Post on 03-Dec-2018
1
SUPPLEMENTARY DATA 1
2
Table S1. Primers used in this study 3 4 Primer name Sequence
Primers used to clone nlpE
EcoRI-nlpE-5 cccgaattcggtcgggaataaaaagaaggaatgg
HindIII-nlpE-3 gcgaagcttgtctcaagacgggttactgccc
Primers used to check single mutants
cpxR.ext-5 gattgattcataaatactcc
cpxR.ext-3 caaacagtaagttaatgaaatc
rcsB.ext-5 aaatgctcgcagctgaccc
rcsB.ext-3 tgccgtcaacggacaaagcgg
degP.ext-5 cagcgatcttcttaagctatat
degP.ext-3 acaagtgcatcaaccgcgac
Kmfrt.verif-5 ggattcatcgactgtggccg
Kmfrt.verif-3 cagtcatagccgaatagcct 5
2
1 Table S2. ApoEdpL-W upregulated genes in E. coli K-12 2
3
N° Gene name FCa Encoded function Regulonb
Sugar metabolism and polysaccharide synthesis
b4026 yjbE 1910.25 Production of uncharacterized polysaccharide Rcs(+)
b2053 gmd 1848.92 GDP-mannose 4,6-dehydratase Rcs(+)
b2052 wcaG 1734.66 GDP-4-keto-6-L-galactose reductas Rcs(+)
b2055 wcaE 1595.95 Predicted colanic acid glycosyl transferase Rcs(+)
b2054 wcaF 1513.11 Putative colanic acid acetyltransferase Rcs(+)
b2056 wcaD 1246.84 Putative colanic acid polymerase Rcs(+)
b2062 wza 1014.80 Putative polysaccharide export protein Rcs(+), σE(+)
b2051 wcaH 826.60 GDP-mannose mannosyl hydrolase
b2060 wzc 814.95 Protein-tyrosine kinase Rcs(+), σE (+)
b2049 manC 807.14 Mannose-1-phosphate guanylyltransferase Rcs(+)
b2059 wcaA 763.64 Predicted glycosyl transferase Rcs(+)
b2057 wcaC 713.09 Predicted glycosyl transferase Rcs(+)
b2050 wcaI 481.47 Predicted glycosyl transferase Rcs(+)
b4029 yjbH 478.81 Production of uncharacterized polysaccharide Rcs(+)
b2046 wzxC 435.13 Colanic acid exporter Rcs(+)
b2058 wcaB 393.09 Putative colanic acid acetyltransferase Rcs(+)
b1951 rcsA 372.17 Colanic acid biosynthesis activator Rcs(+), Cpx*
b2047 wcaJ 312.20 Putative UDP-glucose lipid carrier transferase
b2045 wcaK 236.57 Predicted pyruvyl transferase
b2044 wcaL 183.10 Putative colanic acid glycosyl transferase Rcs(+)
b4028 yjbG 87.62 Production of uncharacterized polysaccharide Rcs(+)
b2028 ugd 37.15 UDP-glucose 6-dehydrogenase Rcs(+)
b1897 otsB 6.46 Trehalose-6-phosphate phosphatase
b1236 galU 3.80 Glucose-1-phosphate uridylyltransferase Rcs(+)
b1613 manA 2.56 Mannose-6-phosphate isomerase
b2388 glk 2.14 Glucokinase
Osmotic shock
b1283 osmB 39.19 Osmotically inducible lipoprotein Rcs(+), Cpx*, σS
b1482 osmC 4.94 Osmotically inducible protein Rcs(+), σS
3
b4376 osmY 4.05 Hyperosmotically inducible periplasmic protein Rcs(+), σS
Envelope stress response
b1743 spy 85.42 Periplasmic protein Rcs(+), Cpx(+),
BaeR(+)
b0161 degP 17.03 Serine endoprotease Cpx, σE
b3914 cpxP 13.36 Periplasmic repressor Cpx, σS
b3913 cpxP 12.44 Periplasmic repressor Cpx, σS
b2573 rpoE 3.82 RNA polymerase sigma factor RpoE Cpx(-), σE (+)
b2572 rseA 3.50 Anti- σE factor Cpx(-), σE (+)
b0220 ykfE 11.91 Inhibitor of vertebrate C-lysozyme Rcs(+), Cpx*, σS
b3347 fkpA 3.11 Peptidyl-prolyl isomerase σE (+)
Oxidative stress response
b1732 katE 8.94 Hydroperoxidase (catalase) Rcs(+), σS
b3238 yhcN 3.99 Hydrogen peroxide response σE (-)
