Transcript of Marked effects of tachykinin in myositis both in the experimental side
http://www.diva-portal.org
This is the published version of a paper published in ISRN
Inflammation.
Citation for the original published paper (version of
record):
Song, Y., Stål, P., Yu, J., Forsgren, S. (2013)
Marked effects of tachykinin in myositis both in the experimental
side and contralaterally:
studies on NK-1 receptor expressions in an animal model.
ISRN Inflammation, 2013(907821)
N.B. When citing this work, cite the original published
paper.
Permanent link to this version:
http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-68846
Hindawi Publishing Corporation ISRN In!ammation Volume "#$%,
Article ID &#'("$, $& pages
http://dx.doi.org/$#.$$))/"#$%/&#'("$
Research Article Marked Effects of Tachykinin in Myositis Both in
the Experimental Side and Contralaterally: Studies on NK-1 Receptor
Expressions in an Animal Model
Yafeng Song,1 Per S. Stål,1 Jiguo Yu,2 and Sture Forsgren1
! Section for Anatomy, Department of Integrative Medical Biology,
Umea University, "#! $% Umea, Sweden & Sports Medicine Unit,
Department of Surgical and Perioperative Sciences, Umea University,
"#! $% Umea, Sweden
Correspondence should be addressed to Sture Forsgren;
sture.forsgren@anatomy.umu.se
Received "( November "#$"; Accepted $( December "#$"
Academic Editors: L. Dagna, P. Gascon, and D. Szukiewicz
Copyright © "#$% Yafeng Song et al. *is is an open access article
distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Muscle injury and in!ammation (myositis) in a rabbit model of an
unilateral muscle overuse were examined. It is unknown if the
tachykinin system has a functional role in this situation. In this
study, therefore, the neurokinin-$ receptor (NK-$R) expression
patterns were evaluated. White blood cells, nerve fascicles, +ne
nerve +bers, and blood vessel walls in myositis areas showed NK- $R
immunoreaction. NK-$R mRNA reactions were observable for white
blood cells and blood vessel walls of these areas. NK-$R
immunoreaction and NK-$R mRNA reactions were also seen for muscle
+bers showing degenerative and regenerative features. *ere were
almost no NK-$R immunoreactions in normal muscle tissue.
Interestingly, marked NK-$R expressions were seen for myositis
areas of both the experimental side and the contralateral
nonexperimental side. EIA analyses showed that the concentration of
substance P in the muscle tissue was clearly increased bilaterally
at the experimental end stage, as compared to the situation for
normal muscle tissue. *ese observations show that the tachykinin
system is very much involved in the processes that occur in muscle
injury/myositis. *e e,ects can be related to proin!ammatory e,ects
and/or tissue repair. *e fact that there are also marked NK-$R
expressions contralaterally indicate that the tachykinin system has
crossover e,ects.
1. Introduction
*e tachykinins conform to a group of neuropeptides with marked
functional roles. *e neuropeptide which is most well known in the
group is substance P (SP). SP has pro- nounced pro-in!ammatory
e,ects, including the promotion of extravasation and accumulation
of leukocytes at sites of injury [$]. SP is also involved in the
so-called neurogenic in!ammation ["], wound healing [%], and
angiogenesis [-]. SP is on the whole known to have
autocrine/paracrine e,ects [)]. SP has a high a.nity for the
neurokinin-$ receptor (NK- $R), having its major functions via this
receptor [/].*e NK- $R has -#' amino acids and belongs to the
G-protein-coupled group of receptors ['].*e NK-$R can play an
important role in the modulation of the accumulation of white blood
cells that occurs in in!ammatory processes [(].
*ere is frequently an upregulation of tachykinins in situ- ations
with in!ammation and tissue injury.*at includes the
situation in, for example, ulcerative colitis [&] and
experimen- tally induced acute pancreatitis and associated lung
injury [$#]. In the latter situation, the NK-$R is considered to
play a key role in the damaging process [$$]. It is actually a fact
that the upregulation of tachykinins that occurs in in!ammation in
general is associated with increases in NK-$R expression [$",
$%].
We have in recent experimental studies been using a rabbit model of
a marked overuse a,ecting the triceps surae muscle and found that
the overuse led to muscle in!amma- tion (myositis) and muscle
tissue derangements [$-]. *is model can be considered to be a
suitable animal myositis model [$-–$/].*ere is a great lack of
information concerning the involvement of tachykinins in situations
with myositis and muscle injury. Tachykinins might possibly be
involved in the processes that occur. Interestingly, in our studies
using the overuse muscle model, it was observed that myositis and
muscle tissue derangements not only occurred for the triceps
" ISRN In!ammation
surae muscle in the experimental side but also for this muscle in
the nonexercised, contralateral side [$-].*is observation of an
a,ection not only for the experimental side but also for the
non-experimental contralateral side is completely new information
concerning experimentally induced muscle injury/myositis. How the
situation is for tachykinins in this respect is therefore also
unknown. *e information that so far exists concerning tachykinins
andmuscle in!ammation is related to the patterns of SP
immunoreactions observed at the spinal cord level and for the
neurons innervating the muscles [$'–$&].
*ere is no information at all on the expression of the NK-$R in the
situationwithmyositis/markedmuscle changes. Our recent observations
described above for the overuse rabbit model thus reinforced us to
investigate the NK-$R pat- terns during myositis development.
Immunohistochemistry and in situ hybridization were used.
Comparisons between tachykinin (SP) and NK-$R expression patterns
were also made.*e above described experimental model was used, as
it has been observed to be suitable in establishing myositis. *e
triceps surae muscle on both the experimental and non-
experimental, contralateral sides were evaluated.
*e main aim of the study was to examine for the impor- tance of the
tachykinin system in the myositis process. *e hypothesis was that
NK-$R would be highly expressed in the a,ected areas with myositis.
A further aim was to evaluate if there were upregulations of the
NK-$R expressions not only in the experimental side but also in the
contralateral non- experimental side.
2. Material and Methods
&.!. Animals. Female New Zealand white rabbits with a weight of
approximately - kg (age ranging from / to & months) were used
for the experiment. In total, samples from "- animals were
evaluated. Six of the animals belonged to a reference group
(controls). Eighteen animals corresponded to animals that were
subjected to an exercise protocol leading to a marked overuse of
the triceps surae muscle. *ey underwent the experimental exercise
procedure on their right leg every second day, for a total period
of $, %, and / weeks, respectively, (see further below).
&.&. Exercise Procedure. To induce muscle overuse, a lab-
oratory model (a “kicking machine”) leading to marked overuse of
the triceps surae muscle was used. Repetitive passive !exion and
extension of the right ankle was achieved by means of a pneumatic
piston and a band was placed around the hip/pelvis to restrict
movements on the le0 side. During the plantar !exion phase, an
active contraction was furthermore induced by electrical
stimulation via surface electrodes (Pediatric electrodes -# -"/A,
Hewlett Packard, Andover, MA, USA) placed " cm apart over the
triceps surae on the right side.*e stimulation was synchronized
with the plantar !exion movement of the piston by a microswitch,
which trigged the stimulator unit (Disa stimulator Type $-E, Disa
Elektronik A/S, Herlev, Denmark). A single impulse of #."ms
duration was delivered ()ms a0er the initiation of the plantar
!exion at an amplitude of %)–)#V. *e stimulation
intensity, which was tested out before the experiment, was
submaximal and the intensity was individually corrected to obtain
powerful muscle contractions. *e movement frequency was $)#
movements per minute. *e le0 leg was not attached to the kicking
machine. *is exercise session lasted for " hours and was repeated
every second day for $, %, or / weeks. *e frequency and duration of
repetitive movements were chosen in order to make a very marked
strain on the muscles.*e experimental procedures conform to those
previously described [$-, $), "#] and do, with some amendments
being made, conform to those described in studies by Backman and
collaborators ["$].
All animals were anaesthetized during the exercise pro- cedure, by
means of an intramuscular injection of fen- tanyl!uanison
(#."-#.%mL/kg) and diazepam (#."mL/kg; )mg/mL), followed by
additional injections of fentanyl!u- anison (#.$mL/kg) every
%#–-)min during the experimental procedure in order to maintain
anesthesia. For analgesia, buprenorphine, #.#$–#.#)mg/kg, was given
s.c. postopera- tively a0er each experiment session.
&.'. Collection, Freezing, and Sectioning of Muscle Samples. On
the day a0er the last exercise, the rabbits were sacri+ced by an
intraperitoneal injection of an overdose of Pentobar- bital natrium
and the triceps surae with attached Achilles tendon was dissected
out. *e muscle samples were directly transported on ice to the
laboratory. Further dissection was made, whereby samples conforming
to the distal parts of the soleus and gastrocnemius muscles () !
