Thermoregulation of Capsule Production of Streptococcus ... · Hyaluronic acid capsule expression...

Post on 19-May-2020

1 views 0 download

Transcript of Thermoregulation of Capsule Production of Streptococcus ... · Hyaluronic acid capsule expression...

Southern Illinois University CarbondaleOpenSIUC

Theses Theses and Dissertations

12-2009

Thermoregulation of Capsule Production ofStreptococcus pyogenes Strain HSC5Trilce Michelle GaleasSouthern Illinois University Carbondale, mgaleas@gmail.com

Follow this and additional works at: http://opensiuc.lib.siu.edu/theses

This Open Access Thesis is brought to you for free and open access by the Theses and Dissertations at OpenSIUC. It has been accepted for inclusion inTheses by an authorized administrator of OpenSIUC. For more information, please contact opensiuc@lib.siu.edu.

Recommended CitationGaleas, Trilce Michelle, "Thermoregulation of Capsule Production of Streptococcus pyogenes Strain HSC5" (2009). Theses. Paper 122.

THERMOREGULATION OF CAPSULE PRODUCTION IN Streptococcus

pyogenes STRAIN HSC5

By

Trilce Michelle Galeas Peña

MD, Universidad Autónoma de Santo Domingo, Santo Domingo. Dominican Republic. 2005

A Thesis Submitted in Partial Fulfillment of the Requirements

For the Master of Science Degree

Department of Microbiology

Molecular Biology, Microbiology, and Biochemistry Graduate Program

Southern Illinois University, Carbondale, IL 62901

December, 2009.

THESIS APPROVAL

THERMOREGULATION OF CAPSULE PRODUCTION IN Streptococcus pyogenes STRAIN HSC5

By

Trilce Michelle Galeas Peña

A Thesis Submitted in Partial

Fulfillments of the Requirements

for the Degree of

Master of Science

in the field of Microbiology, Molecular Biology and Biochemistry

Approved by:

Dr. KyuHong Cho, PhD

Dr. Douglas Fix, PhD Chair

Dr. David Clark, PhD

Graduate School

Southern Illinois University, Carbondale.

December, 2009.

AN ABSTRACT OF THE THESIS OF

TRILCE MICHELLE GALEAS PEÑA, for the Master of Science degree in MOLECULAR BIOLOGY, MICROBIOLOGY and BIOCHEMISTRY, presented on JULY 15th , 2009, at Southern Illinois University Carbondale.

TITLE: THERMOREGULATION OF CAPSULE PRODUCTION IN Streptococcus pyogenes STRAIN HSC5.

MAJOR PROFESSOR: Dr. KyuHong Cho

Group A Streptococcus (GAS) is responsible for mild and common

infections like tonsillitis and pharyngitis, and more serious invasive disorders like

necrotizing fasciitis and glomerulonephritis. The ability to invade tissues is

closely linked to the virulence factors expressed by the bacterium. Hyaluronic

acid capsule expression is variable among all the strains in S. pyogenes and

confers the capacity to evade the immune response. In a previous study, it was

found that capsule production in CovR mutants was temperature-regulated,

showing no capsule production at 37 but increased production was observed

at 25. In this study, the objective is to find the elements involved in the

thermoregulation using a genetic approach. First, mutants were created by

knocking-out CovR, the response regulator of the CovRS two-component system

that controls about 15% of GAS genome. Transposon mutants were screened to

find changes in capsular phenotype. Colonies expressing capsule at 37 were

selected for sequencing. The sequencing revealed three different events in

different mutants. Two of them pointed at hypothetical proteins, one of them,

i

SpyM3_1255, was phage associated protein with a DnaD domain and the other

one, SpyM3_1377, encoded cvfA. A third over-producer mutant showed an

insertion in the promoter area of the has operon, the operon that encodes for

hyaluronan synthase production, upstream from other disruptions in the promoter

area that generated non-producing mutants. This suggest that there is more than

one factor involved in thermoregulation of capsule production.

ii

TABLE OF CONTENTS

CHAPTER PAGE

ABSTRACT ........................................................................................................... i

LIST OF TABLES ................................................................................................ vi

LIST OF FIGURES ............................................................................................ viii

INTRODUCTION ................................................................................................. 1

Pathogenesis and Virulence Factors of S. pyogenes ................................ 2

Purpose of this study ................................................................................. 7

Hyaluronic Acid Capsule Structure and Synthesis .................................... 8

The Hyaluronic Acid Synthesis (has) Operon in Streptococcus sp ......... 14

Streptococcus pyogenes gene regulation ............................................... 16

Thermoregulation in bacterial gene expression ...................................... 20

Research Aims ........................................................................................ 23

MATERIALS AND METHODS ............................................................................ 24

Media, Buffers, Solutions and Standard Protocols .................................. 24

Bacterial Strains and Plasmids ............................................................... 24

iii

Plasmid Construction .............................................................................. 24

Creation of CovR mutants ....................................................................... 25

Transposon Mutagenesis ........................................................................ 25

Capsule Quantitation ............................................................................... 26

RESULTS AND DISCUSSION ........................................................................... 29

Wild Types and the generation of CovR Mutants .................................... 29

CovRS complementation ........................................................................ 30

Temperature dependence of capsule expression ................................... 31

Transformation and phenotypification of MGAS315 ................................ 31

Transposon Mutagenesis ........................................................................ 48

Knock-out Experiment ............................................................................. 57

REFERENCES .................................................................................................. 64

APPENDICES

Appendix A - Media, Buffers and Solutions ........................................................ 83

Media ................................................................................................................. 83

Antibiotics ........................................................................................................... 85

iv

Buffers and Solutions .............................................................................. 86

Appendix B - Protocols ...................................................................................... 87

Generation of In-Frame Deletion Strain .................................................. 87

Isopropanol Precipitation ......................................................................... 88

Electroporation of S. pyogenes ............................................................... 90

Electroporation of S. pyogenes with pJRS233 Derivatives ..................... 92

Escherichia coli Transformation .............................................................. 95

Quantitation of S. pyogenes Capsule ...................................................... 96

Storing Cells at -80 Freezer ................................................................ 98

Plasmid Extraction .................................................................................. 99

DNA Purification of PCR Products .......................................................... 99

Preparation of Chromosome of S. pyogenes with Sigma Column .......... 99

Preparation of E. coli Competent Cells ................................................. 100

VITA .................................................................................................................. 102

v

LIST OF TABLES

TABLE PAGE

Table 1: Bacterial Strains ................................................................................... 27

Table 2: Plasmids ............................................................................................... 28

Table 3: Capsule quantitation of wild types and CovR mutants at 37 ............ 33

Table 4: Capsule quantitation of wild types and CovR mutants at 30 ............ 34

Table 5: Capsule quantitation of wild types and CovR mutants at 25 ............ 35

Table 6: Capsule quantitation of HSC5 and CovR mutants at 37 .................. 38

Table 7: Capsule quantitation of HSC5 and CovR mutants at 30 .................. 39

Table 8: Capsule quantitation of HSC5 and CovR mutants at 25 .................. 40

Table 9: Results of capsule quantitation of complementation strain and

controls at 37 .................................................................................... 43

Table 10: Results of capsule quantitation of complementation strain and

controls at 30 .................................................................................. 44

Table 11: Results of capsule quantitation of complementation strain and

controls at 25 ................................................................................. 45

Table 12: Capsule quantitation of transposon mutants at 37 ......................... 54

vi

Table 13: Capsule quantitation of transposon mutants at 25 ......................... 55

Table 14: PCR primers used for hasA promoter area amplification ................... 59

Table 15: Primers used for hasA promoter area knock-out confirmation ........... 59

vii

LIST OF FIGURES

FIGURE PAGE

Figure 1: Draw of Streptococcus .......................................................................... 3

Figure 2: Structure of hyaluronic acid ................................................................ 11

Figure 3: Enzyme functions needed for hyaluronic acid biosynthesis ............... 13

Figure 4: Graphic representation of has operon ................................................ 15

Figure 5: Capsule phenotype ............................................................................. 32

Figure 6: Capsule quantitation of wild types and CovR mutants at 37 ......... 36

Figure 7: Capsule quantitation of wild types and CovR mutants at 30 .......... 36

Figure 8: Capsule quantitation of wild types and CovR mutants at 37 ......... 37

Figure 9: Effect of temperature in wild type and CovR mutants ........................ 37

Figure 10: Capsule quantitation of HSC5 and CovR mutants at 37 ............... 41

Figure 11: Capsule quantitation of HSC5 and CovR mutants at 30 ............... 41

Figure 12: Capsule quantitation of HSC5 and CovR mutants at 25 .............. 42

Figure 13: Effect of temperature on HSC5 and CovR mutants .......................... 42

Figure 14: Capsule quantitation for CovRS complementation strain and

controls at 37 ................................................................................ 46

viii

Figure 15: Capsule quantitation for CovRS complementation strain and

controls at 30 ................................................................................ 46

Figure 16: Capsule quantitation for CovRS complementation strain and

controls at 37 ................................................................................ 47

Figure 17: Effect of temperature in complementation strain and controls .......... 47

Figure 18: Complete sequence of spyM3_1254 ................................................ 51

Figure 19: Partial sequence of spyM3_1376 ..................................................... 52

Figure 20: The hasA promoter region ................................................................ 53

Figure 21: Capsule production of transposon mutants at 37 ......................... 56

Figure 22: Capsule production of transposon mutants at 25 ......................... 56

Figure 23: Gel electrophoresis of nucleic acids for knockout experiments ........ 60

Figure 24: Primer annealing for knock-out confirmation .................................... 61

Figure 25: Graphic representation of transposon insertion ................................ 62

Figure 26: Graphic representation of insertional inactivation ............................. 63

ix

INTRODUCTION

Streptococcus pyogenes is a Gram positive human pathogen that grows in

chains (Figure 1) and is the causative agent of relatively mild diseases such as

tonsillitis, pharyngitis, pyoderma and impetigo or serious invasive infections like

necrotizing fasciitis and streptococcal toxic shock syndrome. In some cases, after

infection with Group A Streptococcus (GAS) post-streptococcal systemic

diseases like rheumatic fever, glomerulonephritis, endocarditis (91) and

Sydenhamʼs chorea (56) could develop. S. pyogenes can be found naturally in

the human skin and throat. It is an aerotolerant anaerobe called β-hemolytic

because of the complete hemolysis pattern formed in blood agar (β-hemolysis)

(67).

In the United States, each year there are over 10,000 cases of invasive

streptococcus infections such as necrotizing fasciitis, bacteremia and toxic shock

syndrome, resulting in 1,000 – 1,800 deaths (76).

Global epidemiology is unknown due to poor report and surveillance

systems in most developing countries. However, it is estimated that there are at

least 517,000 deaths each year linked to severe streptococcal infections and

post-streptococcal diseases. The prevalence of GAS is at least 18.1 million cases

with 1.78 million new cases each year (13) and there are at least 663,000 new

cases with 163,000 deaths each year from invasive GAS infections. That added

to the fact that there are more than 111 million cases of pyoderma and 616

1

million cases of pharyngitis per year, it is easy to conclude that there is a high

prevalence of streptococcal diseases in the clinical practice.

Rebecca Lancefield, in 1928, published a method to serotype

streptococcus based on its M protein, resulting in over 100 serotypes (59). Later,

in 1946, she published another serotyping method based on the T protein, 20

serotypes are known in this system (60), and 4 of the antigens related to T

protein are pili, a structure relevant to attachment to host cells (75).

Pathogenesis and virulence factors of S. pyogenes

There are several virulence factors in S. pyogenes that enable the

bacterium to attach to host cells, invade deep tissues favoring spreading and

avoid immune responses. Among those is the hyaluronic acid capsule which is

the subject of this research and will be discussed in detail later.

M protein, which is a major factor in phagocytosis evasion uses its ability to bind

two different components of the immune response (C4BP and IgA) inhibiting

opsonization and phagocytosis (14). It is also related to the autoimmune

response in rheumatic fever and rheumatic heart disease derived from post-

streptococcal infection by eliciting a molecular mimicry mechanism and activating

opsonic antibodies and lymphocytes (42). Another relevant characteristic of the

well studied M protein is its interaction with peptides derived from the fifth domain

of beta-2 glycoprotein I (beta-2-GPI), a human heparin binding plasma protein,

which has antibacterial activities against Gram-positive and Gram-negative

bacteria. Also, protein H and M1 protein, released from the bacterial cell wall by

2

FIGURE 1: Photomicrograph of Streptococcus bacteria, 900x magnification,

showing its typical spherical shape and chain growth. (CDC Public Health Image

Library). http://phil.cdc.gov/phil/details.asp

3

polymorphonuclear-derived proteases, bind to, and inhibit the activity of,

beta(2)GPI-derived antibacterial peptides. Taken together, it is suggested that the

interaction between the streptococcal proteins and beta(2)GPI or beta(2)GPI-

derived peptides presents a novel mechanism to resist an antibacterial attack by

beta(2)GPI-cleavage products (77).

Another virulence factor is F protein, which facilitates adherence to host

cells (9), and is linked to severe soft tissue infections (80). It also mediates

invasion in HeLa cells and enables the bacteria to be internalized, proving that M

protein is essential for adhesion, but F protein is essential for internalization (82).

F protein shall not be confused with streptococcal pyrogenic exotoxin SpeF,

previously referred as mitogenic factor, which, in Toxic Shock-like Syndrome

caused by Streptococcus, causes permeabilization of lung vessels, leading to

Acute Respiration Distress Syndrome (70). Moreover, F protein has

superantigenic properties. Fibronectin-binding properties of S. pyogenes are also

mediated by protein F (50). While M protein of S. pyogenes mediates the binding

of the bacterium to keratinocytes, protein F directs the adherence of the

organism to Langerhans' cells (81).

Many of the virulence factors of GAS are not present in all clinical

isolates, however, Streptolysin O (SLO), an oxygen-labile (thiol-activated)

cytolysin, is present in most and is a powerful toxin that is partially responsible for

hemolytic pattern and is highly cardiotoxic (49, 46). When absent, S. pyogenes

shows a significant decrease in lethality and ability to cause disease (63). A

4

recent study found this pore-forming cytolytic streptolysin O as responsible and

sufficient for apoptosis induction of macrophages and neutrophils involving

caspase-1. This requires internalization of the bacterium by the phagocyte,

contributing to GAS virulence and immune evasion (102). This toxin has the

potential to establish a novel class of suicide gene therapeutic reagents (114).