b4062 soxS 3,07 DNA binding transcriptional regulator
Heat shock proteins
b3686 ibpB 95.49 Heat shock chaperone σH
b2592 clpB 4.16 Protein disaggregation chaperone σH
b3687 ibpA 28.70 Heat shock protein σH
b0891 lolA 3.51 Outer membrane lipoprotein carrier protein
b0014 dnaK 2.36 Molecular chaperone σE (+), σH
b1379 hslJ 9.46 Heat-inducible protein σH
b0473 htpG 3.06 Heat shock protein 90 σH
b1829 htpX 2.52 Heat shock protein HtpX Cpx(+), σH
Antibiotic resistance
b1536 ydeI 114.11 Stress response protein Rcs(+)
b1531 marA 4.24 DNA-binding transcriptional activator,
multiple antibiotic resistance
Iron homeostasis
b0593 entC 251.84 Isochorismate synthase Fur
4
b0585 fes 172.56 Enterobactin/ferric enterobactin esterase Fur
b0594 entE 155.00 Enterobactin synthase multienzyme component Fur
b0586 entF 106.88 Enterobactin synthase multienzyme component
b0595 entB 89.16 Isochorismatase Fur
b0596 entA 79.86 2,3-dihydroxybenzoate-2,3-dehydrogenase Fur
b0584 fepA 58.44 Iron-enterobactin outer membrane transporter Fur
b1684 sufA 8.28 Fe-S cluster assembly protein
b4367 fhuF 7.63 Ferric iron reductase involved in ferric
hydroximate transport
Fur
b0150 fhuA 7.53 Ferrichrome outer membrane transporter
b3005 exbD 2.31 Biopolymer transport protein
Regulators
b1305 pspB 4.57 DNA binding transcriptional regulator
b1060 yceP 4.31 Biofilm formation regulatory protein σH
b1304 pspA 3.45 Phage shock protein A σH (-)
b1608 rstA 2.34 DNA binding response regulator
Miscellaneous functions
b0597 rsmB (ybdB) 82.14 16S rRNA methyltransferase Fur
b2674 nrdI 51.14 Ribonucleotide reductase stimulatory protein Fur
b3926 glpK 5.34 Glycerol kinase
b3927 glpF 5.18 Glycerol uptake facilitator protein
b2597 yfiA 5.12 Translation inhibitor protein
b2209 eco 4.55 Ecotin, serine protease inhibitor
b3426 glpD 3.05 Glycerol-3-phosphate dehydrogenase
b0461 tomB (yb) 2.97 Modulation of Hha toxicity Cpx(+)
b1480 rpsV 2.69 30S ribosomal subunit S22 Rcs(+), σS
b3932 hslV 2.37 ATP-dependent protease/peptidase subunit σH
b3931 hslU 2.13 ATP-dependent protease/peptidase subunit σH
b0492 ybbN 2.02 Thioredoxin-like protein σH
Predicted proteins
b0379 yaiY 492.16 Predicted inner membrane protein Rcs(+)
b1110 ycfJ 417.96 Hypothetical protein Rcs(+)
b0005 yaaX 170.84 Hypothetical protein
b1115 ycfT 103.62 Hypothetical protein Rcs(+)
5
b3563 yiaB 86.63 Hypothetical protein
b2671 ygaC 65.73 Hypothetical protein Rcs(+), Fur
b1172 ymgG 21.78 Hypothetical protein Rcs(+)
b1171 ymgD 18.19 Hypothetical protein Rcs(+), Cpx
b0753 ybgS 17.75 Hypothetical protein
b2833 ygdR 13.91 Hypothetical lipoprotein Rcs(+)
b1846 yebE 13.82 Hypothetical protein Cpx
b2936 yggG 9.98 Predicted peptidase Rcs(+)
b4045 yjbJ 9.39 Putative stress-response protein Rcs(+), σS
b3055 ygiM 8.73 Putative signal transduction protein σE
b1063 yceB 6.71 Predicted lipoprotein
b0453 ybaY 5.68 Hypothetical protein
b4217 ytfK 4.82 Hypothetical protein Rcs(+), σS
b1452 yncE 3.99 Hypothetical protein
b0865 ybjP 3.73 Predicted lipoprotein σS
b3192 mlaC (yrbC) 2.47 Predicted subunit of phospholipid ABC