(–$#mm) were further processed. *ese samples were +xed by immersion
overnight at -C in an ice-cold solution of -% formaldehyde in #.$M
phosphate bu,er (pH '.#). *ey were therea0er thoroughly washed in
Tyrode’s solution containing $#% sucrose at -C overnight.*e samples
were mounted on thin cardboard in OCT embedding medium (Miles
Laboratories, Naperville, IL, USA), frozen in propane chilled with
liquid nitrogen, and stored at "(#C. Series of '-(#m thin sections
were cut using a cryostat. *e sections were mounted on slides
precoated with chrome-alum gelatine and were then processed for
immunohistochemistry or morphology. Other series were sectioned for
the purpose of being used for in situ hybridization. Additional
samples were processed without being chemically +xed. *ese were
directly mounted and frozen in the way described above and were
sectioned and processed for the demonstration of tissue
morphology.
&.(. Staining for the Demonstration of Morphology (Haema-
toxylin-Eosin). Sections in the series were stained in Harris
Haematoxylin solution for "min. *ey were then rinsed in distilled
water, dipped in #.$% acetic acid for a few seconds, followed by
washing in running water. Counterstaining was achieved by immersion
in eosin for $min.*e sections were dehydrated in ethanol and
mounted in Permount.
&.). Immunohistochemistry
&.).!. Staining Procedures for the Demonstration of NK-!R. A0er
washing with PBS )min ! %, incubation for "#min in a $% solution of
Triton X-$## (Kebo lab, Stockholm,
ISRN In!ammation %
Sweden) in #.#$M phosphate bu,er saline (PBS), pH '.", containing
#,$%sodiumazide as preservative, was performed, wherea0er followed
rinsing in PBS three times, )min each time.*e sections were then
incubated in )% normal donkey serum (code no: #$'-###-$"$, Jackson
Immune Research Lab. Inc.) in PBS and were therea0er incubated with
the NK- $R primary antibody, diluted in PBS (pH '.-), in a humid
environment. Incubation was performed for /#min at %'C. A0er
incubation with speci+c antiserum and three )-minute washes in PBS,
another incubation in normal donkey serum followed, a0er which the
sections were incubated with FITC- conjugated A.niPure donkey
anti-goat IgG ('#)-#&)-$-'; Jackson ImmunoResearch Lab Inc,
dilution $ : $##) for %#min at %'. *e sections were therea0er
washed in PBS and then mounted in Vectashield Mounting Medium
(H-$###) (Vector Laboratories, Burlingame, CA, USA). Examination
was carried out in a Zeiss Axioscope " plus microscope equipped
with an Olympus DP'# digital camera.
As an alternative procedure, sections were initially pre- treated
with acid potassium permanganate for "min, a pro- cedure found to
enhance speci+c immuno!uorescence reac- tions [""]. A0er this
pretreatment, the procedures described above followed. Both
procedures (with or without acid potassium treatment) gave in
principle similar results.*ere were, however, some di,erences in
staining intensities and levels of background reactions. It was
therefore found useful to analyse sections by using both
procedures.
&.).&. Double-Staining NK-!R Antibody/Tachykinin (SP) Anti-
body. *e initial procedures conformed to the procedures described
above concerning the staining for the NK-$R anti- body. *at
included the use of FITC-conjugated A.niPure donkey anti-goat IgG
('#)-#&)-$-'). *e sections were then rinsed in PBS -! ".)min
and incubated in )%normal donkey serum in PBS for $)min. *e
sections were therea0er incu- bated with a monoclonal tachykinin
(SP) antibody ((-)#- #)#), Biogenesis, Poole, UK), diluted $ : )#
in PBS with BSA, for /#min at %'C. A0er incubation with this
antiserum and - ! ".)-minute washes in PBS, a new incubation in
normal donkey serum followed, a0er which the sections were
incubated in TRITC-conjugated A.niPure donkey anti-rat lgG
('$"-#")-$)#) (Jackson ImmunoResearch, West Grove, PA, USA),
diluted $ : -# in PBS supplemented with #.$% BSA, for %#min at %'C.
*e procedures for washing and mounting were as described above. *e
reactions obtained with the tachykinin antibody are further on
referred to as SP immunoreactive.
&.).'. Double-Staining NK-!R Antibody/Mouse Monoclonals. *e
initial procedures conformed also in this case to the procedures
described above concerning the staining for the NK-$R antibody. *at
included the use of FITC-conjugated A.niPure donkey anti-goat IgG
('#)-#&)-$-') and rinsing in PBS - ! ".)min, and as normal
serum, )% normal donkey serum in PBS was used. A0er the procedures
for NK-$R immunolabelling were +nished, the sections were rinsed in
PBS - ! ".)min and incubated in )% normal rabbit serum in PBS with
BSA for $)min. A0er that, the sections were incu- bated with the
other primary antibody to be stained for (all
of which were mouse monoclonal antibodies) and which was against
white blood cell markers, betaIII-tubulin, S-$##beta, or desmin
(see further below), and diluted in PBS with BSA, in a humid
environment. Incubation was performed for /#min at %'C. A0er
incubation with this antiserum and - ! ".)-minute washes in PBS, a
new incubation in normal rabbit serum followed, a0er which the
sections were incubated in rabbit anti-mouse immunoglobulins/TRITC
(R#"'/) (Dako, Denmark). As an alternative procedure, normal donkey
serum was used instead of rabbit normal serum, and in these cases,
donkey anti-mouse immunoglobulins/TRITC ('$)-"&)-$)#) (Jackson
ImmunoResearch)were utilized. Both variants gave similar and
reliable results. *e secondary antibody was used at a dilution of $
: -# (R#"'/) or $ : )## ('$)-"&)-$)#); the incubation with
secondary antiserum in both cases proceeded for %#min at %'C. *e
sections were therea0er washed in PBS for - ! ".)min and were then
mounted in Vectashield Mounting Medium (H-$###) or Mounting Medium
with DAPI (H-$)##) (Vector Laborato- ries, Burlingame, CA, USA) in
order to identify nuclei.
&.).(. Antibodies. AnNK-$R antibody produced in goats was used
(sc-)""#, Santa Cruz). It is an a.nity puri+ed polyclonal antibody
raised against a peptide mapping within an internal region of NK-$R
of human origin. It was regularly used at a dilution of $ : )#–$ :
$## in #.$% in PBS. *e tachykinin antibody used in double stainings
was an SP monoclonal antibody produced in rats ((-)#–#)#),
Biogenesis, Poole, UK). It was used at a dilution of $ : )# in
#.$%BSA in PBS.*e antibody (-)#–#)#) recognizes the COOH terminal
end of SP and has been previously used for the immunohistochem-
ical detection of SP in experimental animals and man ["%].
*e other antibodies used in double stainings were mouse monoclonal
antibodies. One of these conformed to an antibody against CD/(,
(code no: M#($-), fromDAKOC- ytomation (Glostrup, Denmark),
whichwas used at a dilution of $ : $## in #.$% BSA in PBS.*e
antigen for this antibody is a glycosylated transmembrane
glycoprotein, which is mainly located in lysosomes. Another one was
an anti-rabbit T- cell/neutrophil antibody from AbD Serotec
(Oxford, UK) (MCA(#)G), which was utilized at a dilution of $ : $##
in #.$% BSA in PBS. *is antibody is an a.nity puri+ed antibody
against a cell surface antigen, which is reported to be expressed
by a subset of T cells, thymocytes, neutrophils, and platelets. A
third antibody used was the antibody MAB$#(' from Chemicon
(Temecula, CA, USA), which reacts with human eosinophil peroxidase.
*is antibody was used at a dilution of $ : $## in #.$% BSA in PBS.
Furthermore, an antibody against betaIII-tubulin (T(//#, Sima
Aldrich, USA, $ : $##) was used, being utilized at a dilution of $
: )##. *e antibody speci+cially recognizes an epitope located on
isotype III of beta-tubulin. An antibody against S-$## (beta-
subunit) was also utilized (S ")%") (Sigma, New York, NY, USA). It
was used at a dilution of $ : )##. *e antibody recognizes an
epitope located on the beta-chain, but not the alpha-chain, of
S-$##. An antibody against desmin was used as well (M#'/#). It was
used at a dilution of $ : $##. It is by the supplier
(DAKOCytomation, Glostrup, Denmark) reported to give speci+c
reactivity with desmin in a wide
- ISRN In!ammation
variety of tissues as seen via Western blotting experiments. It is
furthermore reported not to show reactivity with other types of
intermediate +laments ["-]. Further descriptions of the antibodies
are described elsewhere [$/, "), "/].
&.).). Control Stainings. Control stainings concerning the
NK-$R antibody included the use of NK-$R blocking sub- stance
(sc-)""#P) ()##g/mL antiserum). Ordinary stainings for
NK-$Rweremade in parallel. Concerning controls for the SP antibody,
blockingwith SP peptide (full length SP peptide) from Sigma (S/((%)
()##g/mL antiserum) was used. Other control stainings conformed to
stainings when the primary antibodieswere excluded (bu,er instead
of the antibody).*e characteristics of antibodies used have also
been evaluated in previous studies ["%–")].