Membrane damage by SLO is analogous to that mediated by previously studied

channel formers, namely, the C5b-9 complement complex and staphylococcal

alpha-toxin (8). On capsule production, capsular and acapsular M3 strains were

tested and the result was that the cytotoxic effects of streptolysin O protect GAS

from phagocytic killing and enhance bacterial virulence, particularly of strains that

may be relatively deficient in hyaluronic acid capsule (96).

Another key virulence factor is streptolysin S (SLS), that is partially

responsible, along with SLO, for the beta-hemolytic phenotype. It is encoded by

the sagA gene (28). Despite a long time since its discovery, its chemical structure

remains unknown (74). SLS is not immunogenic; thus, no neutralizing antibodies

are evoked during the course of natural infection, but recently, a synthetic peptide

containing aminoacids 10 to 30 from the sagA gene coupled with keyhole limpet

hemocyanin elicited an antibody response in a rabbit and reversed the hemolytic

phenotype, giving cues to develop a new vaccine (28).

GAS also secretes streptokinase which binds and activates plasminogen

(7), the enzyme that destroys fibrin clots. Interactions between bacteria,

fibrinogen, streptokinase and plasminogen resulted in acquisition of cell-

associated enzymatic activity that can lyse fibrin clots despite the presence of the

5

major physiological plasmin inhibitor, alpha 2-antiplasmin (107), and this

interaction promotes bacterial invasion of tissues (101). It is strongly believed

that streptokinase plays a mayor role in acute post-streptococcal

glomerulonephritis by initiating the nephritis process by glomerular deposition,

which leads to local activation of the complement cascade. Detection of

streptokinase in kidney tissue increased with the degree of glomerular

hypercellularity. Thus, the severity of the pathological process may be a reflection

of the degree of streptokinase deposition (78, 79).

Virtually all strains of the human bacterial pathogen Streptococcus

pyogenes express a highly conserved extracellular cysteine protease known as

streptococcal pyrogenic exotoxin B (SpeB) (65) that is used by GAS to kill

phagocytes, as demonstrated by Lukomski et al, where a mutant lacking

expression of SpeB was unable to resist phagocytosis and subsequent

dissemination (66). SpeB also affects directly the production of hyaluronic acid

capsule, when inactivated, extracellular hyaluronic acid levels decreased (112). It

also degrades IgG, IgM, IgA, IgD and IgE (23). The mechanism to inactivate IgG

is by cleaving IgG into Fc and Fab fragments, therefore, increasing bacterial

survival (24, 37). Another proposed mechanism of phagocytic evasion by SpeB is

by mitochondrial damage to the polymorphonuclear cells at an early infectious

stage (18). As reviewed so far, SpeB cleaves or degrades host serum proteins

such as human extracellular matrix, immunoglobulins, complement components,

and even GAS surface and secreted proteins. Destruction of both host and

6

bacterial proteins makes SpeB the key virulence factor in GAS pathogenesis

(19).

To invade host tissues, S. pyogenes uses hyaluronidase as one of the

many virulence factors involved in invasion and dissemination. This chromosomal

and phage-associated enzyme degrades hyaluronic acid from host tissues and

increase adherence to epithelial host cells (6). A recent study found that

hyaluronidase digests tissue hyaluronic acid and facilitates spread of large

molecules but is not sufficient to cause subcutaneous diffusion of bacteria or to

affect lesion size (98). Along with hyaluronidase, GAS also produces hyaluronic

acid for its capsule, and another interesting finding was that hyaluronidase is not

sufficiently active to remove capsule during peak synthesis (98).

Purpose of this Study

Human pathogens are exposed to changes in the environmental

conditions, such as temperature, osmolarity and pH. In order to survive, bacteria

have to regulate their gene expression according to environmental factors and,

thus, ensure a successful colonization that allows them to thrive in the highly

hostile human body.

Temperature is one of the most relevant environmental factors. Several

thermoregulation studies have been done in other bacteria, demonstrating how

differential gene expression may be temperature-dependent, especially in

pathogenesis, where body temperature is a significant cue for the bacterium to

start the virulence machinery.

7

In the specific case of Group A Streptococcus, where colonization of both

skin surface and blood is possible, there must be a thermoregulation in the

capsule production that allows the bacteria to switch from one place to another

while evading phagocytosis and internalization.

Also, the products of temperature-regulated genes with central roles in

physiology and virulence could be targets for novel therapeutics or mutation to

generate defined live attenuated vaccines.

Hyaluronic acid capsule structure and synthesis

The most relevant virulence factor for this study is the hyaluronic acid (HA)

capsule produced in the surface of the bacterial cell that plays a key role in

virulence and invasiveness in mucoid strains (109). The capsule is also a

mechanism to avoid oxygen damage by isolating the cell from the environment,

making oxygen diffusion through the capsule much more slow, providing the

bacterium with a shield from oxygen metabolites (22). The virulence of HA

capsule is derived from its capacity to confer phagocytosis resistance to the

bacterium (110) and is not necessary to be heavily expressed to confer full

virulence, as demonstrated by Ashbaugh, where moderately encapsulated

strains and heavily encapsulated strains posed the same invasiveness and

virulence (4). The capsule in Streptococcus pyogenes is also required for biofilm

formation by helping in the process of maturation into a tridimensional structure

(20)

8

The composition of hyaluronic acid is shared by bacteria and mammalians

alike, therefore the immune system is unable to recognize encapsulated bacteria

leading to failed opsonization and phagocytosis (27). Encapsulated strains are

very invasive in soft tissue infections, as oppose to uncapsulated strains that are

internalized by keratinocytes (93) resulting in a noninvasive disease, and

evidencing the fact that in order to spread, GAS needs to avoid phagocytosis and

internalization and this is accomplished by capsule production (30). Introduction

of GAS into the pharynx or deep tissues activates capsule production in

capsulated strains (44), however, the underlying mechanism remains unknown,

although several putative environmental triggers have been studied with little

success. In this regard, a recent publication tried to identify the trigger, after

noticing how mucoid strains on primary culture lost their encapsulated phenotype

after laboratory passage, suggesting that the trigger must be present in the host

environment and absent in most laboratory culture media. They found that

cathelicidin LL-37, a human antimicrobial, had the ability to stimulate CovRS-

regulated virulence factors (45).

HA is synthesized at the protoplast and its structure is a polymer of

disaccharides, themselves composed of D-glucuronic acid and D-N-

acetylglucosamine, linked via alternating β-1,4 and β-1,3 glycosidic bonds.

Hyaluronic acid can be 25,000 disaccharide repeats in length. Polymers of

hyaluronan can range in size from 5,000 to 20,000,000 Da in vivo (99, 73, 100)

(Figure 2). The average molecular weight of extracellular HA is 2 X 106, and its

production is only effective until the cell reach stationary phase, where production

9

is halted, possibly because of changes in membrane conformation (106). HA

release after formation is mediated by an ABC transport system, coded adjacent

to the HA synthase gene with a reading frame in opposite direction (84).

Synthesis of hyaluronic acid requires much energy and takes a high

percentage of sugar, therefore, the obvious advantages of its synthesis is not

widespread among pathogenic bacteria. The enzyme responsible for hyaluronic

acid synthesis is Hyaluronic Acid Synthase. The gene encoding this enzyme was

first discovered in 1993 from GAS (31) and after that, it has been described in

different species in bacteria and mammals as well. These various hyaluronic acid

synthases share many common features and aminoacid sequence regions

identity or similarity (108). In Streptococcus pyogenes, the HA synthase is known

as HAs Class I.

The first work identifying the HA synthase was in 1950 by Dorfman. In his

paper, he described the enzyme as membrane-bound that needed Mg++ and

used two sugar-nucleotide substrates, uridine diphospho-glucuronic acid (UDP-

GlcA) and uridine diphospho-H-acetylglucosamine (UDP-GlcNAc) to polymerize

a hyaluronic acid chain (69) adding one after another at the reducing end (103).

Different from proteoglycans, hyaluronic acid chain initiation does not need a

protein backbone, the sole presence of the nucleotide sugar precursors are

enough to elicit initiation and elongation (84).

10

FIGURE 2: Structure of hyaluronic acid. Hyaluronic acid consists of repeating

disaccharides composed of N-acetylglucosamine (GlcNAc) and glucuronic acid

(GlcA).

11

HA synthase is very unique; it has two different functions as

glycosyltransferase. The product of the first sugar addition is the substrate for the

next addition (108). The overall reaction for the synthesis of one hyaluronan

disaccharide unit is:

Although this reaction seems simple, it is believed that at least six different

reactions take place to complete the cycle. Before it is released, the chain can

grow to more than 40,000 monosaccharides, corresponding to a mass of more

than 8 million Da. The sugar-nucleotide substrates are produced and used by the

synthase inside the cell, and the hyaluronan chain is continuously transferred

(translocated) so that it is extruded into the exterior of the cell to form the capsule

(Figure 3). It was also believed that in absence of precursors, capsule would not

be able to be synthesized and that hyaluronidase may play a role in solving this

problem. To demonstrate a possible nutritional role for hyaluronidase, GAS was

shown to grow with N-acetylglucosamine but not d-glucuronic acid (both

components of HA) as a sole carbon source. However, only hyaluronidase (+)

strains could grow utilizing HA as a sole carbon source, suggesting that

hyaluronidase may permit the organism to utilize host HA or its own capsule as

an energy source (98).

As bacterial hyaluronic acid is very similar to human and other vertebrates

molecule, different strains of Streptococcus is being use for production and later

use for purpose of human health and cosmetic industry (113). Also recombinant

12

FIGURE 3: Enzyme functions needed for hyaluronic acid biosynthesis. The

diagram shows the membrane-bound hyaluronan synthase and the six

independent activities required for the enzyme to make a disaccharide unit and

extend the growing hyaluronic acid chain. (Image used with permission of

Glycoforum. www.glycoforum.gr.jp).

13

HA from E. coli (115), B. subtillis (111) and Agrobacterium sp. (68) is used

for commercial purposes.

The hyaluronic acid synthesis (has) operon in Streptococcus species.

Hyaluronic acid production is coded in an operon containing three genes:

hasA, hasB, and hasC, which encode hyaluronan synthase, UDP-Glc

dehydrogenase and UDP-Glc pyrophosphorylase, respectively (Figure 4). hasA

codes for the enzyme responsible for the overall hyaluronic acid synthesis

reaction (35), hasB is necessary to make UDP-GlcA, one of the substrates

needed for HA production, from UDP-Glc in an oxidation that requires 2 NAD+

(34), and hasC codes for the enzyme that creates UDP-Glc from UTP and Glc-1-

phosphate (25). Deletion analysis of the operon by Ashbaugh demonstrated that

hasC gene, although it is part of the transcript, is not necessary for hyaluronic

acid production, therefore hasAB are the only genes necessary for capsule

production (5) and probably the hasC function is shared by other metabolic

pathways in the cell. This operon is quite unique for Streptococcal species and

recent phylogenetic studies show that there is no evidence of detectable inter-

species lateral gene transfer suggesting intra-species genetic rearrangement as

the origin of has operon (34). It also shows that the hasA is highly conserved

among streptococcal strains, different from the M protein that is highly variable

(32). Even when all streptococcal strains posses the operon, not every strain

have the capsular phenotype. In acapsular phenotype, no operon mRNA

14

HAS OPERON: 3606 base pairs (bp)

hasA (1259 bp hasB (1208 bp) hasC (915 bp) spyM3_1854 recF

FIGURE 4: General representation of has operon and its genomic context. The

P represents the promoter area and the T is the terminator.

15

P T

transcript is expressed (26). Further characterization of the operon showed a

promoter consensus sequence upstream the hasA gene, and no terminator

sequence was found on hasA, indicating that the has operon promoter could

regulate transcription of the entire operon, thus producing a polycistronic mRNA

(26), therefore, mutations in the has operon promoter or in the hasA gene lead to

a polar effect.

The level of capsule production sometimes differs among individual strains

of the same M-type. It is likely that strain-specific factors also affect capsule

production along with the intrinsic strength of the has promoter conferred by the

serotype-specific has promoter sequence (1).

Streptococcus pyogenes gene regulation

Gene regulation in Streptococcus pyogenes is mediated by several

regulators that either activate or repress certain genes in response to growth

phase or environmental triggers this is achieved by transcriptional regulator

proteins, like Mga (12), a regulator of gene expression, which is responsible for

the activation of expression during exponential growth of genes involved in

adhesion, internalization and immune evasion and influences the expression of

over 10% of all GAS genome, primarily genes and operons involved in

metabolism and sugar utilization (53). Mga functions as a DNA-binding protein

that interacts with sites both proximal and distal to the start of transcription for the

16

genes that it regulates (2). Ribardo et al (89) described an open reading frame

named amrA that is required for maximal activation of the Mga regulon during

exponential phase and is strongly conserved across different streptococcal M

types. Inactivation of amrA in an M3 serotype also resulted in reduction of the

gene coding M protein, emm, transcripts, therefore, the role of amrA does not

appear to be serotype specific. Although the specific function of AmrA is

unknown, its putative membrane localization and homology to transporters

involved in cell wall synthesis suggest a link between growth and Mga (89).

Many virulence regulators in other bacteria respond to carbon catabolite

repression, a potential catabolite-responsive element important for binding by the

catabolite control protein A (CcpA) was found in the promoter area of Mga

upstream of its distal P1 start of transcription, supporting the role for CcpA in the

early activation of the Mga promoter and establishing a link between carbon

catabolite repression and Mga regulation in GAS (3). A link in a regulatory

pathway has been found between CovRS and Mga, this is mediated by a novel

two-component system regulator, which is CovR repressed, named TrxR that

regulates the expression of Mga regulon genes, therefore, connecting CovR

expression with Mga, affecting pathogenesis in GAS (61).

Gene regulation in S. pyogenes is also achieved by two-component

systems like CovRS, the global response regulator that mediates expression of

about 15% of all GAS genome (43).

Two-component regulatory systems constitute an extensive superfamily of

pairs of functionally linked proteins that modulate the activity of biochemical

17

pathways and regulate the expression of virulence factors in many bacteria. The

sensor component typically consists of a membrane-bound protein that responds

to an environmental signal by phosphorylating a conserved histidine residue in a

cytoplasmic transmitter domain of the sensor protein. The phosphate group is

subsequently transferred from the sensor protein to a conserved aspartic acid

residue in the receiver domain of the response regulator, a cytoplasmic protein.