transporter
b3191 mlaB (yrbB) 2.30 Predicted subunit of phospholipid ABC
transporter
b2922 yggE 2.36 Hypothetical protein Rcs(+), σS
b3098 yqjD 2.06 Hypothetical protein
Intergenic regions
IG 2135266/857-r 1650.08 yegH->wza
IG 2116427/701_r 508.94 wzxc->wcaK
IG 1341353/620_r 101.90 ycit->osmB
IG 2317849/8062_r 80.83 atoS->rcsC
IG 3198607/847_f 9.11 ygiF->ygiM
IG 2302414/3127_f 4.53 eco->mqo a FC, fold change. 1 b Known regulators of gene expression according to (1-4) and EcoCyc database (http://ecocyc.org/). When 2 established, the up (+)- or down(-)-action of the regulator is reported in brackets. Cpx*, regulation predicted by 3 promoter region analysis but not validated experimentally. 4 5 1. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. 2006. Conserved and variable functions 6
of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 7
6
2. De Wulf P, McGuire AM, Liu X, Lin EC. 2002. Genome-wide profiling of promoter 1 recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 2 277:26652-26661. 3
3. Ferrieres L, Clarke DJ. 2003. The RcsC sensor kinase is required for normal biofilm formation 4 in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid 5 surface. Mol Microbiol 50:1665-1682. 6
4. McHugh JP, Rodriguez-Quinones F, Abdul-Tehrani H, Svistunenko DA, Poole RK, Cooper 7 CE, Andrews SC. 2003. Global iron-dependent gene regulation in Escherichia coli. A new 8 mechanism for iron homeostasis. J Biol Chem 278:29478-29486. 9
10 11 12 13 14 15 16 17 18 19
20
7
1 Table S3. ApoEdpL-W downregulated genes in E. coli K-12 2
3
N° Gene name FCa Encoded functiona Regulonb
Sugar metabolism and transport
b4032 malG -16.27 Maltose transporter subunit BaeR(-)
b4035 malK -15.17 Maltose/maltodextrin transporter ATP-binding
protein
b4033 malF -14.62 Maltose transporter subunit BaeR(-)
b4036 lamB -11.67 Maltoporin
b4239 treC -8.97 Trehalose-6-P hydrolase
b4037 malM -7.61 Maltose regulon periplasmic protein
b3416 malQ -7.03 4-Alpha-glucanotransferase Rcs(+)
b4034 malE -6.96 Maltose transporter subunit
b4240 treB -6.40 Trehalose(maltose)-specific PTS system
components IIBC
TCA cycle and cell energy
b2210 mqo -3.08 Malate:quinone oxidoreductase
b1746 astD -3.08 Succinylglutamic semialdehyde
dehydrogenase
b0722 sdhD -2.88 Succinate dehydrogenase cytochrome subunit
b2283 nuoG -2.82 NADH dehydrogenase subunit
b0723 sdhA -2.81 Succinate dehydrogenase flavoprotein subunit
b3894 fdoG -2.80 Formate dehydrogenase-O major subunit
b3893 fdoH -2.75 Formate dehydrogenase-O beta subunit
b3892 fdoI -2.66 Formate dehydrogenase-O subunit
b0724 sdhB -2.54 Succinate dehydrogenase iron-sulfur subunit
b3891 fdhE -2.38 Formate dehydrogenase accessory protein
b2284 nuoF -2.21 NADH dehydrogenase I subunit
b2518 ndk -2.18 Nucleoside diphosphate kinase
b2286 nuoC -2.15 NADH:ubiquinone oxidoreductase subunit
b2282 nuoH -2.14 NADH dehydrogenase subunit
b1612 fumA -2.13 Fumarase
b4108 phnA -2.00 NADP-NADPH transhydrogenase
8
Nucleic acid metabolism
b0411 tsx -4.80 Nucleoside channel