&.*. In Situ Hybridization (ISH). In order to complement the
results obtained at the protein level (via immunohistochem- istry),
stainings to show the situation at the mRNA level (via in situ
hybridization) were performed. Digoxigenin- (DIG-) hyperlabelled
oligonucleotide triple probe cocktail (ssDNA) for the detection of
the NK-$R, also known as tachykinin receptor $ (TACR$) (Gene
Detect, New Zealand), was thus used. A “triple probe cocktail” was
prepared as the exact rabbit TACR$ sequence is not yet cloned. *is
contained three antisense probes directed towards both human and
rat TACR$ mRNA, which is considered to have a very high probability
of detecting rabbit TACR$ mRNA. *e antisense probe sequences
were
- probe 1$: GGCTGCACGAACTGGTTAGACTCAG-
AGGTGTTGGTGGAGATGTTGGGG,
- probe 1": TGGAGCTTTCTGTCATGGTCTTGGA-
GTTGCTGCGAGAGGAGCCGTTGG,
- probe 1%: TGACCACCTTGCGCTTGGCAGAGA-
CTTGCTCGTGGTAGCGGTCAGAGG.
As a negative control, a “triple probe cocktail” of the cor-
responding sense DIG-hyperlabelled ssDNA probes was used. Also
$-actin antisense/sense probes (GD)###-OP) (GeneDetect, New
Zealand) were used for control purposes.
Based on the features noted concerning tissue morphol- ogy
(myositis a,ection) and NK-$R immunohistochemical reaction
patterns, certain samples were chosen for the in situ
hybridization. *ese corresponded to $ sample from the control
nonexercised group, $ sample from the $-week group (exercised
side), and " samples from the /-week group (one from nonexercised
side and one from exercised side). Two of the samples were from the
soleus muscle and two were from the gastrocnemius muscle. It was
considered that the samples used were representative samples.
ISH was performed according to an established pro- tocol ["'] using
an alkaline-phosphatase- (AP-) labelled anti-DIG antibody for
detection, with a few modi+cations ["(, "&]. *e cryostat knife
was washed in '#% EtOH in diethyl pyrocarbonate [DEPC]–H"O and the
sections were mounted on Super Frost Plus slides (nr. #-$%##,
Menzel- Glaser, Braunschweig, Germany). Concerning the
further
procedures, see ["(, "&]. In brief, an aliquot ()# ng) of the
ssDNA probe was added to $)#L of hybridisation solution in a $.)mL
microfuge tube, denatured for )min in (#C and then put on ice. *e
hybridisation solution was as follows: )###L formamide, "## #L "#x
SSC, )# #L of "#x Denhardt’s solution, )##L herring sperm DNA
[$#mg/mL] heat denatured, ") #L baker’s yeast RNA [$#mg/mL], $') #L
dextran sulphate [)#%], and total volume was: $.#mL. *e
probe-containing hybridisation solution was then applied to each
section, the sections being covered with cover slips and sealed
with nail polish. Incubation followed at )/C overnight.
&.%. EIAMethod. In order to complement theNK-$R reaction
studies, EIA analysis of SP content for the muscle specimens was
made. For this purpose, muscle samples were frozen in liquid
nitrogen directly a0er being weighed, wherea0er they were
homogenized, by the use of Precellys "- tissue homoge- nizer
(Bertin Technologies, SaintQuentin enYvelines, Cedex, France), and
further processed for EIA using commercially available enzyme
immunoassay SP kit (Phoenix Pharma- ceuticals, Burlingame, CA,
USA). For further details of the procedures, see [%#]. Analysis was
restricted to the analysis of control muscles and muscles of /-week
groups. *e assay was conducted in accordance with the instructions
from the manufacturer. An SP EIA analysis evaluating all the
various groups will be conducted and described in a forthcoming
study.
&.$. Statistics. Independent T-tests were done concerning
evaluations of di,erences in SP concentration between con- trols
and /w groups. *e statistical so0ware SPSS PASW Statistics $( (SPSS
Inc, Chicago, USA) was used. A %-value< #.#) was considered to
be signi+cant.
&.". Ethics. *e study protocol was approved by the local eth-
ical committee at Umea University (A %-/#'). *e approval was
obtained before the start of the study. A licensed breeder had bred
all animals for the sole purpose of being used in animal
experiments. All e,orts were made to minimize animal
su,ering.
3. Results
'.!. Morphology. *e specimens of the soleus and gastroc- nemius
muscles showed marked morphological changes in response to the
experimental procedure. *e changes were especially pronounced a0er
the /-week experiment period (Figure $). However, morphological
alterations were also to some extent seen in the $-week and %-week
groups. *e morphological changes included an occurrence of marked
in!ammatory in+ltrates, a pronounced variability in muscle +ber
size, and occurrence of marked muscle +ber alter- ations
(morphologically “abnormalmuscle +bers”) (Figure $). Numerous white
blood cells could be seen to be dispersed in the tissue (Figures
$(b) and $(c)).*e morphological changes were seen in certain parts
of the specimens. In other areas of the specimens, the morphology
was seemingly una,ected.
ISRN In!ammation )
Importantly, morphological changes occurred to an almost similar
extent in the muscles in the contralateral nonexercised side as in
the muscles in the exercised side (Figures $(b) and $(c)). *e
pattern for the morphological changes was the same for the soleus
and the gastrocnemius muscles, but the extent of the changes was
somewhat more pronounced for the soleus muscle. *e +ndings
concerning the morphology are in accordance with previous +ndings
for the triceps surae muscle in response to the experimental
regimen here used [$-].
'.&. Immunohistochemistry
'.&.!. Reactions in the InvadingWhite BloodCells. Immunore-
actions for NK-$R occurred in cells that were dispersed in the
in!ammatory in+ltrates (Figure ").*at was the situation for both
the exercised (Figures "(a)–"(c)) and nonexercised (Figure "(d))
sides and for both muscles. *e reactions frequently showed a
granular/punctuate appearance. Double stainings showed that parts
of the NK-$R immunoreac- tive cells were also SP immunoreactive,
whilst others did not show SP immunoreaction (Figures "(e) and
"(f)). *e NK-$R immunoreactions were abolished in sections pro-
cessed with NK-$R antiserum that had been preabsorbed with NK-$R
antigen (Figures "(g) and "(h)). *e NK-$R immunoreactive cells were
found to correspond to CD/( immunoreactive cells, that is,
macrophages (Figures %(a) and %(b)), or eosinophils (Figure %(c)).
*ere were no NK-$R immunoreactions in cells showing reactions for
the antibody that was a T-cell/neutrophil marker.
'.&.&. Reactions in Muscle Fibers Showing In+ltration of
White Blood Cells. White blood cells were not only seen to be
dispersed in the tissue, but could also be seen to be coalesced
into muscle +bers (morphologically “abnormal muscle +bers”) (c.f.
above) in the myositis areas (Figure $(a)). *e stainings for NK-$R
showed that there were frequently NK-$R immunoreactions in the
cells that had invaded the muscle +bers (Figures -(a)–-(d)). *at
was the situation for exercised as well as nonexercised sides and
for soleus as well as gastrocnemiusmuscles. As was the case for
thewhite blood cells that were dispersed in the tissue, white blood
cells within the muscle +bers were also immunolabelled for
eosinophil marker or CD/(. Double-staining NK-$R/SP showed that SP
immunoreactions were frequently detected in the NK-$R
immunoreactive cells within the muscle +bers (Figures -(d) and
-(e)).*e characteristics of these abnormal muscle +bers are further
clari+ed below.
'.&.'. Reactions inNerve Structures. Nerve fascicles of various
dimensionswere seen in specimens of bothmuscles. Based on the
morphologic appearance, a large number of these were entirely
composed of myelinated nerve +bers. Immunohis- tochemical analysis
revealed that NK-$R immunoreactions were never observed within
nerve fascicles being entirely built up by myelinated nerve +bers
(Figure )(a)).
# !
(c)
F23456 $: Sections of the soleus muscle of the /-week group,
exercised side (a, b) and nonexercised side (c), stained with
H&E. Morphological features are shown.*ere is an excess of
connective tissue (asterisk) and presence of adipose tissue to the
le0 in (a).*ere are pronounced in!ammatory cell in+ltrates in (b,
c) (asterisks). *ere is an overall marked variability in muscle
+ber sizes (b, c). In the inset in (a), a +ber that is invaded by
numerous in!ammatory cells is seen. *e appearance to the right in
(a) is to some extent resembling the situation for normal muscle.
(1) indicates adipose tissue. Bar = )# #m.
experimental animals were nonimmunoreactive for NK-$R (Figures )(a)
and )(b)). Occasional immunoreactive nerve +bers with a varicose
appearance were, however, noted close to these nonimmunoreactive
nerve fascicles (Figure )(b)). Such nerve +bers could also be
observed in association with blood vessels in connective tissue
spaces.