Regulator proteins of this type influence expression of target genes by acting as

transcriptional activators or repressors, and their activity at binding sites

upstream of target genes depends upon the phosphorylation state of the protein.

Phosphorylation alters the DNA binding properties of the response protein

regarding either affinity or target specificity.

Levin and Wessels described the effect of the system on hyaluronic acid

capsule production and named the system csrRS for “capsule synthesis

regulator” and found that csrR was the negative response regulator and csrS was

the sensor component and are very conserved among Streptococcus (62).

Federle found five different sites of CovR binding to the has operon promoter

area and concluded that, except for the almost overlapping binding site pair CB-1

and -2, binding of CovR to each of the five sites surrounding the hasA promoter

is independent of binding at the other sites. However, binding at all of these sites

is needed for complete repression of this promoter in vivo (38).

CovRS protein products are members of the OmpR/EnvZ two-component

signal transduction family (29). It is widely accepted that CovS mediates CovR

phosphorylation, however, further studies gave evidence that in some

18

exceptional cases CovS may not be needed for CovR phosphorylation and

consequent activation, even when these two proteins are cotranscribed, there

could be another element in the cell able to phosphorylate CovR in absence of

CovS (29). Phosphorylation of CovR by acetyl phosphate results in dimerization

(48) significantly enhancing repression of one group of genes (e.g. speA, hasA,

ska) while reducing repression of a second group (e.g. speB, grab, spd3) (105).

CovS is required for growth under stress conditions like high temperature,

high salt concentration and low pH (29). CovRS has been described as a

double-negative regulator, where CovR represses transcription of the covRS

operon by promoter occlusion (47), so as long as CovR is active, very little new

CovR protein is made.

The consensus region of CovR binding at the promoter area of both covR

and has operons is ATTARA, where R could be any purine. In this sequence the

T residues key in CovR binding (40). Another consequence of stress-induced

inactivation of CovR is derepression of CovR synthesis. It can be expected that

under stress conditions, more inactive CovR accumulates so that when stress is

relieved and CovR becomes active, there is a rapid repression response. The

design of this system thus makes it very sensitive to environmental change, like

temperature. Since CovR-regulated promoters may vary in their degrees of

sensitivity to CovR phosphorylation, CovR-regulated genes may exhibit

differential expression under both normal and stress conditions and may respond

to various degrees when the GAS encounters stress conditions (29).

19

CovR is also regulated by RocA, named for “regulator of Cov”, which plays

an important role in regulation of the operon by increasing its expression and

activation of covR transcription is increased about threefold. As expected, a rocA

mutant is mucoid and produces more transcript from the has promoter since this

promoter is repressed by CovR. This regulator is present in GAS but not in other

species like Group B Streptococcus or Group G Streptococcus (10).

There are other regulators than the previously described CovRS and

Mga. For instance, the RofA-like proteins (RALP) including RofA and Nra (39),

regulate genes involved in persistence; FasA, which is involved in growth phase

regulation of virulence gene expression (58) and Rgg (RopB), which activates

expression of extracellular proteins such as SpeB (16). Rgg has also been

shown to play a role in regulating the metabolic activities of GAS (17).

Thermoregulation in bacterial gene expression

Temperature is a relevant stress factor sensed by bacteria and used to

regulate gene expression. Depending on the induction mechanism, two different

pathways have to be distinguished, namely the heat shock response and the

high temperature response. While the heat shock response is induced by

temperature increments and is transient, the high temperature response needs a

specific temperature to become induced and proceeds as long as cells are

exposed to that temperature. The heat shock response is induced by denatured

proteins and aimed to prevent definitive denaturation and formation of protein

aggregates by refolding, and the high temperature response is mainly used by

20

pathogenic bacteria to detect entry into a mammalian host followed by induction

of their virulence genes (94). Thus, thermoregulation in gene expression has

been described in several bacterial species. Several pathogenic bacteria

undergo temperature shift when going from one host to another or from one

environment to another, e.g. skin to deep tissues. Genes are up or down-

regulated depending on different temperatures; this difference, in some cases,

has been linked to promoter sequence, as for maRAB and acrAB in Salmonella

thyphimurium (51). Another report on Salmonella found a strong thermosensing

for virulence phenotype where bacteria grown at 30 or lower were unable to

activate the intracellular type III secretion system even under strong inducing

signals such as synthetic medium, contact with macrophages, and exposure to

the murine gut (36).

Three different macromolecules have been identified being able to sense

temperature: DNA, proteins and mRNA. For example, DNA supercoiling can

control gene expression of pVY virulence plasmid in Yersinia enterocolítica (90)

as well as virB expression in Shigella (87). Protein regulation that are

temperature-dependent are found in the expression of flagella gene in Listeria

species (95) and the two-component signal transduction BvgAS in Bordetella

pertussis (55). RNA regulation is conferred by riboswitches and an example is

the LcrF production in Yersinia pestis (52) that induces expression of several

virulence factors. An example of how temperature regulates the expression of a

two-component signal transduction is BvgSR in Bordetella pertussis, the

causative agent of whooping cough (57). This system is transcribed and up-

21

regulated at 37°C and down-regulated at 25°C (88) and the mechanism is very

similar to CovR activation by phophorylation (55). Microarray studies with

Francisella tularensis showed that after shifting temperature from 26°C to 37°C

about 11% of the bacteriumʼs genes were differentially regulated and 40% of

those genes are linked to pathogenesis (54). In group B streptococcus (GBS)

changes in the genome occurred after incubation in blood at a temperature

similar to those in patients with infection (about 40°C) (72), proving adaptative

changes mediated by temperature in response to invasive infection. In a recent

study in E. coli the effect of temperature on colicin K production was investigated

and the results showed that expression was higher at 37°C than at 22°C and is

hypothesized that SOS response indirectly regulates thermoregulation of colicin

K (11). Another example of bacteria that uses temperature as a regulatory cue for

pathogenicity is Borrelia burgdorferi, the causative agent of Lyme disease. It

regulates expression of RevA in response to temperature, with the protein being

synthesized by bacteria cultivated at 34 but not by those grown at 23 (15).

In some cases, a change in DNA topology, instead of promoter sequence, can

lead to thermoregulation, as reported for virB transcription in Shigella flexneri,

where a reduction in negative superhelicity at the promoter area was identified

(104).

As for Streptococcus pyogenes, previous studies have related some gene

expression and temperature. At least 9% of the genes are expressed

differentially at 29°C relative to 37°C, as shown in microarray analysis. These

genes include transporter proteins, proteins involved in iron homeostasis,

22

transcriptional regulators, phage-associated proteins, and proteins with no known

homologue. Relatively few known virulence genes were differentially expressed

at this threshold (97). However, at 40°C more gene expression was shifted,

showing that there is thermoregulation in gene expression in GAS.

Research Aims

The aim of this study was to identify the gene(s) or protein(s) responsible

for thermoregulation and which areas of the has operon promoter are involved.

For this purpose transposon mutagenesis was performed.

23

MATERIALS AND METHODS

Media, Solutions and Standard Protocols

All the recipes for media, buffers and solutions used in this research are

provided in Appendix A. The protocols are described in Appendix B.

Bacterial Strains and Plasmids

The bacterial strains used in this research and their relevant

characteristics are described in Table 1. Plasmid vectors are listed in Table 2.

Molecular cloning experiments were performed with Top10 E. coli cells (64) which

were cultured in Luria-Bertani broth at 37°C with agitation at 250 rpm. For routine

culture of S. pyogenes, Todd-Hewitt medium (BBL) supplemented with 0.2%

yeast extract (Difco) (THY medium) was employed. For growth in liquid media, S.

pyogenes was cultured at 37°C in sealed tubes without agitation. To produce

solid media, Bacto agar (Difco) was added to a final concentration of 1.4% (wt/

vol). When appropriate, antibiotics were added to the media (see Appendix A).

Plasmid construction

The plasmids used in this work are listed in Table 2. Gene manipulation

and cloning were carried out according to standard protocols (Sambrook et al,

1989). Plasmid constructs were verified by PCR and gel electrophoresis.

24

Creation of CovR mutants

CovR is the response regulator in the CovRS two-component system that

regulates capsule expression. CovR mutants were created by two methods. One

was an insertional disruption on the covR gene that was achieved by using

pSpc18 vector that confers spectinomycin resistance. The plasmid is a 2.94 kb

suicide vector with a multicloning site and an origin of replication for E. coli. A

fragment of the covR gene was inserted to create the disruption in the target loci

of the chromosome. Also, an in-frame deletion mutant was created using the

temperature induced plasmid pJRS233; no resistance is conferred after plasmid

excision. Both transformations were performed as described in Appendix B.

Transposon mutagenesis

Electroporation was performed to introduce the transposon into competent

S. pyogenes cells prepared as described in Appendix B. Mutants were plated in

THY plates with the appropriate antibiotic and incubated at 37°C as described in

standard methods (21). Transformants with insertions of pMGC8, a plasmid

carrying a transposon, were then recovered following overnight incubation at

37°C on THY medium plates supplemented with kanamycin. Insertion was

confirmed with PCR. For mutants displaying the desired phenotypes

(overproducers or non-producers) the transposon insertion site was identified by

chromosomal DNA sequencing. The strain used for transposon mutagenesis was

CovRIFD which does not produce capsule at 37°C but produces it at 25°C.

25

Capsule quantitation assay

As different strains expressed capsule differently, a method to measure

the amount of capsule was developed and optimized using Stains-all reagent; the

complete protocol can be found in Appendix B. Stains-all is known to bind to acid

polysaccharides. As hyaluronic acid is a highly acidic polysaccharide, Stains-all

was used to quantitate the capsule amount produced by cells. The

spectrophotometric readings were done using a 640 nm wavelength. The first

method included a resuspension of THY medium pellet along with the colony to

be measured. This method was discontinued because the media caused

interference with the spectrophotometer readings. The new method included only

the colony in the resuspension. Another problem was the continuous growth of

cells when incubating at room temperature for 24 hrs after the initial 37

incubation. To solve this problem, readings were done the same day using

different sets of cells for each temperature to be measured.

A standard curve was created by measuring the absorbance of hyaluronic

acid concentrations from 1 to 5 µL at 640 nm wavelength. The values obtained

were plotted. The X axis represents optical density and Y axis the hyaluronic acid

concentration. This generated an Y/X slope that was used to multiply the OD of

the samples, the resulting number was then multiplied considering the dilution

factor, which in this case was 2. The subsequent value was divided between the

total cell number of the colonies and the result was converted from µg/cfu to fg/

cfu. All samples were duplicated and the values were averaged.

26

TABLE 1: Bacterial Strains

Bacterial strains Relevant characteristics SourceE. coli Top10 hsdR, mcrA, lacZΔM15, endA1,

recA1(64)

S. pyogenes strains: HSC5

OPTM18

OPTM 2

OPTM7

ΩCovR

CovRIFD

MGAS315

MGAS315ΩCovR

Wild type, M14 serotype

Transposon generated mutant with a disruption in has operon promoter area created with pMGC8. Overproducer phenotype

Transposon mutant with a disruption in a hypothetical protein created by pMGC8. Over-producer phenotype

Transposon mutant with a disruption in a hypothetical protein created by pMGC8. Overproducer phenotype.

HSC5 with a mutation in the covR gene created with pSPC18

HSC5 with an in-frame deletion in the covR gene created with pJRS233

Wild type

MGAS315 with an in-frame deletion in the covR gene created with pSPC18

(50)

This study

This study

This study

(84)

This study

(65, 85)

This study

27

TABLE 2: Plasmids

Plasmid Relevant characteristics SourcepMGC8

pJRS233

pSPC18

pCIV2

pLZ12

Transposon containing km gene that confers kanamycin resistance.

Temperature-sensitive shuttle vector. Confers erythromycin resistance.

pUC18-based suicide vector containing aad9 (spectinomycin resistance gene from Enterococcus faecalis).

pUC18-based streptococcal integration vector; contains aphA3 conferringkanamycin resistance

Self replicating plasmid. Confers chloramphenicol and kanamycin resistance.

(41)

(86)

(20)

(21)

(29)

28

RESULTS AND DISCUSSION

Wild types and the generation of CovR mutants

One of the wild type strains used in this study was the non-mucoid HSC5,

which shows no capsule production at any temperature. To study the

thermoregulation of capsule production, CovR, the response regulator of the

CovRS two-component system was mutated, conferring a less regulated capsule

expression with an obvious temperature-dependent production. The CovR

mutants presented a clear temperature-dependent phenotype where no capsule

was produced at 37 and there was capsule production after incubation at 25

(Figure 5). Because HSC5 is not fully sequenced, MGAS315 was used for

genomic and phenotypical comparison. It showed the same non-mucoid

phenotype as HSC5.

To generate ΩCovR, the wild type was transformed with pSPC18, a

plasmid carrying spectinomycin resistance that creates a disruption and partial

duplication.

An in-frame deletion CovR mutant was also created using the temperature

regulated plasmid pJRS233 carrying erythromycin resistance. The resulting

phenotype was similar to the ΩCovR mutant. For transposon mutagenesis

experiments, this was the strain used because the in-frame deletion generates

no partial duplicates, as opposed to insertional disruption (Figures 25 and 26).

And because no double antibiotic resistance genes are carried (for each plasmid

insertion).

29

HSC5, MGAS315 and CovR mutant strains showed a low capsule reading

at 37, around 40 - 130 fg/μL. The difference in capsule production between

37 and 25 was not significant, showing always low values. However,

MGAS315 wild type usually had a higher values in capsule quantitation,

compared to HSC5, but macroscopically, it showed no characteristic coat of

hyaluronic acid, but only slightly larger colonies. For CovR mutants, the

difference was significant (Tables 3-5) showing an increased production of

hyaluronic acid capsule at 25 (Figures 6-9). Only in one measurement, HSC5

showed capsule production (Tables 6-8, Figures 10-13) but further attempts to

obtain the same phenotype failed, suggesting that the capsule production

observed in HSC5 was a consequence of a technical or human error.

Measurements at 30 were performed to determine if there was an

intermediate phenotype at an intermediate temperature. The results for this

reading showed that CovR mutants start their capsule production slowly after

removal from the 37 environment.

