure 6: Effects of androgen treatment, withdrawal and/or blockade on
Mcl1 mRNA expression in the PC-1 and DC-3 cell lines. PC-1 and DC-3 cells
were cultured (n=3/group) in CF-FBS in the absence (-) of DHT without (black
bars) or with (left-sided stripped bars) hydroxyflutamide and in the presence (+)
of DHT without (grey bars) or with (right-sided stripped bars) hydroxyflutamide
for 3h, 6h, 12h, 24h, and 48h. Changes in expression for Mcl1 were assessed by
qRT-PCR and normalized to Ppia (cyclophilin A) expression. Data are presented
as mean +SEM.