Marked immunoreactions for NK-$R were, on the other hand, noted in
nerve fascicles of large/considerable sizes that were located in
myositis areas and in the close proximities of these areas for both
muscles and for both exercised and nonexercised sides. *e reactions
were point-like but were frequently coalesced. Due to the
occurrence of marked reaction intensities for these, broad areas
were partly seen to exhibit !uorescence (Figures )(c)–)(e)). *ese
types of
/ ISRN In!ammation
(a) (b)
(c) (d)
! (h)
F23456 ": Immunoreaction patterns for cells in in!ammatory
in+ltrates are shown. Sections are from gastrocnemius muscle
specimens, $- week group ((a), (b), and (e)–(h)), /-week group (c),
exercised sides, and soleus muscle specimen of the /-week group,
nonexercised side (d). In (a)–(d), the presence of cellular NK-$R
immunoreactions is seen (arrows). *e reactions show frequently a
granular appearance. Double staining for SP (e) and NK-$R (f) show
that there is partly colocalization (arrows), partly not
colocalization (arrowheads). Ordinary staining for NK-$R shows the
presence of marked immunoreactions in cells (g) (arrows) (low
magni+cation), whereas there are no speci+c immunoreactions in a
parallel section processed for NK-$R a0er preabsorption with NK-$R
antigen (h). *e immunoreactive cells seen in (g) are scattered in
the connective tissue and coalesced into a muscle +bre (asterisk
(g), c.f. (h)). Arrows in (h) point at nonimmunoreactive cells.
Bars = ")#m.
immunoreactions were especially seen in the /-week groups (Figures
)(c)–)(e)) but could also be seen in myositis areas of the $- and
%-week groups. Such immunoreactions for nerve fascicles were never
seen in areas of muscles from experimental animals showing
normalmorphology andwere never seen in the specimens of the control
nonexperimental animals (c.f. above). Double stainings revealed
that theseNK- $R immunoreactions frequently, but not always, were
associ- ated with comparatively marked S$##beta immunoreactions
(Figure /).
*e nuclei of the nerve fascicles in which the NK-$R immunoreactions
described above were noted and which thus were located in myositis
areas showed, when DAPI was used in embedding medium and when
S$##beta immuno- labelling was performed, another colour reaction
than the nuclei located outside the nerve fascicles (Figures /(c)
and /(f)). *e former nuclei showed a pink colour reaction, whilst
the latter exhibited a bluish reaction; that is, a colour that is
characteristic of the DAPI reaction. *e nuclei of nerve fascicles
located in normally appearing
muscle tissue mainly showed the characteristic bluish DAPI
reaction.
Via parallel double stainings for betaIII-tubulin/NK- $R and
S$##beta/NK-$R and via comparisons with parallel stainings made for
white blood cells further information on nerve-related NK-$R
reactions was obtained. Strong NK- $R immunoreactions that were not
present in large nerve fascicles and that were not in!ammatory cell
related were thus seen in myositis areas of both sides and in close
prox- imities to these areas (Figures '(a)–'(c)). *ese strong NK-
$R immunoreactions were betaIII-tubulin immunoreactive (Figures
((a) and ((b)). It was hereby veri+ed that these corresponded to
axonal pro+les. *e NK-$R immunoreac- tions were associated with
strong S$##beta immunoreactions (Figures '(f) and '(g)). Parts of
the NK-$R immunoreactive axonal pro+les were SP immunoreactive
(Figures '(d) and '(e)). *ese axonal NK-$R immunoreactions (Figures
((c) and ((d)), as well as the point-like NK-$R immunoreactions
seen in large nerve fascicles (Figures )(e) and )(f)), were
abrogated by preabsorption with NK-$R antigen.
ISRN In!ammation '
(a) (b)
M
M
(c)
F23456 %: Results of double stainings for cells of in!ammatory
in+ltrates. Sections are from gastrocnemius muscle specimen of the
$-week group, exercised side. Double staining for NK-$R (a) and
CD/( (b). *ere is colocalization in cells (arrows). Double staining
for NK-$R (green) and eosinophil marker (MAB$#(') (reddish) is
shown in a single montage (DAPI inmountingmedium) in (c).*ere is
colocalization in eosinophils (arrows). M = muscle +bers. Bar = ")
#m.
M
(a)
M
(b)
(c) (d) (e)
F23456 -: Sections of soleusmuscle specimens from the /-week group,
nonexercised side (a, b) and the $-week group, exercised side (c),
and of gastrocnemius muscle specimen from the $ week group,
exercised side (d, e). Abnormal muscle +bers, that is, muscle +bers
being completely in+ltrated by white blood cells, are shown. Such a
+ber is seen in themiddle in (a) (H&E staining).*ere are
cellular NK-$R immunoreactions in this +ber (b) (arrows).*ere are
also cellular NK-$R immunoreactions in (c) and (d) (arrows indicate
immunoreactive cells). (d) and (e) represent double staining for
NK-$R (d) and SP (e).*ere is colocalization (arrows). M = ordinary
muscle +bers. Bars = ") #m.
( ISRN In!ammation
(a) (b)
(c) (d)!
! (f)
F23456 ): NK-$R immunoreaction patterns in nerve fascicles.
Sections of soleus muscle specimens from the control group (a), the
$-week group, exercised side (b) and the /-week group, nonexercised
side (c) and of gastrocnemius muscle specimens from the /-week
group, exercised side (d) and nonexercised side (e, f).*e nerve
fascicle shown in (b) was located in a region showing normal muscle
morphology whilst those shown in (c)–(e) were localized tomyositis
areas. Note that there are noNK-$R immunoreactions in the nerve
fascicle in (a).*is fascicle is seemingly entirely composed of
myelinated nerve +bers. *ere are also no immunoreactions in the
nerve fascicles in (b) (above and below). Just outside these, there
are +ne varicose immunoreactive nerve +bers (arrows). On the other
hand, there are marked NK-$R immunoreactions in the nerve fascicles
shown in (c)–(e) (arrows). *ese show a punctuate appearance, with
the reactions to some extent, however, being spread out in broad
areas. In (f), a section parallel to the section shown in (e) is
seen, and for which the NK-$R antibody had been preabsorbed with
NK-$R peptide.*ere are no NK-$R immunoreactions in the nerve
fascicle in (f). Asterisks mark corresponding regions in (e) and
(f). Bars = ") #m.
ISRN In!ammation &
(a) (b) (c)
(d) (e) (f)
F23456 /: Double staining for NK-$R (a, d) and S$## ($-subunit) (b,
e). Merged images including DAPI reactions are shown in (c, f).
Large nerve fascicles are seen. Sections are from gastrocnemius
muscle specimen of the /-week group, nonexercised side. *ere is
NK-$R immunoreaction and to some extent an extra marked S-$##beta
immunoreaction in some regions (arrows) (a)–(f). For some regions
there is NK-$R immunoreaction but not this type of marked S-$##beta
immunoreaction (arrowheads). Note that the nuclei within the nerve
fascicles show a pink colour reaction whilst those located outside
these show the characteristic blue DAPI reaction in (c, f).*is
means that the nuclei located inside the nerve fascicle exhibit the
blue DAPI reaction merged with the colour reaction from the
S-$##beta staining. Bar = ")#m.
'.&.(. Reactions in Blood Vessel Walls and Fibroblasts. NK- $R
immunoreactions were noted for the endothelial layer of some of the
blood vessels in myositis areas and areas located in the close
proximities of these areas (Figure &).*ey were observable for
small and intermediate-sized vessels. Blood vessel-related NK-$R
immunoreactions were never seen for the walls of blood vessel walls
of controls and those in normally appearing muscle tissue of
experimental animals and were in principle not seen for the walls
of large arteries of either of the groups. *e reactions were
abrogated via NK-$R preabsorption (Figures &(c) and &(d)).
NK-$R immunoreactions were also seen for +broblast-like cells
located in connective tissue spaces (Figure &(e)).
'.&.). NK-!R in Muscle Fibers in Relation to Desmin Immu-
noreaction. In order to further clarify the NK-$R reactions in
muscle +bers, double staining for desmin and NK-$R was performed.
In muscle +bers that were heavily in+ltrated by white blood cells
(c.f. above) and for which NK-$R was
frequently detected in these cells, therewas amarkeddecrease or a
lack of desmin immunoreactivity. *e lack of desmin immunoreaction
could be seen in parts of the muscle +ber (Figure $#) or in the
entire muscle +ber. Muscle +bers with an increased desmin
immunoreactionwere also seen (Figure $$). *ese muscle +bers
contained more internal nuclei than normally seen (Figure $$). In
these +bers, there was also NK- $R immunoreaction, with the
immunoreaction in this case being scattered in the form of
punctuate reactions (Figure $$).
Both types of muscle +bers described above showingNK- $R
immunoreactions and an aberrant desmin immunoreac- tion were
observed in myositis areas or in areas that were closely adjacent
to these areas. *ey were very occasionally seen in other areas
ofmuscle samples of experimental animals and were never seen in
muscle samples of control animals. Other muscle +bers in the
myositis areas and in normally appearing muscle tissue of
experimental animals and all muscle +bers in the specimens of
control animals showed the characteristic desmin immunoreaction
pattern, that is, a
$# ISRN In!ammation
(a) (b)
M
(f)
M
(g)
F23456 ': Sections stained for the demonstration of NK-$R (a)–(c).
In (d, e), double-staining for SP (d) and NK-$R (e) is shown. In
(f, g), double staining for NK-$R (f) and S$##beta (g) is shown.