CovRS complementation

The phenotype of CovR mutants shows a temperature dependent capsule

expression. To rule out a possible secondary mutation causing the phenotype a

complementation experiment was performed. The plasmid used was pLZ12

containing a fragment of the CovRS two-component system. After

electroporation, revertants were obtained, showing the same phenotype

30

observed in the wild type. Capsule quantitation assay demonstrated a lack of

capsule production in the complementation mutants (Tables 9-11, Figures 14-17).

Temperature dependence of capsule expression

The mutant strains ΩCovR and CovRIFD showed a temperature-

dependent expression of capsule. At 37, the strain showed no hyaluronic acid

production, but at 25 an evident coat of hyaluronic acid capsule was produced

(Figure 5). In order to study the temperature dependence in HSC5, capsule

measurements at 30 were performed. It was observed that the amount of

capsule produced at this intermediate temperature was lower than the amount

produced at 25, but higher than the amount at 37 (Tables 4, 7 and 10.

Figures 7, 11 and 15 ).

Transformation of MGAS315

The strain used in this study, HSC5, is not fully sequenced and in order to

have genomic profiles of the disrupted genes we used the sequence of

MGAS315, a strain with the closest similarity to HSC5. The capsular phenotype

of MGAS315 was the same as HSC5. An ΩCovR mutant using MGAS315 was

created and the phenotype corresponded to that of the ΩCovR mutant with

HSC5 background. Capsule quantitation assays showed only a slight increment

in capsule amount (Tables 3-5), but the thermoregulated pattern of the MGAS315

CovR mutant was maintained (Figures 6-9).

31

a) b)

c)

FIGURE 5: Capsule phenotype. a) no capsule production. b) and c) capsule

production.

32

TABLE 3: Capsule quantitation of wild types and CovR mutants at 37

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/

cfu) Average Standard deviation

HSC5-1 0.017 720,000 140.90

HSC5-2 0.018 730,000 147.14 144.02 4.41

MGAS315-1 0.020 700,000 170.50

MGAS315-2 0.020 780,000 153.01 161.75 12.36

ΩCovR-1 0.023 396,000 301.38

ΩCovR-2 0.021 394,000 257.48 279.43 31.04

MGAS315ΩCovR-1 0.020 480,000 285.94

MGAS315ΩCovR-2 0.017 500,000 250.63 268.28 24.96

33

TABLE 4: Capsule quantitation of wild types and CovR mutants at 30

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu) Average Standard

deviation

HSC5-1 0.020 440,000 264.51

HSC5-2 0.020 430,000 270.66 267.58 4.34

MGAS315-1 0.030 480,000 363.70

MGAS315-2 0.030 510,000 342.31 353.00 15.12

ΩCovR-1 0.100 244,000 2384.92

ΩCovR-2 0.090 236,000 2219.19 2302.05 117.18

MGAS315ΩCovR-1 0.120 370,000 1887.31

MGAS315ΩCovR-2 0.110 330,000 1939.73 1913.52 37.07

34

TABLE 5: Capsule quantitation of wild types and CovR mutants at 25

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/

cfu)

Average Standard deviation

HSC5-1 0.05 3,600,000 80.82

HSC5-2 0.05 3,700,000 78.64 79.73 1.54

MGAS315-1 0.04 3,300,000 70.54

MGAS315-2 0.04 3,200,000 72.74 71.64 1.55

ΩCovR-1 0.15 350,000 2,493.94

ΩCovR-2 0.13 33,000 2,292.41 2,393.18 142.50

MGAS315ΩCovR-1 0.09 180,000 2,909.60

MGAS315ΩCovR-2 0.09 190,000 2,756.46 2,833.03 108.28

35

FIGURE 6: Capsule quantitation of wild types and CovR mutants at 37.

FIGURE 7: Capsule quantitation of wild types and CovR mutants at 30. Note

the different capsule amount in the CovR mutants, showing that in those strains

the capsule expression starts after leaving the 37 incubation.

0

100

200

300

400

HSC5 MGAS315 ΩCovR MGAS315ΩCovR

0

750

1500

2250

3000

HSC5 MGAS315 ΩCovR MGAS315ΩCovR

36

fg/cfu

fg/cfu

FIGURE 8: Capsule quantitation of wild types and CovR mutants at 25.

FIGURE 9: Effect of temperature in wild type and CovR mutants. Note how CovR

mutants present a thermoregulated capsule phenotype, as opposed to wild types

HSC5 and MGAS315

0

750

1500

2250

3000

HSC5 MGAS315 ΩCovR MGAS315ΩCovR

0

750

1500

2250

3000

HSC5 MGAS315 ΩCovR MGAS315ΩCovR

37 30 25

37

fg/cfu

fg/cfu

TABLE 6: Capsule quantitation of HSC5 and CovR mutants at 37

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu) Average Standard

deviation

HSC5-1 0.004 4,000,000 58.09

HSC5-2 0.004 4,500,000 51.63 54.86 4.56

CovRIFD-1 0.004 6,500,000 35.75

CovRIFD-2 0.005 6,600,000 44.00 39.87 5.84

ΩCovR-1 0.005 7,800,000 37.23

ΩCovR-2 0.005 7,900,000 36.768 37.00 0.33

38

TABLE 7: Capsule quantitation of HSC5 and CovR mutants at 30

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

HSC5-1 0.05 1,170,000 251.08

HSC5-2 0.04 1,090,000 215.60 233.34 25.08

CovRIFD-1 0.09 1,370,000 385.96

CovRIFD-2 0.07 1,280,000 321.30 353.63 45.72

ΩCovR-1 0.10 2,070,000 283.83

ΩCovR-2 0.09 1,970,000 268.41 276.12 10.90

39

TABLE 8: Capsule quantitation of HSC5 and CovR mutants at 25

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

HSC5-1 0.17 1,270,000 786.44

HSC5-2 0.18 1,350,000 783.36 784.90 2.18

CovRIFD-1 0.18 1,590,000 665.12

CovRIFD-2 0.17 1,470,000 679.44 672.28 10.13

ΩCovR-1 0.20 1,670,000 703.62

ΩCovR-2 0.22 1,600,000 807.84 755.73 73.69

40

FIGURE 10: Capsule quantitation of HSC5 and CovR mutants at 37.

FIGURE 11: Capsule quantitation of HSC5 and CovR mutants at 30.

0

15

30

45

60

HSC5 CovRIFD ΩCovR

0

100

200

300

400

HSC5 CovRIFD ΩCovR

41

fg/cfu

fg/cfu

FIGURE 12: Capsule quantitation of HSC5 and CovR mutants at 25.

FIGURE 13: Effect of temperature on HSC5 and CovR mutants. Note that HSC5

wild type showed increased capsule production at 30 and 25, which is not the

usual behavior.

0

225

450

675

900

HSC5 CovRIFD ΩCovR

37 30 25

0

200

400

600

800

HSC5 CovRIFD ΩCovR

42

fg/cfu

fg/cfu

TABLE 9: Results of capsule quantitation of complementation strain and controls

at 37.

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

HSC5-1 0.003 422,000 45.97

HSC5-2 0.003 427,000 45.43 45.70 0.38

ΩCovR-1 0.006 820,000 47.31

ΩCovR-2 0.007 1,030,000 43.94 45.63 2.38

ΩCovR(pCovRS)-1 0.005 820,000 39.43

ΩCovR(pCovRS)-2 0.006 860,000 45.11 42.27 4.01

43

TABLE 10: Capsule quantitation for complementation strain and controls at 30

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

HSC5-1 0.006 730,000 47.05

HSC5-2 0.006 760,000 45.19 46.12 1.31

ΩCovR-1 0.177 1,790,000 566.06

ΩCovR-2 0.171 1,680,000 582.68 574.37 11.75

ΩCovR(pCovRS)-1 0.009 1,040,000 49.54

ΩCovR(pCovRS)-2 0.009 1,030,000 50.02 49.78 0.34

44

TABLE 11: Capsule quantitation for complementation strain and controls at 25

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu) Average Standard

deviation

HSC5-1 0.008 1,030,000 44.46

HSC5-2 0.007 1,060,000 37.80 41.13 4.71

ΩCovR-1 0.240 2,070,000 663.72

ΩCovR-2 0.243 1,980,000 693.89 678.81 21.33

ΩCovR(pCovRS)-1 0.010 1,240,000 46.17

ΩCovR(pCovRS)-2 0.009 1,360,000 37.88 42.02 5.86

45

FIGURE 14: Capsule quantitation for CovRS complementation strain and

controls at 37.

FIGURE 15: Capsule quantitation for CovRS complementation strain and

controls at 30.

0

11.5

23.0

34.5

46.0

HSC5 ΩCovR(pCovRS) ΩCovR

0

150

300

450

600

HSC5 ΩCovR(pCovRS) ΩCovR

46

fg/cfu

fg/cfu

FIGURE 16: Capsule quantitation for CovRS complementation strain and

controls at 25.

FIGURE 17: Effect of temperature in complementation strain and controls.

0

200

400

600

800

HSC5 ΩCovR(pCovRS) ΩCovR

0

175

350

525

700

HSC5 ΩCovR(pCovRS) ΩCovR

37 30 25

47

fg/cfu

fg/cfu

Transposon mutagenesis

The efficiency is expected to be high in this kind of experiments because

the insertion is random and the mobile element is very stable. After

electroporation and incubation, several mutants were screened and selected

mutants showing anomalous capsule expression were tested for proper insertion

and sequencing. The strain used in these experiments was CovRIFD. The

capsular phenotypes observed in the transposon mutants were a) non-producer,

which didnʼt produce capsule at room temperature, and b) overproducer that

produced capsule at 37, as opposed to the background strain CovRIFD.

Approximately 20 non-producer colonies were examined and all of them showed

insertions in either hasA gene or hasA promoter area. Of particular interest were

the overproducer phenotype, and those were sequenced to identify the disrupted

area. The mutants were named OPTM for “overproducing transposon mutant”.

The data obtained from the transposon mutagenesis experiments

revealed more than one chromosomal location involved in the thermoregulation

of capsule production and that a mutation in this system confers an increased

capsule production at 37, thus, giving the potential of more virulence and

invasiveness, adding more evidence to the fact that virulence regulation is

complex in S. pyogenes and that it could respond to more than one molecular

trigger.

Four mutants with three different insertion sites that resulted in massive

capsule expression at 37, were analyzed. The strains were called OPTM2,

48

OPTM7, OPTM17 and OPTM18. All were sequenced to obtain the insertion

location.

OPTM2

The first mutant sequenced was named OPTM2. Blasting the sequence

against an MGAS315 genomic database showed an insertion in the gene

spyM3_1254 (Figure 18). There was a possibility that this disruption caused

polarity effect on downstream genes and gave an overproducer phenotype.

There are about 14 genes downstream of spyM3_1254 that are also hypothetical

proteins encoding phage associated proteins whose products have not been well

characterized. Inactivation in any of these genes by polar effect may lead to an

overproducing phenotype from a gene different from the one disrupted.

OPTM7 and OPTM16

Two other overproducers, OPTM7 and OPTM16 showed an insertion in

the cvfA (spym3_1377) gene (Figure 19). Downstream of cvfA there is a gene

encoding a guanylate kinase. CvfA is a predicted HD superfamily hydrolase that

in previous studies it has been found to be linked to virulence in S. pyogenes, as

well as virulence in B. subtillis and S. aureus (71). As part of the continued

research, protein work is being performed in order to elucidate the possible

interaction between cvfA and thermoregulation of capsule production.

49

OPTM18

Another over-producer mutant, OPTM18, showed a different insertion site.

Identification of the transposon insertion loci revealed that this mutant had an

insertion in the intergenic area, upstream from the insertion site at the promoter

area of hasA, found in non-producers (Figure 20).

There are five binding sites for CovR at the promoter area; none of these

was affected by the transposon insertion, but this particular finding may imply

that part of the sequence upstream from the promoter region of the has operon is

involved in the thermoregulation in GAS, along with other elements found in the

other mutants obtained in this study.

Capsule was measured in mutants and wild type strains. OPTM18 showed

an increment in capsule production at 37 compared with the wild type,

reaching values higher than 900 fg/μL at 37 (Figures 21 and 22).

However, insertional inactivation of the same promoter area region by site

directed mutagenesis did not lead to any observable defect on capsule

production.

50

spyM3_1254:

ATGATGAAGAAGAAAGGAGAAGCATTGGACAAAAAAGAACTGTTTGATAATTT

CCAAATAATTGGATGCGTCTCTTATCACCATTTGAGATTGAAGACATTAATAAG TGGATTGACGAAGAGAAGATGCCTGTTGAAGTTGTTAACGAGGCACTAAAAT

CGACAATTCTATACAACGCACCAAACCTTAGATACTTAAACAGAGTCTTGAAC

AACTGGAAGCGACAAGGGATTGATACAGTCGAGAAAGTCGAATTTGCTAGGT

TGCAATTTGAAAATAAAAAGCTCAGTCAAAATAAAAATCATCAATCCAACGTCC

CAAGCTGGTCGAATCCAGACTACAAAGAACCAGATTTAAAAGAATTTGCACTA stopGGAAGCATAGACGGTATAGAAGATGGATCAGGAGATTTTTAA

FIGURE 18: Complete sequence of spyM3_1254. The insertion site of the

transposon is shown with a vertical arrow. The gene is 414 nucleotides long. This

insertion generated OPTM2.