b2497 uraA -4.69 Uracil transporter
b0337 codA -3.80 Cytosine deaminase
b0336 codB -3.44 Cytosine permease
b0721 sdhC -3.28 Succinate dehydrogenase cytochrome subunit
b0945 pyrD -3.09 Dihydro-orotate dehydrogenase 2
b4346 mcrB -3.03 Specific restriction enzyme subunit
b3962 udhA -2.93 Soluble pyridine nucleotide transhydrogenase
b4246 pyrL -2.72 pyrBI operon leader peptide
b1281 pyrF -2.67 OMP decarboxylase
b4005 purD -2.56 Phosphoribosylglycinamide synthetase
b3714 purP (yieG) -2.47 Adenine uptake
b2393 nupC -2.38 Nucleoside transporter
b1062 pyrC -2.35 Dihydro-orotase
b0033 carB -2.30 Carbamoyl phosphate synthase subunit
b2498 upp -2.22 Uracil phosphoribosyltransferase
b4006 purH -2.18 XICAR transformylase / IMP cyclohydrolase
b0238 gpt -2.14 xanthine-guanine phosphoribosyltransferase
Amino acid and peptide metabolism
b1487 ddpA -5.07 D-ala-D-ala transporter subunit
b1488 ddpX -4.58 D-alanyl-D-alanine dipeptidase
b2309 hisJ -2.93 Histidine-binding periplasmic protein
b1748 astC -2.43 Succinylornithine/acetylornithine transaminase
b2310 argT -2.39 Aysine/arginine/ornithine transporter subunit
b0674 asnB -2.10 Asparagine synthetase B
b3965 trmA -2.06 tRNA (uracil-5-)-methyltransferase
Nitrogen assimilation
b3869 glnL -2.83 Nitrogen regulation protein
b1988 nac -2.69 Nitrogen assimilation transcriptional regulator
b0451 amtB -2.57 Ammonium transporter
Porins
b0929 ompF -23.13 Outer membrane protein F Cpx(-),σE (-)
9
b0553 nmpC -11.24 Outer membrane porin protein
b2215 ompC -2.32 Outer membrane porin protein C Cpx(+), σE (-)
Iron homeostasis
b1905 ftnA -6.66 Ferritin iron storage protein Fur
Miscellaneous functions
b4314 fimA -2.80 Major type 1 fimbriae subunit Rcs(+)
Regulators
b1987 cbl -3.60 Transcriptional regulator
b4438 ryeE -2.95 Small regulatory RNA
b2369 evgA -2.84 DNA binding response regulator
b0034 caiF -2.70 DNA binding transcriptional activator
b2669 stpA -2.48 DNA binding protein
Predicted proteins
b4354 yjiY -10.06 Hypothetical protein
b0458 ylaC -2.32 Hypothetical protein
b0786 ybhL -2.25 Hypothetical protein
b4353 yjiX -2.21 Hypothetical protein
b2351 yfdh -2.17 Bactoprenol glucosyl transferase
Intergenic regions
IG 2660152/602_r -2.26 iscR/yfhP->tmrJ/yfhQ a FC, fold change. 1 b Known regulators of gene expression according to (1-4) and EcoCyc database (http://ecocyc.org/). When 2 established, the up(+)- or down(-)-action of the regulator is reported in brackets. 3 4 1. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. 2006. Conserved and variable functions 5
of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 6 2. De Wulf P, McGuire AM, Liu X, Lin EC. 2002. Genome-wide profiling of promoter 7
recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 8 277:26652-26661. 9
3. Ferrieres L, Clarke DJ. 2003. The RcsC sensor kinase is required for normal biofilm formation 10 in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid 11 surface. Mol Microbiol 50:1665-1682. 12