Specimens are from gastrocnemius muscle, exercised side, $-week
group (a, d, e), gastrocnemius muscle, nonexercised side, /-week
group (b, f, g), and soleus muscle, exercised side, /-week group
(c). In (a), strong NK-$R immunoreactions are seen in nerve +bers
(arrows) and weaker immunoreactions in in!ammatory cells
(arrowheads). In (b, c), immunoreactive nerve pro+le reactions are
seen (arrows). In (d, e) it is obvious that there is only partial
colocalisation between SP- and NK- $R immunoreactions in the nerve
+bers (arrows). In (f), coalesced NK-$R immunoreactive pro+les are
seen.*ese are related to a markedly S$##beta-immunoreactive cell
(arrowhead at nucleus). Note that this nucleus exhibits a pink
colour reaction; other nuclei in (g) show the characteristic bluish
DAPI reaction. M= muscle +ber (f, g). Bars = ") #m.
striated reaction pattern in longitudinally cut muscle +bers
(Figure $$). *ese muscle +bers were NK-$R nonimmunore- active
(Figure $$).
'.&.*. Comparisons Exercised versus Nonexercised Musdes Overall
Comments. *e pattern andmagnitude of the NK-$R immunoreactions for
all the various structures were similar for exercised and
nonexercised sides. *e marked NK-$R immunoreactions seen for white
blood cells, nerve fascicles, blood vessel walls, and muscle +bers
described above were restricted to myositis areas and areas that
were very close to these areas. *at was the case for both the
soleus and gastrocnemius muscles. *us, the magnitude of the NK-$R
immunoreactions was related to the degree of in!ammatory in+ltrates
(myositis) within the specimens, which to some extent varied
between the di,erent samples in the experimen- tal groups
[$-].
'.'. In Situ Hybridization. *e in situ hybridization studies showed
that NK-$R mRNA reactions were observable in the same cell
structures as were found to be NK-$R immunore- active. *at included
+broblast-like cells (Figure $"), cells of blood vessel walls in
myositis areas and/or closely adjacent areas (Figures $% and $-),
white blood cells in in!ammatory in+ltrates (Figure $)), and muscle
+bers showing abnormal morphology, being heavily in+ltrated by
cells (Figure $/) or containing frequent internal nuclei. *e NK-$R
mRNA reactions in blood vessel walls were not only localized to the
endothelial layer but could also be seen for the smoothmuscle part
of the walls (Figure $%).*e speci+city of reactions seen for all
the various structures was veri+ed via stainings with sense control
probe (Figures $"(b), $%(b), $-(b), and $/(c)).
'.(. EIA Results. Analysis of SP concentration was made for muscles
of control animals and animals for which the most pronounced
myositis was observed, that is, the /-week
ISRN In!ammation $$
(a) (b)
(c)
(d)
F23456 (: Sections from gastrocnemius muscle of $-week exercised
group. Double staining for NK-$R and $-Tubulin is shown in (a,
b).$-Tubulin immunoreactions ((a), red, arrows) show colocalization
with NK-$R immunoreactions ((b), green, arrows). In (b), the DAPI
reaction is also seen. Results of preabsorption stainings are shown
in (c, d), ordinary staining for NK-$R in (c), and preabsorption
staining in (d). *e region in (c) corresponds to that in (d). *ere
are axonal NK-$R immunoreactions in (c) (arrows). *ere are no NK-$R
immunoreactions in the preabsorption control (d). Bars = ")
#m.
groups. It was found that the concentrationwas clearly higher in
the /-week groups for both muscles and for both sides. *e mean
values were thus $.(% times higher for exercised side and $.''
times higher for nonexercised side, as compared to control muscle,
concerning the soleus muscle (% = 0.004 in both cases), and %.-)
times (exercised side) and %.#$ times (nonexercised side) higher
than themean value in the control
group concerning the gastrocnemius muscle (% < 0.05 in both
cases).
4. Discussion
(.!. Summary of Findings. Via evaluations of the NK-$R reaction
pattern, the present study indicates that tachykinins are highly
involved functionally in the myositis and muscle a,ection process
in our rabbit model of muscle overuse. An upregulation of the
expression of NK-$R was observed in both the exercised as well as
the nonexercised sides. NK- $R immunoreactions and NK-$R mRNA
reactions were seen for cells of the in!ammatory in+ltrates and for
blood vessel walls within the in!amed and a,ected areas. Such
reactions were also seen for +broblasts. Strong NK-$R immunoreac-
tions in axonal pro+les and +ne NK-$R immunoreactions in
large-sized nerve fascicles were furthermore frequently detected in
the areas in!uenced by the myositis process. Additionally,
morphologically abnormal muscle +bers in these areas displayed
NK-$R immunoreactions and NK-$R mRNA reactions.*e NK-$R reactions
were thus in principle restricted to the myositis areas and the
areas located very close to these areas.
When interpreting the signi+cance of the NK-$R immu- noexpressions,
one should be aware of the fact that not only SP but also
endokinins and hemokinins show a remark- able potency for NK-$
receptors [%$]. Nevertheless, in the tachykinin stainings performed
in the present study antibod- ies against SP (monoclonal
antibodies) were used.
(.&. Crossover E,ects of the Tachykinin System. An interesting
aspect in the current study is that the tachykinin system becomes
involved in a process that occurs bilaterally in response to a
unilateral experiment. *ere was thus an upregulation of NK-$R
expression bilaterally, as well as an increase in SP levels
bilaterally as seen via EIA analyses. *is suggests that the system
has crossover e,ects. Similar crossover e,ects were reported in a
recent study where retinal laser burn-induced neuropathy lead to an
increase in SP- inducible NK-$R +rst in the retina of the burned
eye and then in the contralateral eye [%"]. *e authors of this
study, who had previously noted that unilateral retinal laser burn
leads to in!ammation not only in this eye but also in the nonburned
eye [%%], suggested that SP had transmitted early in!ammatory
signals from the a,ected eye to the contralat- eral eye. In the
same context, Chang and collaborators [%-] demonstrated that
unilateral burn injury in a limb can have a long-lasting allodynia
that spreads to the contralateral limb. It was concluded that
central neuropathic mechanisms, via the occurrence of the
hyperexcitability of second-order neurons and microglial
activation, were responsible for the cross- transfer e,ect
[%-].
It has previously been shown that unilateral experiments and
unilateral in!ammation in limbs can lead to contralateral e,ects
and in which cases neurological mechanisms are considered to be
very important [%)–%(]. Occurrence of contralateral responses
following unilateral stimuli in the form of intradermal injections
of capsaicin has also been
$" ISRN In!ammation
!
!
F23456 &: (a)–(d) NK-$R immunoreactions in the walls of blood
vessels located in myositis areas or close to these areas are shown
(preabsorption control in (d)). Sections are from gastrocnemius
muscles from the exercised side, the /-week (a) and $-week (b)
groups, and from the nonexercised side, %-week group (c, d). Note
that there are NK-$R immunoreactions in the blood vessel walls in
both exercised and nonexercised sides (arrows, (a)–(c)).*e
reactions are observed in the endothelial layer of the vessels.*ere
is no reaction in the preabsorption control (d).*e vessel shown in
(d) conforms to that in (c) but was sectioned in another level of
the sectioning, why the vessel morphology is di,erent. Asterisks in
the lumen of the blood vessel (c, d). Bars = ") #m. (e)
Immunostaining for NK-$R. Soleus muscle specimen of the /-week
group, nonexercised side.*ere are immunoreactions in +broblast-like
cells (arrows). Bar = ") #m.
shown for humans [%&] and contralateral increases in sensory
neural activity are suggested to be of importance for the sym-
metry concerning the in!ammation in rheumatoid arthritis [-#]. It
is furthermore known that electrical stimulation can lead to
orthodromic activation of a,erent nerve +bers which can initiate
the release of SP and changes in both the stimulated and the
nonstimulated contralateral muscles [-$]. Bilateral e,ects
concerning SP have previously been seen a0er experiments using heat
injury [-"] and unilateral formaldehyde injections [-%] and in
response to craniofacial in!ammation [--] as well. It should here
be stressed that the NK-$R expressions seen in our model of
myositis/muscle injury were not only related to nerve structures
but also in!ammatory cells, blood vessel walls, and morphologically
abnormal muscle +bers. It is also noteworthy that SP in
experimental studies has been found to have a systemically acting
wound messenger e,ect in the early wound healing
processes a0er an injury to the conjunctiva [-)]. In future studies
using the currently used model, the bases for the contralateral
e,ects should be further evaluated. It should be recalled that
a,ections occurred bilaterally for the tendons in studies focusing
on the Achilles tendons using the unilateral setup utilized in the
present study ["#].
(.'. Presence of NK-!R in Axonal Pro+les and Large Nerve Fas-
cicles. It is well known that there is a widespread expression of
NK-$R in the central nervous system. It is also shown that
unmyelinated axons in nerve bundles in peripheral locations can
display NK-$R [-/], and that NK-$Rs are found on sensory nerves in
various locations [-', -(]. However, nerve- related NK-$R
immunoreactions were very infrequently seen in the controls and
areas showingnormalmusclemorphology in experimental animals in this
study. *e only pro+les that were encountered occurred as varicose
pro+les.