51

spyM3_1376:

a b ATGGTTAATATTATTTTATTAATTGTTTCTGCCCTCATTGGTTTAATATTAGGTTATGCACTTATTTCGATTAGACTCAAGTCTGCGAAGGAAGCTGCAGAGTTGACTCTTTTAAACGCTGAACAAGAAGCTGTTGATATTCGTGGCAAAGCAGAAGTAGATGCTGAACACATCAAAAAAACAGCTAAACGTGAAAGTAAAGCAAATCGTAAAGAATTACTTTTAGAAGCAAAAGAAGAGGCAAGAAAATATCGTGAAGAGATTGAACAAGAATTTAAGTCTGAAAGACAAGAGCTTAAACAACTCGAGACACGCTTAGCGGAGCGCTCCTTAACTCTTGACCGTAAAGATGAAAACCTATCAAGTAAAGAAAAGGTACTAGATAGTAAAGAACAAAGTCTGACCGATAAATCTAAACACATTGATGAGCGGCAACTTCAAGTAGAAAAACTTGAAGAGGAGAAAAAAGCAGAACTGGAAAAAGTTGCTGCGATGACGATTGCAGAAGCGCGTGAAGTGATTTTAATGGAGACGGAAAACAAACTGACCCATGAAATTGCGACGCGCATTCGAGATGCCGAACGTGACATCAAGGACCGAACAGTTAAAACCGCCAAGGACTTGTTAGCGCAAGCCATGCAACGCCTTGCTGGTGAGTATGTGACTGAACAAACTATTACCAGTGTCCATCTCCCAGACGACAACATGAAGGGCCGAATTATTGGACGTGAAGGCCGTAATATTCGTACTTTAGAGAGCTTGACTGGCATTGACGTTATTATTGACGATACTCCTGAAGTTGTTATCTTATCAGGATTTGATCCTATTCGACGTGAAATTGCTCGTATGACCTTGGAATCTCTGATTGCTGATGGTCGCATCCATCCAGCTCGTATCGAGGAATTGGTTGAGAAAAATCGTCTTGAAATGGATAATCGTATTCGTGAGTACGGTGAAGCTGCAGCCTATGAGATTGGTGCACCAAACCTTCATCCTGATTTGATTAAAATCATGGGACGCCTGCAATTCCGTACCTCGTTTGGTCAAAATGTCCTACGTCACTCTGTTGAGGTTGGTAAGTTAGCTGGTATTTTAGCTGGTGAGTTAGGTGAAAATGTTGCTCTTGCCCGCCGTGCTGGTTTCTTGCATGATATGGGTAAAGCTATTGACCGTGAGGTTGAAGGTAGTCACGTTGAGATTGGAATGGAATTTGCACGTAAATACAAAGAACATCCAGTTGTTGTCAACACTATTGCTAGCCACCACGGAGATGTGGAGCCAGATTCTGTGATTGCTGTGCTAGTAGCTGCAGCAGACGCCCTCAGTTCGGCTCGTCCAGGCGCTCGTAATGAGTCAATGGAGAATTACATCAAGCGTCTTCGTGATTTAGAAGAAATCGCGACAAGTTTTGATGGGGTACAAAATAGTTTTGCTCTACAAGCTGGACGTGAGATTCGTATTATGGTTCAACCTGAAAAAATTTCAGATGATCAGGTTGTCATTTTGTCGCATAAAGTAAGAGAAAAAATTGAAAACAATCTAGATTACCCAGGAAATATTAAAGTAACTGTTATTCGTGAGATGAGAGCGGTTGATTATGCCAAGTAG stop

FIGURE 19: Partial sequence of spym3_1376, the cvfA gene. The gene is 1608

nucleotides long. Here only the first 259 nucleotides are shown. The vertical

arrows represent the insertion site of the transposon. Arrow “a” points the

insertion site found in OPTM16, arrow “b” shows insertion site found in OPTM7.

52

5ʼ - spym3_2199

TCTTAATCAGATGAAGTTGTACTCCCTGAACAATTTTCATAATGTTTCCTTAATA

AATAGTGTGATCCCTACGATTATACCATTTTTATTCAGGTTAGGTGAGTGATAA

CTTTTTTTGACTTAATTGTCGGGATTCTAGTGTTAGTAAAATATAGTTTTCTACA

ATATATCCTTTACCAGTTATCATATTTCTTGATATTTTTTAAAAATCAAAATATATC aTATTTTTTCATAAAATTAGATAAAACTCTTGGAAAAGTTTACTAAAATAATTTATA

ACAATTCAATTATCCTGATTTTTCTTTTTTCGGGGGAATTTTTTTTATTGAAACA -35 CAATTTTATTAAAAATATCTCTATGTCTAGTTGACATTATTTCTTATTTATATTAG -10 +1 b RBS AATATTGAGGTCCTTTCTTTCAAGGAAATTAAAAAAGAAAGAGGTGTAATT

5ʼ -hasA

GTGCCTATTTTTAAAAAAACTTTAATTGTTTTA

FIGURE 20: The hasA promoter region. The start of hasA transcription is shown

as +1. Promoter elements (-10 and -35 region) and the ribosome-binding site

(RBS) are indicated in bold. 5ʼ-ends of hasA and spy_2199 are indicated by

horizontal arrows. Five CovR binding sites are underlined. The two vertical

arrows indicate transposon insertion sites showing opposite phenotypes. The

transposon insertion close to the transcription start site (vertical arrow b)

generated a capsule non-producer. The transposon insertion 178 bases

upstream of the start codon (vertical arrow a) generated a capsule overproducer

at 37˚C (OPTM18).

53

TABLE 12: Capsule quantitation of transposon mutants at 37

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

MGAS315-1 0.004 340,000 85.95

MGAS315-2 0.005 420,000 86.97 86.46 0.72

MGAS315ΩCovR-1 0.006 470,000 93.27

MGAS315ΩCovR-2 0.006 440,000 99.62 96.45 4.50

OPTM2-1 0.648 4,600,000 1,029.16

OPTM2-2 0.618 4,100,000 1,101.22 1,065.19 50.95

OPTM7-1 0.547 4,800,000 832.56

OPTM7-2 0.532 4,300,000 903.88 868.22 50.43

OPTM18-1 0.597 4,600,000 948.17

OPTM18-2 0.666 4,200,000 1,158.49 1,053.33 148.72

54

TABLE 13: Capsule quantitation of transposon mutants at 25

Strain (duplicated) OD640

Colony number(cfu/mL)

Capsule conc (fg/cfu)

Average Standard deviation

MGAS315-1 0.007 620,000 82.48

MGAS315-2 0.008 680,000 85.95 84.22 2.45

MGAS315ΩCovR-1 0.191 1690000 800.16

MGAS315ΩCovR-2 0.193 1650000 807.48 803.82 5.18

OPTM2-1 0.735 5,500,000 976.32

OPTM2-2 0.771 5,900,000 954.71 965.51 15.28

OPTM7-1 0.697 6,200,000 821.31

OPTM7-2 0.713 6,400,000 813.91 817.61 5.23

OPTM18-1 0.803 6,100,000 961.73

OPTM18-2 0.796 5,900,000 985.66 973.70 16.92

55

fg/cfu

FIGURE 21: Capsule production of transposon mutants at 37. Note the

increased amount of capsule in transposon mutants.

fg/cfu

FIGURE 22: Capsule production of transposon mutants at 25. Note how wild

type MGAS315 does not change the capsule amount, contrasting to the other

strains.

0

375

750

1125

1500

MGAS31

5

MGAS31

5ΩCovR

OPTM

2OP

TM7

OPTM

18

0

250

500

750

1000

MGAS

315

MGAS

315Ω

CovR

OPT

M2

OPT

M7

OPT

M18

56

Knock-out experiment

Knock-out experiments were done for phenotype confirmation of

OPTM18. The target promoter area was amplified by PCR (Table 14) and cloned

into PCIV2, a 4.195 kb plasmid harboring kanamycin resistance. After

transformation, the phenotype of the transformant was similar to the background

strain, no capsule production at 37 and capsule production at 25. The

insertion mechanism of insertional inactivation is different from transposon

mutagenesis and this could explain the difference in phenotype. While PMGC8

was inserted into the target using transposase (Figure 25), PCIV2 was integrated

causing an insertional disruption with a fragment of the target gene, generating

partial duplicates of certain target sequences that would be inactive (Figure 26)

but this could generate a partial binding site or recognition sequence.

The knock-out was confirmed using a confirmation primer that contains a

sequence in the target gene area, OPhasAP-confirm, and a set of primers that

anneal to the vector in two different sites in a reverse and forward direction, M13-

f and M13-r, respectively (Table 15). The insertion is confirmed when an

amplicon of 782 bp is present in a PCR reaction with the confirmation primer and

one of the M13 primers. In this experiment, bands were present with the M13-r

set, showing a reverse direction insertion (Figures 23 and 24).

However, knock-out experiments failed to mimic the same overproducer

phenotype. This may be partially explained by the different insertion mechanisms

for both, plasmid and transposon. While in transposon mutagenesis the

continuity of the DNA sequence is disrupted by the insertion of the mobile

57

element, in insertional disruption a partial duplication is created (figures 25 and

26).

The influence of temperature in pathogen gene expression has been

widely studied, and many thermoregulated genes are known. Several

mechanisms are described in different species and specific genomic changes

have been determined by microarray analysis in GAS, however, most of the

differential expression revealed was in hypothetical proteins (97).

The results presented in this study could throw some light upon the

hypothetical function of uncharacterized proteins and help to develop a model of

thermoregulation in S. pyogenes capsule production, leading to better

understanding of virulence and physiology in this species.

58

TABLE 14: PCR primers used for hasA promoter area amplification

Primer name Primer sequence

5OPhasASph 5ʼ - AAAAGCATGCTCTGTTTCTAGCATTCAAATGTC C - 3ʼ

3OPhasASph 5ʼ - AAAAGCATGCTCTGTTTCTAGCATTCAAATGTC C - 3ʼ

The first 4 As of the sequence are overhangs, GCATGCT is the recognition site

of the restriction enzyme SphI. The optimum PCR condition for amplification of

the hasA promoter area was 55 for annealing temperature and one minute of

extension.

TABLE 15: Primers used for hasA promoter area knock-out confirmation

Primer name Primer sequence

OPhasAP-confirm 5ʼ - TACTCCCTGAACAATTTTCATAATG - 3ʼ

M13 - f 5ʼ -CGCCAGGGTTTTCCCAGTCACGAC - 3ʼ

M13 - r 5ʼ - AGCGGATAACAATTTCACACAGGA - 3ʼ

The optimum PCR condition to check the right insertion was 52 of annealing

temperature and one minute of extension.

59

a.

b.

1 2 3 4 5 6 7

FIGURE 23: Gel electrophoresis of nucleic acids for knockout experiments. a)

amplification of the promoter area of has operon. b) Bands confirming the

insertion of PCIV2 in a reverse direction and consequent disruption of a region of

the has operon promoter area. Lanes 1-5 are transformation products. Lane 6 is

a positive control and lane 7 is a negative control.

60

782 bp

CFhasA M13-f

M13-r

FIGURE 24: Primer annealing for knock-out confirmation. The black bold lines

represent the chromosome region of hasA. The grey line in between represents

the inserted plasmid. The fine line below the chromosome with plasmid insertion

is the extension obtained in this experiment, confirming a reverse insertion. The

green rectangles are the primers in their annealing site.

61

FIGURE 25: Graphic representation of transposon insertion. The green circles

are transposase. The transposon is inserted randomly into the genome, causing

a wide variety of mutations on each transformation, derived from gene disruption

at the insertion site.

62

FIGURE 26: Graphic representation of insertional inactivation. The plasmid is

inserted into the chromosome by homologous recombination between a fragment

of the target gene and the chromosomal target gene loci. The insertion creates a

disrupted gene and a partial duplication of the target sequence.

63

REFERENCES

1. Albertí S, Ashbaugh CD, Wessels MR. Structure of the has operon

promoter and regulation of hyaluronic acid capsule expression in Group A

Streptococcus. Molecular Microbiology. 1998 Apr;28(2):343-53.

2. Almengor AC, Walters MS, McIver KS. Mga is sufficient to activate

transcription in vitro of sof-sfbX and other Mga-regulated virulence genes

in the Group A Streptococcus. Journal of Bacteriology. 2006 Mar;188(6):

2038-47.

3. Almengor AC, Kinkel TL, Day SJ, McIver KS. The catabolite control

protein CcpA binds to Pmga and influences expression of the virulence

regulator Mga in the Group A streptococcus. Journal of Bacteriology. 2007

Dec;189(23):8405-16.

4. Ashbaugh CD, Warren HB, Carey VJ, Wessels MR. Molecular analysis

of the role of the Group A streptococcal cysteine protease, hyaluronic acid

capsule, and M protein in a murine model of human invasive soft-tissue

infection. Journal of Clinical Investigation. 1998 Aug 1;102(3):550-60.

5. Ashbaugh CD, Albertí S, Wessels MR. Molecular analysis of the capsule

gene region of Group A Streptococcus: the hasAB genes are sufficient for

capsule expression. Journal of Bacteriology. 1998 Sep;180(18):4955-9.

6. Bartelt MA, Duncan JL. Adherence of Group A Streptococci to human

epithelial cells. Infection and Immunity. 1978 Apr;20(1):200-8.

64

7. Ben Nasr A, Wistedt A, Ringdahl U, Sjöbring U. Streptokinase activates

plasminogen bound to human group C and G streptococci through M-like

proteins. European Journal of Biochemistry. 1994 Jun 1;222(2):267-76.

8. Bhakdi S, Tranum-Jensen J, Sziegoleit A. Mechanism of membrane

damage by streptolysin-O. Infection and Immunology. 1985 Jan;47(1):

52-60.

9. Bisno AL, Brito MO, Collins CM . Molecular basis of group A

streptococcal virulence. Lancet of Infectious Diseases. 2003. 3 (4): 191–

200.

10. Biswas I, Scott JR. Identification of rocA, a positive regulator of covR

expression in the group A streptococcus. Journal of Bacteriology. 2003

May;185(10):3081-90.

11. Butala M, Podlesek Z, Zgur-Bertok D. The SOS response affects

thermoregulation of colicin K synthesis. FEMS Microbiology Letters. 2008

Jun;283(1):104-11.

12. Caparon, M.G, Scott, J.R. Identification of a gene that regulates

expression of M protein, the major virulence determinant of a group A

streptococci. Process of National Academy of Science USA. 1987. 84:

8677–8681.

13. Carapetis JR, Steer AC, Mulholland EK, Weber M. The global burden of

group A streptococcal diseases. Lancet of Infectious Diseases. 2005 Nov;

5(11):685-94.

65

14. Carlsson F, Berggård K, Stålhammar-Carlemalm M, Lindahl G.

Evasion of phagocytosis through cooperation between two ligand-binding

regions in Streptococcus pyogenes M Protein. The Journal of

Experimental Medicine, Volume 198, Number 7, 1057- 1068.

15. Carroll JA, El-Hage N, Miller JC, Babb K, Stevenson B. Borrelia

burgdorferi RevA antigen is a surface-exposed outer membrane protein

whose expression is regulated in response to environmental temperature

and pH. Infection and Immunity. 2001 Sep;69(9):5286-93.