4. McHugh JP, Rodriguez-Quinones F, Abdul-Tehrani H, Svistunenko DA, Poole RK, Cooper 13 CE, Andrews SC. 2003. Global iron-dependent gene regulation in Escherichia coli. A new 14 mechanism for iron homeostasis. J Biol Chem 278:29478-29486. 15
16
10
1 Figure S1 Audrain et al 2
Sublethal concentrations of ApoEdpL-W have only a mild effect on E. coli growth. E. coli 3
growing cells were exposed to 0, 3 and 3.5 µM of ApoEdpL-W for 45 min and samples were 4
taken every 15 min, serially diluted and plated on LB plates. Percent of survival was calculated 5
by CFU counting and compared to numbers obtained at t=0 min. Statistical analysis: asterisks 6
indicate values significantly different from no ApoEdpL-W condition by the two-tailed unpaired 7
Student’s t-test : *p<0.05. 8
9
11
1 2
Figure S2 Audrain et al 3
The σE pathway is not required for E. coli tolerance to ApoEdpL-W. Decreased σE activity in 4
the wild-type strain or cpxR mutant did not significantly affect E. coli tolerance to ApoEdpL-W. 5
Survival of the wild-type strain carrying an empty vector or pCA24N-rseA (A) and cpxR mutant 6
carrying an empty vector or pCA24N-rseA (B) upon exposure to ApoEdpL-W. Cells were grown 7
in MH medium plus chloramphenicol and IPTG (0.01mM) until reaching OD600 0.1. They were 8
exposed to 0 and 5 µM (MIC) of ApoEdpL-W for 80 min. Samples were taken every 20 min, 9
serially diluted and plated on appropriate LB plates. Survival of each strain was estimated by 10
CFU counting and compared to numbers obtained prior to ApoEdpL-W treatment. NS: not 11
significant by two-tailed unpaired Student’s t-test. 12
12
1 2
3
Figure S3 Audrain et al 4
Impact of DegP on planktonic E. coli tolerance to ApoEdpL-W. degP mutation increased E. 5
coli susceptibility to ApoEdpL-W, whereas complementation of degP mutant with pCA24N-6
degP restored the wild-type phenotype. Wild-type strain, its corresponding degP mutant and the 7
complemented strain were grown in MH medium plus chloramphenicol and IPTG (0.025 mM) 8
until reaching OD600 0.1. They were exposed to 0 and 5 µM (MIC) of ApoEdpL-W for 60 min. 9
Survival of each strain was estimated by CFU counting and compared to numbers obtained prior 10
to ApoEdpL-W treatment. Statistical analysis: *p<0.05; NS: not significant by two-tailed 11
unpaired Student’s t-test. 12
13
14
15
13
1
2 3
4
Figure S4 Audrain et al 5
Induction of the Cpx pathway increased E. coli tolerance to ApoEdpL-W. Overexpression of 6
NlpE increased E. coli tolerance to ApoEdpL-W in a CpxR dependent manner. Survival of the 7
wild type strain carrying an empty vector or pBAD-nlpE and cpxR mutant carrying an empty 8
vector or pBAD-nlpE upon exposure to ApoEdpL-W. Cells were grown in MH medium plus 100 9
µg/ml ampicillin and 0.05% arabinose until reaching OD600 0.1. They were exposed to 0 and 5 10
µM (MIC) of ApoEdpL-W for 80 min. Survival of each strain was estimated by CFU counting 11
and compared to numbers obtained prior to ApoEdpL-W treatment. Statistical analysis: *p<0.05 12
and **p<0.01 by two-tailed unpaired Student’s t-test. 13
14 15
16 17 18 19 20