ISRN In!ammation $%
! # (d)
#! (e)
! # (f)
F23456 $#: Parts of sections from a soleus muscle specimen,
exercised side, /-week group. In (a)–(c) a normally appearing
muscle area is shown, in (d)–(f) a part of a myositis area. *e
muscle +bers in (a)–(c) are in principle transversely cut, whereas
those in (d)–(f) are longitudinally cut. Double staining for desmin
and NK-$R. Desmin staining is shown in (a, d), desmin staining
coupled to DAPI in (b, e), and NK-$R staining in (c, f). In (a, b),
the normal striated desmin immunoreaction pattern is seen. *ere are
no NK-$R immunoreactions in (c). In (e), it is seen that there is a
massive in+ltration of cells in a part of the muscle +ber (1), and
to a certain extent an in+ltration in another part (asterisk).*e
desmin immunoreaction is weak in the middle of the latter part and
non-existent in the former.*ere are NK-$R immunoreactions in
in+ltrating cells (arrows, (f)). Bar = ")#m.
M1
M2 !
(a)
M1
M2 !
(b)
F23456 $$: Section from a soleus muscle specimen, nonexercised
side, /-week group. Double staining for desmin coupled to DAPI (a)
and NK-$R (b) is shown. *e area is shown in higher magni+cation in
(b) than in (a). *ere is a very marked desmin immunoreaction in the
muscle +ber in the middle (asterisk), and the normal desmin
striations cannot be seen in the +ber. *ese striations can be seen
in adjacent muscle +bers. *ere are point-like NK-$R immunoreactions
in this muscle +ber (arrows, (b)) but no NK-$R in adjacent +bers.
M$, M" = muscle +bers.*ere are internal nuclei in the muscle +ber
in the markedly desmin immunoreactive muscle +ber (arrows, (a)).
Bar = ") #m.
On the other hand, nerve-related NK-$R immunoreac- tions were
frequently detected in myositis areas and areas that were very
close to these areas. NK-$R immunoreactions were thus seen in the
form of +ne distinct point-like reactions that were coalesced in
large nerve fascicles and in the form of strong immunoreactive
axonal pro+les.*e double stainings we performed showed that
theseNK-$R immunoactionswere o0en associated with markedly S$##beta
immunoreactive
Schwann cells. *is observation suggests that these NK- $R
expressing pro+les are enclosed by Schwann cells. In accordance
with this interpretation, previous studies made at the
ultrastructural levels in the rat dental mucosa have shown that
NK-$Rs are present in vesicular structures and the axoplasm of
axons that are enclosed by Schwann cells [-&]. Our double
stainings also showed that the large nerve fascicles/axonal pro+les
harbouring these NK-$R reactions
$- ISRN In!ammation
(a) (b)
(c)
F23456 $": Reactions in +broblast-like cells. Sections of a
gastrocnemius muscle specimen of the $-week group, exercised side
(a, b), and a soleus muscle specimen of the /-week group, exercised
side (c), are shown. In situ hybridization (antisense staining in
(a), (c); sense staining in (b); (b) is from a parallel section to
(a)).*ere is an expression of NK-$R (TACR$) mRNA in the cells in
(a).*ere are no reactions in the sense control (b). Arrows point at
+broblast-like cells.*ere are also NK-$RmRNA reactions in the
+broblast-like cells in (c) (arrows). Bar = ") #m.
(a) (b)
F23456 $%: Expression of NK-$R (TACR$) mRNA in blood vessel walls.
Serial sections from soleus muscle specimen of the / week group,
non-exercised side, showing small arteriole (le0 part, (a), (b))
and vein (right part, (a), (b)). Processing for NK-$R mRNA using
anti-sense probe (a) and processing with corresponding sense probe
(b). Expression of NK-$R mRNA is seen in the walls of the blood
vessels in (a). *ere are no reactions in the sense control (b).
Arrows indicate parts of the walls. Bar = ") #m.
were related to nuclei that showed another type of !uo- rescence
reactions than nuclei located outside the nerve fascicles and than
those usually seen for nerve fascicles of normal muscle regions. *e
former !uorescence reactions are related to a combination of the
DAPI reaction and S-$##beta immunoreaction. It, therefore, seems
likely that these nerve fascicles/axons are in a phase of
regeneration. It is thus known that the S-$##beta protein in
principle is detected in the cytoplasm and themembranes of the
Schwann cells, and not the nuclei, as seen in immunohistochemical
stainings, in normal situations [)#]. Furthermore, it is known that
Schwann cells can be activated when there is a nerve damage and
that the S-$##beta protein can be involved in axonal regeneration
[)$, )"] and that Schwann cells ensheath regenerating axons
[)%].
(.(. Presence of NK-!R in White Blood Cells. *e NK-$R, as well as
tachykinins like SP, has been detected in several types
of white blood cells [)-]. In the present study, NK-$R was detected
in macrophages and eosinophils. NK-$R was o0en colocalized with SP
in the cells. *e SP/NK-$R system may thus have an important role
for the accumulation of these cells in the muscle tissue in the
myositis process. Concerning macrophages, these +ndings are in
accordance with a report saying that NK-$Rs are involved in the
accumulation of macrophages in the airways in the development of
smoking- induced emphysema and in response to cigarette smoking
exposure [))].
*e NK-$R reactions in the cells in the in!ammatory in+ltrates
showed frequently an intracellular location.*is is likely to be due
to theNK-$Rs being internalized a0er binding to released SP or that
it represents newly synthesized recep- tors. It is well known that
the NK-$R in neurons undergoes rapid internalization a0er binding
to SPhas occurred and that the receptor therea0er recycles to the
plasmamembrane [)/]. *e intracellular location of NK-$Rs has been
reported to be
ISRN In!ammation $)
! (a)
! (b)
F23456 $-: Expression of NK-$R (TACR$) mRNA in the wall of a large
vein is shown (soleus muscle specimen of /w group, nonex- ercised
side). Processing for NK-$R mRNA using anti-sense probe (a) and
processing with corresponding sense probe (b). Expression of NK-$R
mRNA is seen in the vein wall (a).*ere are no reactions in the
sense control (b). Arrows indicate parts of the wall. Asterisks
indicate similar parts of the vessel wall. Bar = ")#m.
F23456 $): Expression of NK-$R (TACR$) mRNA in in!ammatory
in+ltrate. Staining for the demonstration of NK-$R mRNA (anti-
sense probe) in a section of a gastrocnemius muscle specimen,
exercised side, $-week group, is shown. Cells in an in!ammatory
in+ltrate are showing NK-$R mRNA reactions (arrows). Bar = ")
#m.
transport vesicles and endosomes [)']. Also in nonneuronal cells,
there is a process of endocytosis and recycling of the NK-$R [)(].
It might be that the cells in the in!ammatory in+ltrates are under
the continuous in!uence of SP in an autocrine/paracrine fashion and
that there is a continuous NK-$R internalization but also a
continuous synthesis. SP and the NK-$R are actually reported to be
internalized in the same vesicles and then sorted into independent
endosomes, leading to the eventual degradation of SP and recycling
of the NK-$R [)&].
(.). Presence of NK-!R in Blood Vessel Walls. NK-$R immu-
noreactions and NK-$R mRNA reactions were seen in the endothelium
of blood vessels in myositis areas. It is well known that SP
induces an increased vascular permeability, vasodilatation, and
hyperthermia via binding to NK-$Rs on the endothelial cells of the
blood vessel walls [/#]. *e vasodilator e,ect by SP is thus
considered to be dependent upon the endothelium and to be mediated
by the NK-$R. We also sometimes noted reactions for NK-$RmRNA for
the smooth muscle layer. In accordance with this +nding, it has
been found that smooth muscle cells of airways in rats show mRNA
transcripts for the NK-$R [/$].
! (a)
! (b)
! (c)
F23456 $/: Expression of NK-$R (TACR$) mRNA. Serial sections of a
soleus muscle specimen of the /-week group, nonexercised side,
showing an abnormal muscle +ber (asterisks). In (a), the +ber is
shown to be markedly in+ltrated by in!ammatory cells (staining with
H&E). *ere is NK-$R mRNA expression in this +ber (b) (arrows).
No reactions are visible in the sense control (c). Bar = ")
#m.
(.*. NK-!R in Degenerating/Regenerating Muscle Fibers. NK- $R was
not only detected in white blood cells that were dispersed in the
tissue but also in white blood cells that heavily had in+ltrated
muscle +bers. Based on the complete or relative loss of desmin
immunoreactivity in these mus- cle +bers, they can be considered to
represent degenerat- ing/necrotic muscle +bers. It is thus known
that desmin is undetectable or much decreased in necrotic muscle
+bers [/"]. On the other hand, we noted that other muscle +bers in
myositis areas and adjacent areas showed a very marked desmin
immunoreaction. *ese +bers are interpreted to be in a regenerative
stage.*is is in accordance with the known fact that there is an
overexpression of desmin during muscle regeneration processes [/%].