16. Chaussee, M.S., Ajdic, D., and Ferretti, J.J. The rgg gene of

Streptococcus pyogenes NZ131 positively influences extracellular SpeB

production. Infection and Immunity. 1999. 67: 1715–1722.

17. Chaussee, M.A., Callegari, E.A., and Chaussee, M.S. Rgg regulates

growth phase-dependent expression of proteins associated with

secondary metabolism and stress in Streptococcus pyogenes. Journal of

Bacteriology. 2004. 186: 7091–7099.

18. Chiang-Ni C, Wang CH, Tsai PJ, Chuang WJ, Lin YS, Lin MT, Liu CC,

Wu JJ. Streptococcal pyrogenic exotoxin B causes mitochondria damage

to polymorphonuclear cells preventing phagocytosis of group A

streptococcus. Medical Microbiology and Immunology. 2006 Jun;195(2):

55-63.

19. Chiang-Ni C, Wu JJ. Effects of streptococcal pyrogenic exotoxin B on

pathogenesis of Streptococcus pyogenes. Journal of the Formosa Medical

Association. 2008 Sep;107(9):677-85.

66

20. Cho KH, Caparon MG. Patterns of virulence gene expression differ

between biofilm and tissue communities of Streptococcus pyogenes.

Molecular Microbiology. Volume 57, Issue 6, Pages 1545-1556.

21. Cho KH, Caparon MG. tRNA modification by GidA/MnmE is necessary for

Streptococcus pyogenes virulence: a new strategy to make live attenuated

strains. Infection and Immunity. July 2008. P. 3176-3186.

22. Cleary PP, Larkin A. Hyaluronic acid capsule: strategy for oxygen

resistance in group A streptococci. Journal of Bacteriology. 1979 Dec;

140(3):1090-7.

23. Collin M, Olsén A. Effect of SpeB and EndoS from Streptococcus

pyogenes on human immunoglobulins. Infection and Immunity. 2001 Nov;

69(11):7187-9.

24. Collin M, Svensson MD, Sjöholm AG, Jensenius JC, Sjöbring U,

Olsén A. EndoS and SpeB from Streptococcus pyogenes inhibit

immunoglobulin-mediated opsonophagocytosis. Infection and Immunity.

2002 Dec;70(12):6646-51.

25. Crater DL, Dougherty BA, van de Rijn I. Molecular characterization of

hasC from an operon required for hyaluronic acid synthesis in group A

streptococci. Demonstration of UDP-glucose pyrophosphorylase activity.

Journal of Biology and Chemistry. 1995 Dec 1;270(48):28676-80.

26. Crater DL, van de Rijn I. Hyaluronic acid synthesis operon (has)

expression in group A streptococci. Journal of Biology and Chemistry.

1995 Aug 4;270(31):18452-8.

67

27. Dale JB, Washburn RG, Marques MB, Wessels MR. Hyaluronate

capsule and surface M protein in resistance to opsonization of group A

streptococci. Infection and Immunity. 1996 May;64(5):1495-501.

28. Dale JB, Chiang EY, Hasty DL, Courtney HS. Antibodies against a

synthetic peptide of SagA neutralize the cytolytic activity of streptolysin S

from group A streptococci. Infection and Immunity. 2002 Apr;70(4):

2166-70.

29. Dalton TL, Scott JR. CovS inactivates CovR and is required for growth

under conditions of general stress in Streptococcus pyogenes. Journal of

Bacteriology. 2004 Jun;186(12):3928-37.

30. Darmstadt GL, Mentele L, Podbielski A, Rubens CE. Role of group A

streptococcal virulence factors in adherence to keratinocytes. Infection

and Immunity. 2000 Mar;68(3):1215-21.

31. DeAngelis PL, Papaconstantinou J, Weigel PH. Isolation of a

Streptococcus pyogenes gene locus that directs hyaluronan biosynthesis

in acapsular mutants and in heterologous bacteria. Journal of Biology and

Chemistry. 1993 Jul 15;268(20):14568-71.

32. DeAngelis PL, Yang N, Weigel PH. The Streptococcus pyogenes

hyaluronan synthase: sequence comparison and conservation among

various group A strains. Biochemistry Biophys Research Communications.

1994 Feb 28;199(1):1-10.

68

33. Dorman, C. J. Flexible response: DNA supercoiling, transcription and

bacterial adaptation to environmental stress. Trends in Microbiology, 1996.

4:214–216.

34. Dougherty BA, van de Rijn I. Molecular characterization of hasB from an

operon required for hyaluronic acid synthesis in group A streptococci.

Demonstration of UDP-glucose dehydrogenase activity. Journal of Biology

and Chemistry. 1993 Apr 5;268(10):7118-24.

35. Dougherty BA, van de Rijn I. Molecular characterization of hasA from an

operon required for hyaluronic acid synthesis in group A streptococci.

Journal of Biology and Chemistry. 1994 Jan 7;269(1):169-75.

36. Duong N, Osborne S, Bustamante VH, Tomljenovic AM, Puente JL,

Coombes BK. Thermosensing coordinates a cis-regulatory module for

transcriptional activation of the intracellular virulence system in Salmonella

enterica serovar Typhimurium. Journal of Biology and Chemistry. 2007

Nov 23;282(47):34077-84.

37. Eriksson A, Norgren M. Cleavage of antigen-bound immunoglobulin G by

SpeB contributes to streptococcal persistence in opsonizing blood.

Infection and Immunity. 2003 Jan;71(1):211-7.

38. Federle MJ, Scott JR. Identification of binding sites for the group A

streptococcal global regulator CovR. Molecular Microbiology. 2002 Mar;

43(5):1161-72.

69

39. Fogg, G.C., Gibson, C.M., and Caparon, M.G. The identification of rofA,

a positive-acting regulatory component of prtF expression: use of an m

gamma delta-based shuttle mutagenesis strategy in Streptococcus

pyogenes. Molecular Microbiology.1994. 11: 671–684.

40. Gao J, Gusa AA, Scott JR, Churchward G. Binding of the global

response regulator protein CovR to the sag promoter of Streptococcus

pyogenes reveals a new mode of CovR-DNA interaction. Journal of

Biology and Chemistry. 2005 Nov 25;280(47):38948-56.

41. Gibson CM, Caparon MG. Alkaline phosphatase reporter transposon for

identification of genes encoding secreted proteins in Gram-positive

microorganisms. Applied Environmental Microbiology. 2002 February;

68(2): 928–932.

42. Gorton D, Govan B, Olive C, Ketheesan N. B- and T-cell responses in

group a streptococcus M-protein- or Peptide-induced experimental

carditis. Infection and Immunity. 2009 May;77(5):2177-83.

43. Graham MR, Smoot LM, Migliaccio CA, Virtaneva K, Sturdevant DE,

Porcella SF, Federle MJ, Adams GJ, Scott JR, Musser JM. Virulence

control in group A Streptococcus by a two-component gene regulatory

system: global expression profiling and in vivo infection modeling. Process

of National Academy of Science U S A. 2002 Oct 15;99(21):13855-60.

70

44. Gryllos I, Cywes C, Shearer MH, Cary M, Kennedy RC, Wessels MR.

Regulation of capsule gene expression by group A Streptococcus during

pharyngeal colonization and invasive infection. Molecular Microbiology.

2001 Oct;42(1):61-74.

45. Gryllos I, Tran-Winkler HJ, Cheng MF, Chung H, Bolcome R 3rd, Lu

W, Lehrer RI, Wessels MR. Induction of group A Streptococcus virulence

by a human antimicrobial peptide. Process of National Academy of

Science U S A. 2008 Oct 28;105(43):16755-60.

46. Gupta RK, Gupta S. Cardiotoxicity of streptolysin O of group A and group

C haemolytic streptococci.Indian Journal of Pathological Microbiology.

1986 Jul;29(3):249-54.

47. Gusa AA, Scott JR. The CovR response regulator of group A

streptococcus (GAS) acts directly to repress its own promoter. Molecular

Microbiology. 2005 Jun;56(5):1195-207.

48. Gusa AA, Gao J, Stringer V, Churchward G, Scott JR. Phosphorylation

of the group A Streptococcal CovR response regulator causes

dimerization and promoter-specific recruitment by RNA polymerase.

Journal of Bacteriology. 2006 Jul;188(13):4620-6.

49. Halpern BN, Rahman S. Studies on the cardiotoxicity of streptolysin O.

British Journal of Pharmacology and Chemotherapy. 1968 Mar;32(3):

441-52.

71

50. Hanski E, Caparon M. Protein F, a fibronectin-binding protein, is an

adhesin of the group A streptococcus Streptococcus pyogenes. Process in

National Academy Science U S A. 1992 Jul 1;89(13):6172-6.

51. Hartog E, Ben-Shalom L, Shachar D, Matthews KR, Yaron S.

Regulation of marA, soxS, rob, acrAB and micF in Salmonella enterica

serovar Typhimurium. Microbiology and Immunology. 2008 Dec;52(12):

565-74.

52. Hoe NP, Goguen JD. Temperature sensing in Yersinia pestis: translation

of the LcrF activator protein is thermally regulated. Journal of Bacteriology.

1993 Dec;175(24):7901-9.

53. Hondorp ER, McIver KS. The Mga virulence regulon: infection where the

grass is greener. Molecular Microbiology. 2007 Dec;66(5):1056-65.

54. Horzempa J, Carlson PE Jr, O'Dee DM, Shanks RM, Nau GJ. Global

transcriptional response to mammalian temperature provides new insight

into Francisella tularensis pathogenesis. BioMed Central Microbiology.

2008 Oct 8;8:172.

55. Jones AM, Boucher PE, Williams CL, Stibitz S, Cotter PA. Role of

BvgA phosphorylation and DNA binding affinity in control of Bvg-mediated

phenotypic phase transition in Bordetella pertussis. Molecular

Microbiology. 2005 Nov;58(3):700-13.

56. Kirvan CA, Swedo SE, Kurahara D, Cunningham MW. Streptococcal

mimicry and antibody-mediated cell signaling in the pathogenesis of

Sydenham's chorea. Autoimmunity. 2006 Feb;39(1):21-9.

72

57. Konkel ME, Tilly K. Temperature-regulated expression of bacterial

virulence genes. Microbes and Infection. 2000 Feb;2(2):157-66.

58. Kreikemeyer, B., Boyle, M.D., Buttaro, B.A., Heinemann, M., and

Podbielski, A. Group A streptococcal growth phase-associated virulence

factor regulation by a novel operon (fas) with homologies to two-

component-type regulators requires a small RNA molecule. Molecular

Microbiology. 2001. 39: 392–406.

59. Lancefield RC. "The antigenic complex of Streptococcus hemolyticus”.

Journal of Experimental Medicine . 1928. 47: 9–10

60. Lancefield RC, Dole VP. The properties of T antigen extracted from group

A hemolytic streptococci. Journal of Experimental Medicine. 1946. 84:

449–71.

61. Leday TV, Gold KM, Kinkel TL, Roberts SA, Scott JR, McIver KS.

TrxR, a new CovR-repressed response regulator that activates the Mga

virulence regulon in group A Streptococcus. Infection and Immunity. 2008

Oct;76(10):4659-68.

62. Levin JC, Wessels MR. Identification of csrR/csrS, a genetic locus that

regulates hyaluronic acid capsule synthesis in group A Streptococcus.

Molecular Microbiology. 1998 Oct;30(1):209-19.

63. Limbago B, Penumalli V, Weinrick B, Scott JR. Role of streptolysin O in

a mouse model of invasive group A streptococcal disease. Infection and

Immunity. 2000 Nov;68(11):6384-90.

73

64. Loughman JA, Caparon MG. A novel adaptation of aldolase regulates

virulence in Streptococcus pyogenes. The EMBO journal. 2006. 25,

5414-5422.

65. Lukomski S, Sreevatsan S, Amberg C, Reichardt W, Woischnik M,

Podbielski A, Musser JM. Inactivation of Streptococcus pyogenes

extracellular cysteine protease significantly decreases mouse lethality of

serotype M3 and M49 strains. Journal of Clinical Investigation. 1997 Jun

1;99(11):2574-80.

66. Lukomski S, Burns EH Jr, Wyde PR, Podbielski A, Rurangirwa J,

Moore-Poveda DK, Musser JM. Genetic inactivation of an extracellular

cysteine protease (SpeB) expressed by Streptococcus pyogenes

decreases resistance to phagocytosis and dissemination to organs.

Infection and Immunity. 1998 Feb;66(2):771-6.

67. Madigan M, Martinko J, Dunlap P, Clark D. Brock Biology of

Microorganisms. Pearson Benjamin Cummings. 12th Edition. 2009.

68. Mao Z, Chen RR. Recombinant synthesis of hyaluronan by Agrobacterium

sp. Biotechnology Progress. 2007 Sep-Oct;23(5):1038-42.

69. Markovitz M, Cifonelli JA, Dorfman A. The biosynthesis of hyaluronic

acid by Group A Streptococcus. Biosynthesis from uridine nucleotides in

cell-free extracts. Journal of Biology and Chemistry. 1959. 234:

2343-2350.

74

70. Matsumoto M, Ishikawa N, Saito M, Shibayama K, Horii T, Sato K,

Ohta M. pyrogenic exotoxin F (SpeF) causes permeabilization of lung

blood vessels. Infect Immun. 1999 Sep;67(9):4307-11.

71. Matsumoto Y, Kaito C, Morishita D, Kurokawa K, Sekimizu K.

Regulation of Exoprotein Gene Expression by the Staphylococcus aureus

cvfB Gene. Infection and Immunity. 2007 April; 75(4): 1964–1972.

72. Mereghetti L, Sitkiewicz I, Green NM, Musser JM. Extensive adaptive

changes occur in the transcriptome of Streptococcus agalactiae (group B

streptococcus) in response to incubation with human blood. PLoS ONE.

2008 Sep 4;3(9):e3143.

73. Meyer K. Chemical structure of hyaluronic acid. Federal Process. 1958

Dec;17(4):1075-7.

74. Mitchell DA, Lee SW, Pence MA, Markley AL, Limm JD, Nizet V, Dixon

JE. Structural and functional dissection of the heterocyclic Peptide

cytotoxin streptolysin s. Journal Biology and Chemistry. 2009 May

8;284(19):13004-12.

75. Mora M, Bensi G, Capo S, et al. Group A Streptococcus produce pilus-

like structures containing protective antigens and Lancefield T antigens.

Process of National Academy of Science USA. 2005. 102 (43): 15641–6.

76. National Institutes of Health. Group A Streptococcus website. http://

www3.niaid.nih.gov/topics/streptococcal/default.htm

75

77. Nilsson M, Wasylik S, Mörgelin M, Olin AI, Meijers JC, Derksen RH, de

Groot PG, Herwald H. The antibacterial activity of peptides derived from

human beta-2 glycoprotein I is inhibited by protein H and M1 protein from

Streptococcus pyogenes. Molecular Microbiology. 2008 Feb;67(3):482-92.

78. Nordstrand A, Norgren M, Ferretti JJ, Holm SE. Streptokinase as a

mediator of acute post-streptococcal glomerulonephritis in an

experimental mouse model. Infection and Immunity. 1998 Jan;66(1):

315-21.

79. Nordstrand A, McShan WM, Ferretti JJ, Holm SE, Norgren M. Allele

substitution of the streptokinase gene reduces the nephritogenic capacity

of group A streptococcal strain NZ131. Infection and Immunity. 2000 Mar;

68(3):1019-25.

80. Norrby-Teglund A, Thulin P, Gan BS, Kotb M, McGeer A, Andersson

J, Low DE. Evidence for superantigen involvement in severe group a

streptococcal tissue infections. Journal of Infectious Diseases. 2001 Oct

1;184(7):853-60.

81. Okada N, Pentland AP, Falk P, Caparon MG. M protein and protein F act

as important determinants of cell-specific tropism of Streptococcus

pyogenes in skin tissue. Journal of Clinical Investigation. 1994 Sep;94(3):

965-77.

82. Okada N, Tatsuno I, Hanski E, Caparon M, Sasakawa C. Streptococcus

pyogenes protein F promotes invasion of HeLa cells. Microbiology. 1998

Nov;144 ( Pt 11):3079-86.

76

83. Ono S, Goldberg M, Olsson T, Esposito D, Hinton J, Ladbury J. H-NS

is a a part of a thermally controlled mechanism for bacterial gene

regulation. Journal of Biochemistry. 2005. 391, p. 203-213).

84. Ouskova G, Spellerberg B, Prehm P. Hyaluronan release from

Streptococcus pyogenes: export by an ABC transporter. Glycobiology.

2004 Oct;14(10):931-8.

85. Perez-Casal JF, Dillon HF, Husmann LK, Graham B, Scott JR.

Virulence of two Streptococcus pyogenes strains (types M1 and M3)

associated with toxic-shock-like syndrome depends on an intact mry-like

gene. Infection and Immunology. 1993 Dec;61(12):5426-30.

86. Perez-Casal J, Price JA, Maguin E, Scott JR. An M protein with a single

C repeat prevents phagocytosis of Streptococcus pyogenes: use of a

temperature-sensitive shuttle vector to deliver homologous sequences to

the chromosome of S. pyogenes. Molecular Microbiology. 1993 May;8(5):

809-19.

87. Prosseda G, Falconi M, Giangrossi M, Gualerzi CO, Micheli G,

Colonna B. The virF promoter in Shigella: more than just a curved DNA

stretch. Molecular Microbiology. 2004 Jan;51(2):523-37.

88. Prugnola A, Aricò B, Manetti R, Rappuoli R, Scarlato V. Response of

the bvg regulon of Bordetella pertussis to different temperatures and

short-term temperature shifts. Microbiology. 1995 Oct;141 ( Pt 10):

2529-34.

77

89. Ribardo DA, McIver KS. amrA encodes a putative membrane protein

necessary for maximal exponential phase expression of the Mga virulence

regulon in Streptococcus pyogenes. Molecular Microbiology. 2003 Oct;

50(2):673-85.

90. Rohde JR, Luan XS, Rohde H, Fox JM, Minnich SA. The Yersinia

enterocolitica pYV virulence plasmid contains multiple intrinsic DNA bends

which melt at 37 degrees C. Journal of Bacteriology. 1999 Jul;181(14):

4198-204.

91. Ryan K, Ray C. Sherris Medical Microbiology: An Introduction to

Infectious Diseases. McGraw-Hill. 4th Edition. 2003.

92. Schell, M. A. Molecular biology of the LysR family of transcriptional

regulators. Annual Revisions in Microbiology. 1993. 47:597–626.

93. Schrager HM, Rheinwald JG, Wessels M. Hyaluronic acid capsule and

the role of streptococcal entry into keratinocytes in invasive skin infection.

Journal of Clinical Investigation. 1996 November 1; 98(9): 1954–1958.

94. Schumann W. Thermosensors in eubacteria: role and evolution. Journal

of Biosciences. 2007 Apr;32(3):549-57.

95. Shen A, Higgins DE. The MogR transcriptional repressor regulates

nonhierarchal expression of flagellar motility genes and virulence in

Listeria monocytogenes. PLoS Pathogenesis. 2006 Apr;2(4):e30.

78

96. Sierig G, Cywes C, Wessels MR, Ashbaugh CD. Cytotoxic effects of

streptolysin o and streptolysin s enhance the virulence of poorly

encapsulated group a streptococci. Infection and Immunity. 2003 Jan;

71(1):446-55.

97. Smoot LM, Smoot JC, Graham MR, Somerville GA, Sturdevant DE,

Migliaccio CA, Sylva GL, Musser JM. Global differential gene

expression in response to growth temperature alteration in group A

Streptococcus. Process in National Academy of Science U S A. 2001 Aug

28;98 (18):10416-21.

98. Starr CR, Engleberg NC. Role of hyaluronidase in subcutaneous spread

and growth of group A streptococcus. Infection and Immunity. 2006 Jan;

74(1):40-8.

99. Stoolmiller AC, Dorfman A. The biosynthesis of hyaluronic acid by group

A streptococcus. Exposizione Annuale de Biochimica Medica.

1970;30:65-78.

100.Sugahara K, Schwartz N, Dorfman A. Biosynthesis of Hyaluronic Acid

by Streptococcus. The Journal of Biological Chemistry. 1979. Vol. 254. No

14, Issue of July 25, pp. 6252-6261.

101.Svensson MD, Sjöbring U, Luo F, Bessen DE. Roles of the

plasminogen activator streptokinase and the plasminogen-associated M

protein in an experimental model for streptococcal impetigo. Microbiology.

2002 Dec; 148(Pt 12):3933-45.

79

102.Timmer AM, Timmer JC, Pence MA, Hsu LC, Ghochani M, Frey TG,

Karin M, Salvesen GS, Nizet V. Streptolysin O promotes group A

Streptococcus immune evasion by accelerated macrophage apoptosis.

Journal of Biology and Chemistry. 2009 Jan 9;284(2):862-71.

103.Tlapak-Simmons VL, Baron CA, Gotschall R, Haque D, Canfield WM,

Weigel PH. Hyaluronan biosynthesis by class I streptococcal hyaluronan

synthases occurs at the reducing end. Journal of Biology and Chemistry.

2005 Apr 1;280(13):13012-8.

104.Tobe T, Yoshikawa M, Sasakawa C. Thermoregulation of virB

transcription in Shigella flexneri by sensing of changes in local DNA

superhelicity. Journal of Bacteriology. 1995 Feb;177(4):1094-7.

105.Treviño J, Perez N, Ramirez-Peña E, Liu Z, Shelburne SA 3rd, Musser

JM, Sumby P. CovS simultaneously activates and inhibits the CovR-

mediated repression of distinct subsets of group A Streptococcus virulence

factor-encoding genes. Infection and Immunity. 2009 May 18.

106.Van de Rijn I. Streptococcal hyaluronic acid: proposed mechanisms of

degradation and loss of synthesis during stationary phase. I. Journal of

Bacteriology. Dec. 1983, p. 1059-1065

107.Wang H, Lottenberg R, Boyle MD. Analysis of the interaction of group A

streptococci with fibrinogen, streptokinase and plasminogen. Microbial

Pathogenesis. 1995 Mar;18(3):153-66.

108.Weigel PH, Hascall VC, Tammi M. Hyaluronan synthases. Journal of

Biology and Chemistry. 1997. 272: 13997-14000.

80

109.Wessels M, Moses A, Goldberg J, Dicesare T. Hyaluronic acid capsule

is a virulence factor for mucoid group A streptococci. Process in National

Academy of Science USA. October 1991. Vol. 88, pp. 8317-8321.

110.Whitnack E, Bisno AL, Beachey EH. Hyaluronate capsule prevents

attachment of group A streptococci to mouse peritoneal macrophages.

Infection and Immunity. 1981 Mar;31(3):985-91.

111.Widner B, Behr R, Von Dollen S, Tang M, Heu T, Sloma A, Sternberg

D, Deangelis PL, Weigel PH, Brown S. Hyaluronic acid production in

Bacillus subtilis. Applied Environmental Microbiology. 2005 Jul;71(7):

3747-52.

112.Woischnik M, Buttaro BA, Podbielski A. Inactivation of the cysteine

protease SpeB affects hyaluronic acid capsule expression in group A

streptococci. Microbial Pathogenesis. 2000 Apr;28(4):221-6.

113.Yamada T, Kawasaki T. Microbial synthesis of hyaluronan and chitin:

New approaches. Journal of Bioscience and Bioengineering. 2005 Jun;

99(6):521-8.

114.Yang WS, Park SO, Yoon AR, Yoo JY, Kim MK, Yun CO, Kim CW.

Suicide cancer gene therapy using pore-forming toxin, streptolysin O.

Moecularl Cancer Therapy. 2006 Jun;5(6):1610-9.

115.Yu H, Stephanopoulos G. Metabolic engineering of Escherichia coli for

biosynthesis of hyaluronic acid. Metabolic Engineering. 2008 Jan;10(1):

24-32.

81

APPENDICES

APPENDIX A: Media, Buffers and Solutions

I. Media

1) Luria-Bertani Broth (per liter):

10 grams NaCl

10 grams Tryptone (Fisher Scientific)

5 grams Yeast extract (Difco)

Adjust pH to 7.6 with NaOH solution. Autoclave at 20 psi for 30

minutes.

2) THY broth (per liter):

30 grams Todd Hewitt (BBL)

2 grams Yeast extract (Difco)

Autoclave at 20 psi for 30 minutes.

3) TP broth (per liter):

30 grams Todd Hewitt (BBL)

2 grams Yeast extract (Difco)

20 grams Peptone (Bacto brand)

Autoclave at 20 psi for 30 minutes

83

4) THY agar plates (per liter, approximately 40 plates):

30 grams Todd Hewitt

2 grams Yeast extract

14 grams Agar (Bacto brand)

Autoclave at 20 psi for 30 minutes. Let cool down to 55°C. Add

appropriate antibiotic if needed before pouring plates.

5) LB agar plates (per liter, approximately 40 plates):

10 grams NaCl

10 grams Tryptone

5 grams Yeast extract

14 grams Agar (Bacto brand)

Autoclave at 20 psi for 30 minutes. Let cool down to 55°C. Add

appropriate antibiotic if needed before pouring plates. Add X-Gal if

needed.

84

II. Antibiotics

Antibiotic AbbreviationSolvent Concentration of stock solution

Storage

Chloramphenicol Cam, Cm 50% EtOH 10 mg/ml 4°CErythromycin for

E. coli

Erm, Em 100% EtOH 75 mg/ml 4°C

Erythromycin for

S. pyogenes

Erm, Em 100% EtOH 1 mg/ml 4°C

Kanamycin Kan, Kn ddH2O, filter 100 mg/ml 4°CSpectinomycin Spc ddH2O, filter 100 mg/ml 4°C

For E. coli:

Antibiotic Final concentration (µg/ml)

Volume of stock solution (µL)10 ml 100 ml

Chloramphenicol 100 15 150Erythromycin 750 10 100Kanamycin 50 5 50Spectinomycin 100 10 100

For S. pyogenes:

Antibiotic Final concentration(µg/ml)

Volume of stock solution (µL)10 ml 100 ml

Chloramphenicol 3 3 30Erythromycin 1 10 100Kanamycin 700 70 700Spectinomycin 150 15 150

85

III.Buffers and solutions:

1) PBS buffer (10X)

80 grams NaCl

2 grams KCl

2 grams K phosphate monobasic

11.5 grams Na phosphate dibasic heptahydrate

pH 7.2

2) TAE Buffer (10X)

48.8 grams Tris Base

11.42 mL Glacial acetic acid

2 mL 0.5M EDTA pH 8.0

q.s. to 1 Liter with ddH2O

86

APPENDIX B: Protocols

I. Generation of In-Frame Deletion Strain

1. Once Erm resistant colonies are obtained (which have been grown at

30°C) pick colonies and grow them in 10 ml of THY+Erm1 at 30°C.

2. Next morning, make freezer stocks of the overnight cultures and

inoculate 10 µL of overnight cultures into 10 ml of THY+Erm1 and

incubate at 39°C. This shift of temperature will select for the integration

of the plasmid into the chromosome, as pJRS233 cannot replicate at

39°C.

3. Next morning, inoculate 10 µL of overnight culture into 10 ml of THY

+Erm1 and incubate at 39°C. Passing twice at 39°C in presence of

Erm1 ensures integration of the plasmid.

4. Next morning, inoculate 10 µL of overnight culture into 10 ml THY

without Erm and incubate at 30°C. This temperature shift selects for

the excision of the plasmid, which could leave either the wild type or

deletion allele of the gene.

5. Repeat step 4) twice. Three times passing of the cultures at 30°C

without Erm is necessary to get sufficient percentage of Erm sensitive

cells in the culture.

87

6. After the final passage, make freezer stock of 2 cultures and plate,

and dilutions on THY agar in the absence of Erm, and incubate

overnight at 30°C in an anaerobic conditions.

7. Pick colonies and replica-plate (by patching with sterile wooden sticks)

on THY+ Erm1 and THY plates. Patch 100 colonies. Incubate

overnight in anaerobic conditions at 30°C.

8. Grow up those patches which were Erm sensitive at 37°C and make

freezer stocks and confirm chromosomal structure by PCR after

chromosomal extraction, as these strains could have either wild type or

deleted chromosomal structure. Test 10 colonies. If all the 10 colonies

have the wild type genotype, try again from the beginning.

9. Make freezer stock of wild type revertant as a control and another

stock of settled down strains.