Also these +bers exhibited NK- $R immunoreaction, the reactions in
this case showing a punctuate pattern. *is indicates that both
degenerative and
$/ ISRN In!ammation
regenerative events occur in the myositis process and that the
NK-$R is involved in both types of processes.
(.%. Functional Aspects: General Considerations. As discussed
above, there were marked NK-$R reactions in myositis areas and
areas adjacent to these areas, whilst there were almost no NK-$R
reactions at all in areas with normal morphology. *e reactions were
seen for nerve structures, white blood cells, blood vessel walls,
and abnormal muscle +bers. *e observations of a very marked NK-$R
expression in myositis specimens, in parallel with an increased
content of SP in these specimens (as seen for specimens of the
/-week groups), are comparable to +ndings made in other situations
for tissues exhibiting in!ammation and tissue
damage/reorganization. *at includes colonic +brosis [/-],
immunode+ciency virus lesions [/)], airway in!ammation [//], and
sarcoidosis [/']. It has since long been considered that the
occurrence of interactions between tachykinins and in!ammatory
cells is of great importance in pathological conditions and that
the NK-$R has important roles in these conditions [/(].*ere is a
reason to believe that tachykinin e,ects hereby are related to
interactive e,ects with other signal substances.
*e fact that SP and NK-$R sometimes were found to be colocalized
suggests that autocrine/paracrine SP e,ects may occur in the
tissue. *is can be related to an auto- regulatory mechanism for SP
in relation to the NK-$Rs. Autoreceptor functions for SP a,ecting
NK-$Rs have since long been suggested to occur in other situations
[-/]. It has also previously been suggested that NK-$Rs found on
sensory neurons are autoreceptors, being related to the mod-
ulation of peripheral pathophysiological e,ector functions [-'].
Autocrine/paracrine e,ects by SP has on the whole been considered
to take place in several conditions, including in leukemia [/&]
and various in!ammatory situations ['#].
One can ask wheter the marked NK-$R expression in the myositis
areas is not only related to proin!ammatory e,ects but also to
healing e,ects. It should here be recalled that there occurs an
overexpression of the NK-$R not only in response to in!ammation and
tissue damage, but also in situationswith tissue repair
andwoundhealing.*at includes the situation during gastric wound
healing in rodents ['$]. An in!ammatory component is actually
described to be involved in healing e,ects for the skin. Topical
treatment of SP to skin wounds in genetically diabetic mice thus
leads to an increase in in!ammatory density as a part of the
healing process ['"]. SP is considered to be involved not only in
cutaneous healing, but also in corneal wound healing [%] and to be
involved in processes of tendon repair ['%–')]. Concerning
tendinopathy, SP can accelerate the processes of hypercellularity
and angiogenesis in tendon tissue in this condition ['/]. It is
furthermore considered that SP can have protective roles. It is,
for example, reported that NK-$R- mediated functions have
protective roles in acute hyperoxic lung injury [''].
5. Conclusions
*e present study shows that the tachykinin system is markedly
involved in the processes of muscle injury/myositis
that occur in the overuse model here used. To what extent the
e,ects of tachykinin are related to proin!ammatory or
tissue-healing e,ects remains to be answered. Our +ndings suggest
that the NK-$R is involved in both degenerative and regenerative
events. *ere is a reason to believe that tachykinins show
interference e,ects with other signal sub- stances in the processes
that occur. *e tachykinin system is upregulated on both sides, that
is, in the myositis process that occurs in the experimental side as
well as the one that occurs contralaterally. *e upregulation is for
both sides not only restricted to nerve structures but also to
cells of the in!ammatory in+ltrates, the blood vessels, and
morphologically changed muscle +bers.
It has not previously been demonstrated that tachykinins have the
marked e,ects that are shown here for muscle tissue. *e currently
used model can be utilized in fur- ther studies evaluating the
features of interactions between tachykinins and other signal
substances in myositis and degenerative/regenerative muscle
processes and to evaluate if interference with tachykinin e,ects
can be of value for these processes. *e possible e,ectiveness of
NK-$R blocking has been evaluated for various in!ammatory
conditions ['(, '&]. *e results have been unclear. It remains
for the future to evaluate if interference with e,ects at the NK-$R
can have positive e,ects in situations with myositis and muscle
injury.
Acknowledgments
*e authors are grateful to Ms. Ulla Hedlund for excellent technical
assistance at the laboratory, to Mr. Adrian Lam- ouroux and Ms.
Fellon Robson-Long for excellent technical service concerning the
animal model, and to Professor R. Lorentzon and Dr. Clas Backman
for cooperation on the animal experiments. Professor L-E *ornell is
acknowl- edged for comments concerning the aspects of degenera-
tion/regeneration. Financial support was received from the Faculty
of Medicine, Umea University, the Swedish National Centre for
Research in Sports (CIF) and the J. C. Kempe and Seth M. Kempe
Memorial Foundations. China Scholarship Council provided a stipend
to YS. *e funders had no role in the study design, data collection
and analysis, decision to publish, or preparation of the
manuscript.
References
[$] T. Patel, S. H. Park, L. M. Lin, F. Chiappelli, and G. T. J.
Huang, “Substance P induces interleukin-( secretion from human
dental pulp cells,” Oral Surgery, Oral Medicine, Oral Pathology,
Oral Radiology, and Endodontics, vol. &/, no. -, pp. -'(–-(),
"##%.
["] P. Geppetti, R. Nassini, S. Materazzi, and S. Benemei, “*e
concept of neurogenic in!ammation,” BJU International, Sup-
plement, vol. $#$, no. %, pp. "–/, "##(.
[%] T. Nishida, “Neurotrophic mediators and corneal wound heal-
ing,” Ocular Surface, vol. %, no. -, pp. $&-–"#", "##).
[-] H. Kohara, S. Tajima, M. Yamamoto, and Y. Tabata, “Angiogen-
esis induced by controlled release of neuropeptide substance P,”
Biomaterials, vol. %$, no. %%, pp. (/$'–(/"), "#$#.
ISRN In!ammation $'
[)] M. Munoz, A. Pavon, M. Rosso et al., “Immunolocalization of
NK-$ receptor and substance P in human normal placenta,” Placenta,
vol. %$, no. ', pp. /-&–/)$, "#$#.
[/] A. D. Hershey and J. E. Krause, “Molecular characterization of
a functional cDNA encoding the rat substance P receptor,” Science,
vol. "-', no. -&-), pp. &)(–&/", $&&#.
['] H.Ohkubo and S.Nakanishi, “Molecular characterization of the
three tachykinin receptors,” Annals of the New York Academy of
Sciences, vol. /%", pp. )%–/", $&&$.
[(] T. Cao, E. Pinter, S. Al-Rashed, N. Gerard, J. R. Hoult, and S.
D. Brain, “Neurokinin-$ receptor agonists are involved in mediating
neutrophil accumulation in the in!amed, but not normal, cutaneous
microvasculature: an in vivo study using neurokinin-$ receptor
knockout mice,” Journal of Immunology, vol. $/-, no. $#, pp.
)-"-–)-"&, "###.
[&] M. Jonsson, O. Norrgard, and S. Forsgren, “Presence of a
marked nonneuronal cholinergic system in human colon: study of
normal colon and colon in ulcerative colitis,” In-ammatory Bowel
Diseases, vol. $%, no. $$, pp. $%-'–$%)/, "##'.
[$#] M. Bhatia, A. K. Saluja, B. Ho7auer et al., “Role of substance
P and the neurokinin $ receptor in acute pancreatitis and
pancreatitis-associated lung injury,” Proceedings of the National
Academy of Sciences of the United States of America, vol. &),
no. (, pp. -'/#–-'/), $&&(.
[$$] H. Y. Lau, F. L. Wong, and M. Bhatia, “A key role of
neurokinin $ receptors in acute pancreatitis and associated lung
injury,” Biochemical and Biophysical Research Communications, vol.
%"', no. ", pp. )#&–)$), "##).
[$"] D. Renzi, B. Pellegrini, F. Tonelli, C. Surrenti, and A.
Calabro, “Substance P (neurokinin-$) and neurokinin A (neurokinin-
") receptor gene and protein expression in the healthy and in!amed
human intestine,” American Journal of Pathology, vol. $)', no. ),
pp. $)$$–$)"", "###.
[$%] C. Remrod, S. Lonne-Rahm, and K. Nordlind, “Study of substance
P and its receptor neurokinin-$ in psoriasis and their relation to
chronic stress and pruritus,” Archives of Dermatolog- ical
Research, vol. "&&, no. ", pp. ()–&$, "##'.
[$-] Y. Song, S. Forsgren, J. Yu, R. Lorentzon, and P. S. Stal,
“E,ects on contralateral muscles a0er unilateral electrical muscle
stim- ulation and exercise,” Plos ONE, vol. ', no. $", Article ID
e)""%#, "#$".