II. Isopropanol precipitation

1. Transfer the sample to an Eppendorf tube. Sample volume in a tube

should be less than 800 µL. if sample volume is over 800 µL split in

two tubes.

2. Add 1/10 volume of 3M Sodium Acetate solution (pH5.2) to the sample.

88

3. Add 70% of the final volume of room temperature isopropanol to the

DNA solution and mix well.

4. Centrifuge the sample immediately at 10,000 – 15,000 x g for 1 hour at

4°C.

5. Carefully decant the supernatant without disturbing the pellet.

6. Add 1 ml of 70% EtOH to a tube gently.

7. Centrifuge at 10,000 – 15,000 xg for 15 minutes at 4°C.

8. Carefully decant the supernatant without disturbing the pellet.

9. Remove the residual ethanol solution with a pipette very carefully.

10. Dry the pellet at 50°C for 5 – 20 minutes (depending on the size of the

pellet).

11. Add DW. Added amount of DDW depends on the final DNA

concentration you want to get. Usually 50 µL is enough.

12. Tap the tubes vigorously to dissolve DNA for about 5 minutes per tube.

13. Examine DNA concentration by gel electrophoresis or nanodrop.

14. Store sample at -20°C.

89

III.Electroporation of S. pyogenes

1. Prepare DNA

2. Prepare THY plates containing appropriate antibiotics.

3. Add 100 µL of filter sterilized 2M glycine solution to 10 ml TP medium

and add appropriate antibiotic.

4. Inoculate S. pyogenes and incubate them overnight at 37°C.

5. Next morning, add 1 ml of filter sterilized 2M glycine solution to 200 ml

of TP medium plus appropriate antibiotic.

6. Take out 2 ml for blanks (1 ml per cuvette) for spectrophotometry and

add 2 ml of overnight culture to 98 ml of TP+ glycine and add

appropriate antibiotic.

7. Incubate the culture at 37°C until the culture reaches OD600=0.24.

8. Distribute cultures into 4 tubes of 50 ml falcon tubes.

9. Harvest cells by centrifugation (7,000 x g for 10 minutes at room

temperature). Resuspend total cell pellets in 4 ml of the supernatant.

10. Incubate cells at 43°C for 9 minutes.

11. Add 6 ml of 15% glycerol solution and centrifuge the cells (7,000 x g)

for 10 minutes at room temperature.

90

12. Discard the supernatant and wash the cells three times with 10 ml of

15% glycerol solution.

13. Remove the supernatant as much as possible.

14. Resuspend the cell pellet in 800 µL of 15% glycerol solution.

15. Keep competent cells at room temperature until electroporation.

16. Place tubes of 10 ml of THY media and electroporator cuvettes on ice.

17. Set the electroporator condition (Voltage: 2100 V, Capacitor: 25 µF,

Resistance: 200 Ohms, electroporator cuvette: 2 mm).

18. Place DNA in an ice-cold 2 mm electroporator cuvette:

Suicide vectors: 10 – 20 µL

Shuttle vectors: 0.5 – 2 µL

Transposon vectors: 10 – 20 µL

pJRS233: 10 – 20 µL

19. Add 200 µL of competent cells into the cuvettes ad pipette up and

down to mix well.

20. Give electric shock.

21. Immediately, remove cells from the cuvette and add the cells into the

cold 10 ml THY media.

91

22. Record the time constant.

23. Incubate cells for 30 minutes on ice, then 1 hour and 30 minutes at

37°C. Dry the plates during this time.

24. Harvest cells by centrifugation (7,000 x g) for 10 minutes at room

temperature and resuspend cells in 500 µL of THY medium.

25. Plate 100 µL of cells on each plate.

26. Incubate overnight at 37°C in anaerobic conditions.

IV. Electroporation of S. pyogenes with pJRS233 derivatives

1. Prepare pJRS233 using a Maxi prep kit (initial volume: 300 ml of

overnight culture, final volume: 50-100 µL in DDW).

2. Prepare THY agar plates with no antibiotic (24 ml THY agar/plate)

3. Add 100 µL of filter sterilized 2M glycine solution to 10 mL of TP

medium.

4. Inoculate S. pyogenes and grow overnight at 37°C.

5. Next morning, add 1 ml of filter sterilized 2M glycine solution to 100

mL of TP medium.

6. Take blanks for spectrophotometry (2 mL) and add 2 mL of overnight

culture to 98 mL of TP+Glycine medium containing proper antibiotic.

92

7. Incubate the culture at 37°C until the culture reaches OD= ≈ 0.24.

Usually it takes 2 hours for wild type.

8. Turn on the heat block containing a 15 ml tube block and set

temperature at 43°C.

9. When the culture reaches OD= ≈0.24, distribute cultures into two 50

mL falcon tubes and harvest cells by centrifugation (7,000 x g for 10

minutes at 14°C).

10. Resuspend total cell pellets in 2 mL of the supernatant and transfer to

a 15 mL falcon tube.

11. Incubate cells at 43°C for 9 minutes. Use the heat block.

12. Add 8 mL of 15% glycerol solution and centrifuge the cells (7,000 x g

for 10 minutes at 14°C).

13. Discard the supernatant and wash the cells twice with 10 mL of 15%

glycerol solution (centrifugation at 14°C).

14. During the final wash, place tubes of 10 mL of THY media and

electroporator cuvettes on ice. The tube number are transformation

number plus one (for negative control). The cuvette number is the

same as the transformation number.

15. Remove supernatant as much as possible after the final wash.

16. Resuspend the cell pellet in 600 µL of 15% glycerol solution.

93

17. Keep the competent cells at room temperature, not on ice. Perform a

Electroporation as soon as possible.

18. Set the electroporator (voltage: 2100V, Capacitor: 25µF, Resistance:

200 Ω, electroporator cuvette: 2 mm).

19. Place DNA in an ice-cold 2 mm electroporator cuvette.

a. pJRS233 derivative: 10-20 µg

b. DNA concentration after Maxi-prep using 300 mL of 20-24 hrs

culture: 3-4 µg/µL

20. Add 200 µL of competent cells into the cuvettes and pipette up and

down to mix well.

21. Press the red button on the electroporator.

22. Immediately, remove cells from the cuvette and add the cells into the

cold 10 mL THY media.

23. Record the time constant.

24. Incubate cells for 30 minutes on ice, then 1 hour in the 30°C incubator.

You can dry the agar plates during this time if plates are not dry.

25. Harvest cells by centrifugation (7,000 x g for 10 minutes at room

temperature) and resuspend cells in 300 µL of THY medium.

94

26. Add 300 µL of cells to 15 mL of THY soft agar (cooled down to 43°C),

mix gently and pour 3 mL of cells-soft agar mix onto a THY + Erm1

plate.

27. Incubate the plates in an anaerobic jar at 30°C at least 2 hours and no

more than 3 hours.

28. Remove the plates from the anaerobic jar. Overlay with an additional 3

mL THY soft agar containing erythromycin (4 µg/mL)

29. Incubate plates at 30°C for 48 hours in an anaerobic jar.

V. E. coli transformation:

1. Thaw frozen Top10 competent cells on ice.

2. To each Top10 cell aliquot add 1 – 200 ng of transforming DNA in a

volume of 10 µL or less. For a ligate, use 10 µL (maximum amount).

Include a positive control (the undigested vector for the cloning) and no

DNA control.

3. Place cells on ice for 30 minutes.

4. Heat shock cells for 30 seconds at 43°C.

5. Add 1 ml of LB broth to each tube and incubate at 37°C for one hour,

shaking intermittently or in a 37°C shaker incubator.

95

6. Dry agar plates.

7. Plate 200 µL of cells on selective agar plates (6 plates for

transformation and 1 plate for control cells).

8. Incubate plates overnight at 37°C.

VI. Quantitation of S. pyogenes capsule:

1. Grow S. pyogenes overnight in 10 ml THY media with appropriate

antibiotic.

2. Next morning, dilute cells to 10-5, 10-6, and 10-7 with sterile PBS buffer

and plate 100 µL of cells on THY agar plates. Incubate the plates at

37°C in anaerobic conditions. Make triplicate dilutions and place each

set in a different jar (or as many as the temperature that will be tested)

3. 24 hours later, take out the jars and place one at 25°C (if more

temperatures will be tested, then move each jar to each temperature)

and save one jar for measurement at 37°C. Measure the capsule

amount produced by the 37°C jar.

4. 4-5 hours later, measure the capsule amount produced by colonies on

the plates incubated at 25°C.

96

Capsule Quantitation using Stains-All reagent solution

Analyze in duplicate. Do not use PBS buffer in the Stains-All assay

because it inhibits the reaction

5. 2X Stains-All reagent: 20 mg of Stains-All and 60 µL of glacial acetic

acid in 50 mL of 50% formamide. Wrap the reagent bottle with foil

because itʼs degraded by light. Store at 4°C. The reagent is effective

within a month.

6. Take colonies carefully using a spatula and place this colony into a

tube with 10 ml of DDW. Duplicate the samples.

7. Vortex the tubes about 1 minute to resuspend cells and capsule.

8. Take 100 µL of the resuspension and dilute it in 900 µL of PBS buffer.

Save for later serial dilution and plating. This will be the first tube of the

serial dilution.

9. Centrifuge the 10 ml tubes to precipitate cells (6,000 x g) for 10

minutes at room temperature.

10. Take 500 µL of supernatant into a spectrophotometry cuvette.

11. Mix with 500 µL of 2X Stains-all reagent.

12. Prepare hyaluronic acid solutions for a standard curve. Add 1 µL, 2 µL,

3 µL, 4 µL and 5 µL of 1 mg/ml hyaluronic acid in 500 µL of DDW in a

spectrophotometer cuvette. Mix the solution very well with a P1000

97

pippetman. This mixing step is very important because hyaluronic acid

does not dissolve in the Stains-all reagent. Add 500 µL of the Stains-all

reagent to each cuvette and mix well.

13. Prepare blanks with 500 µL of DDW mixed with 500 µL of Stains-all.

14. Measure OD640

15. Dilute resuspended cells to 10-3, 10-4 and 10-5 with PBS buffer and

plate 100 µL of cells on THY agar plates. Make the dilution and plating

in duplicate. Next morning count appropriately spread colonies and

calculate cell concentration (cell number/ml).

16. Using the standard curve and cell concentration, calculate the amount

of capsule produced per CFU.

17. 5 hours later, measure the capsule amount produced by colonies on

the plates at room temperature the same way it was done before,

make dilutions, plate and then count colonies to calculate cell

concentration and capsule production.

VII. Storing cells at -80°C freezer

1. Grow cells overnight in THY media with antibiotics if needed.

2. Transfer 0.7 mL of culture into a cryogenic tube and add 0.3 mL of

80% glycerol solution. Mix well.

98

3. Label the tube and store at -80°C.

VIII. Plasmid extraction

All plasmids were propagated in E. coli Top10 cells and extracted using

Biotech Gerard Maxi Prep Kit according to manufacturerʼs protocol,

except that final volume was 2 mL per sample. Initial volume: 300 mL

of LB broth.

IX. DNA Purification for PCR products

PCR products were purified using Qiagen PCR Purification Kit

following the protocol provided by the manufacturer.

X. Preparation of Chromosome of S. pyogenes with Sigma column

1. Grow 10 ml of overnight culture in THY broth with 100 µL of 20mM

glycine and add appropriate antibiotic if necessary.

2. Harvest cells by centrifugation at 7,000 rpm for 10 minutes.

3. Wash twice with 3 ml of TE buffer.

4. Add 200 µL of lysozyme (100 mg/µL), 2 µL of mutanolysin (100 µ/

µL), 80 µL of RNAse and 520 µL of Gram positive solution.

5. Incubate 1 hour at 37°C with intermittent shaking.

99

6. Follow the remaining steps provided by the manufacturer.

XI. Preparation of E. coli competent cells

1. Grow Top10 cells in 10 mL of LB broth at 37°C overnight.

2. Dilute 1 mL of cells into 200 mL of LBB in a 500 mL flask.

3. Make solutions and keep them on ice.

4. Grow cells with vigorous shaking until they reach 10-8 cells/mL. It

takes approximately 2 hours.

5. Divide 200 mL culture into four 50 mL conical tubes.

6. Harvest cells at 5,000 x g for 5 minutes at 4°C. From this point on,

cells must be kept ice cold.

7. Gently resuspend each pellet in 10 mL ice cold, sterile solution I.

8. Recover cells by centrifugation at 5,000 x g, 5 minutes, 4°C.

9. Discard supernatant. Gently resuspend each pellet in 10 mL of

solution II. Pipette up and down. Do not vortex.

10. Place tubes on ice for 15 minutes.

11. Recover cells by centrifugation, 5,000 x g, 5 minutes, 4°C. gently

resuspend all pellets in 10 mL of solution II containing 10% (v/v)

glycerol.

100

12. Divide cells in 200 µL aliquots in eppendorf tubes (approximately 50

tubes) and freeze at -80°C.

Solution I 10 mM MOPS (KOH) pH 7.010 mM RbCl

Solution II 100 mM MOPS (KOH) pH 6.550 mM CaCl2

10 mM RbClStock solutions .1 M MOPS pH 7.0

.1 M RbCl1.0 M MOPS pH 6.50.5 M CaCl2

Solution I 32 mL ddH2O4 mL 0.1M MOPS pH 7.04 mL 0.1 RbCl

Solution II 35 mL ddH2O5 mL 1.0 M MOPS pH 6.55 mL 0.1 M RbCl5 mL 0.5 M CaCl2

Solution II containing 10%

glycerol

10 mL solution II1.43 mL of 80% glycerol

101

VITA

Graduate School

Southern Illinois University

Trilce Michelle Galeas Peña Date of Birth: April 10th, 1979.

1211 W Schwartz St Apt 2. Carbondale, Illinois 62901

Calle Camaguey # 21. San Salvador, El Salvador.

mgaleas@gmail.com

Universidad Autónoma de Santo Domingo

Doctor in Medicine, June 2005.

Special Memberships and Awards:

Fulbright Scholarship recipient

United Nations University – Program for Biotechnology for Latin America and the Caribbean Scholarship recipient

Fundación Carolina Scholarship recipient

American Society for Microbiology member 2007 – present

American Association for Advancement of Science member 2008- present

Thesis Title:

Thermoregulation of Capsule Production in Streptococcus pyogenes strain HSC5.

Major Professor: Dr. KyuHong Cho

102