[$)] S. Forsgren, L. Renstrom, C. Purdam, and J. E. Gaida, “TNF-
alpha in the locomotor system beyond joints: high degree of
involvement inmyositis in a rabbitmodel,” International Journal of
Rheumatology, vol. "#$", Article ID /%'-)", "#$".
[$/] C. Spang, A. Scott, P. Danielson, R. Lorentzon, and S.
Forsgren, “VGluT" and NMDAR$ expression in cells in the in!ammatory
in+ltrates in experimentally induced myositis: evidence of local
glutamate signaling suggests autocrine/paracrine e,ects in an
overuse injury model,” In-ammation, vol. %), no. $, pp. %&–-(,
"#$".
[$'] U. Hoheisel, A. Kaske, and S. Mense, “Relationship between
neuronal activity and substance P-immunoreactivity in the rat
spinal cord during acute and persistent myositis,” Neuroscience
Letters, vol. ")', no. $, pp. "$–"-, $&&(.
[$(] A. Reinert, A. Kaske, and S. Mense, “In!ammation-induced
increase in the density of neuropeptide-immunoreactive nerve ending
in rat skeletal muscle,” Experimental Brain Research, vol. $"$, no.
", pp. $'-–$(#, $&&(.
[$&] R. Ambalavanar, D. Dessem, A. Moutanni et al., “Muscle
in!ammation induces a rapid increase in calcitonin gene- related
peptide (CGRP)mRNA that temporally relates to CGRP
immunoreactivity and nociceptive behavior,” Neuroscience, vol. $-%,
no. %, pp. (')–((-, "##/.
["#] G. Andersson, S. Forsgren, A. Scott et al., “Tenocyte
hypercellu- larity and vascular proliferation in a rabbit model of
tendinopa- thy: contralateral e,ects suggest the involvement of
central neuronal mechanisms,” British Journal of Sports Medicine,
vol. -), no. ), pp. %&&–-#/, "#$$.
["$] C. Backman, L. Boquist, J. Friden, R. Lorentzon, and G.
Toolanen, “Chronic achilles paratenonitis with tendinosis: an
experimental model in the rabbit,” Journal of Orthopaedic Research,
vol. (, no. -, pp. )-$–)-', $&&#.
[""] M. Hansson and S. Forsgren, “Immunoreactive atrial and brain
natriuretic peptides are co-localized in Purkinje +bres but not in
the innervation of the bovine heart conduction system,”
Histochemical Journal, vol. "', no. %, pp. """–"%#,
$&&).
["%] A. C. Cuello, M. Del Fiacco, and G. Paxinos, “*e central and
peripheral ends of the substance P-containing sensory neurones in
the rat trigeminal system,” Brain Research, vol. $)", no. %, pp.
-&&–)#&, $&'(.
["-] G.N.VanMuijen,D. J. Ruiter, and S.O.Warnaar, “Coexpression of
intermediate +lament polypeptides in human fetal and adult
tissues,” Laboratory Investigation, vol. )', no. -, pp.
%)&–%/&, $&('.
[")] J. Pettersson,D. Kalbermatten, A.McGrath, and L.N.Novikova,
“Biodegradable +brin conduit promotes long-term regenera- tion a0er
peripheral nerve injury in adult rats,” Journal of Plastic,
Reconstructive and Aesthetic Surgery, vol. /%, no. $$, pp.
$(&%– $(&&, "#$#.
["/] A. M. McGrath, M. Brohlin, P. J. Kingham, L. N. Novikov, M.
Wiberg, and L. N. Novikova, “Fibrin conduit supplemented with human
mesenchymal stem cells and immunosuppressive treatment enhances
regeneration a0er peripheral nerve injury,” Neuroscience Letters,
vol. )$/, no. ", pp. $'$–$'/, "#$".
["'] A. Panoskaltsis-Mortari and R. P. Bucy, “In situ hybridization
with digoxigenin-labeled RNA probes: facts and artifacts,”
BioTechniques, vol. $(, no. ", pp. %##–%#', $&&).
["(] P. Danielson, H. Alfredson, and S. Forsgren, “In situ
hybridiza- tion studies con+rming recent +ndings of the existence
of a local nonneuronal catecholamine production in human patellar
tendinosis,”Microscopy Research and Technique, vol. '#, no. $#, pp.
&#(–&$$, "##'.
["&] A. Scott, H. Alfredson, and S. Forsgren, “VGIuT"
expression in painful achilles and patellar tendinosis: evidence of
local gluta- mate release by tenocytes,” Journal of Orthopaedic
Research, vol. "/, no. ), pp. /()–/&", "##(.
[%#] M. Johansson, M. Josson, O. Norrgard, and S. Forsgren, “New
aspects concerning ulcerative colitis and colonic carci- noma:
analysis of levels of neuropeptides, neurotrophins, and
TNFalpha/TNFreceptor in plasma and mucosa in parallel with
histological evaluation of the intestine,” In-ammatory Bowel
Diseases, vol. $-, no. $#, pp. $%%$–$%-#, "##(.
[%$] Z. Helyes, K. Elekes, K. Sandor et al., “Involvement of pre-
protachykinin A gene-encoded peptides and the neurokinin $ receptor
in endotoxin-induced murine airway in!ammation,” Neuropeptides,
vol. --, no. ), pp. %&&–-#/, "#$#.
[%"] K. Lucas, D. Karamichos, R. Mathew, J. D. Zieske, and J.
Stein-Streilein, “Retinal laser burn-induced neuropathy leads to
substance P-dependent loss of ocular immune privilege,” Journal of
Immunology, vol. $(&, no. %, pp. $"%'–$"-", "#$".
[%%] H. Qiao, K. Lucas, and J. Stein-Streilein, “Retinal laser burn
disrupts immune privilege in the eye,” American Journal of
Pathology, vol. $'-, no. ", pp. -$-–-"", "##&.
$( ISRN In!ammation
[%-] Y. W. Chang, A. Tan, C. Saab, and S. Waxman, “Unilateral focal
burn injury is followed by long-lasting bilateral allodynia and
neuronal hyperexcitability in spinal cord dorsal horn,” Journal of
Pain, vol. $$, no. ", pp. $$&–$%#, "#$#.
[%)] J. D. Levine, S. J. Dardick, A. I. Basbaum, and E. Scipio,
“Re!ex neurogenic in!ammation. I. Contribution of the peripheral
nervous system to spatially remote in!ammatory responses that
follow injury,” Journal of Neuroscience, vol. ), no. ), pp. $%(#–
$%(/, $&().
[%/] B. L. Kidd, S. C. Cruwys, N. E. Garrett, P. I. Mapp, V. A.
Jolli,e, and D. R. Blake, “Neurogenic in!uences on contralat- eral
responses during experimental rat monoarthritis,” Brain Research,
vol. /((, no. $-", pp. '"–'/, $&&).
[%'] M. Koltzenburg, P. D.Wall, and S. B.McMahon, “Does the right
side know what the le0 is doing?” Trends in Neurosciences, vol. "",
no. %, pp. $""–$"', $&&&.
[%(] N. Shenker, R. Haigh, E. Roberts, P. Mapp, N. Harris, and D.
Blake, “A review of contralateral responses to a unilateral in-
!ammatory lesion,”Rheumatology, vol. -", no. $$, pp. $"'&–$"(/,
"##%.
[%&] N. G. Shenker, R. C. Haigh, P. I. Mapp, N. Harris, and D.
R. Blake, “Contralateral hyperalgesia and allodynia following
intradermal capsaicin injection in man,” Rheumatology, vol. -', no.
&, pp. $-$'–$-"$, "##(.
[-#] S. Kelly, J. P. Dunham, and L. F. Donaldson, “Sensory nerves
have altered function contralateral to a monoarthritis and may
contribute to the symmetrical spread of in!ammation,” European
Journal of Neuroscience, vol. "/, no. -, pp. &%)–&-",
"##'.
[-$] O. Hudlicka, L. Graciotti, G. Fulgenzi et al., “*e e,ect of
chronic skeletal muscle stimulation on capillary growth in the rat:
are sensory nerve +bres involved?” Journal of Physiology, vol. )-/,
no. %, pp. ($%–("", "##%.
[-"] T. J. Coderre and R. Melzack, “Increased pain sensitivity fol-
lowing heat injury involves a central mechanism,” Behavioural Brain
Research, vol. $), no. %, pp. ")&–"/", $&().
[-%] A. M. Aloisi, C. A. Porro, M. Cavazzuti, P. Baraldi, and G.
Carli, “’Mirror pain’ in the formalin test: behavioral and "-
deoxyglucose studies,” Pain, vol. )), no. ", pp. "/'–"'%,
$&&%.
[--] R. Ambalavanar, M. Moritani, A. Moutanni, P. Gangula, C.
Yallampalli, and D. Dessem, “Deep tissue in!ammation upreg- ulates
neuropeptides and evokes nociceptive behaviors which are modulated
by a neuropeptide antagonist,” Pain, vol. $"#, no. $-", pp. )%–/(,
"##/.
[-)] H. S. Hong, J. Lee, E. Lee et al., “A new role of substance P
as an injury-induciblemessenger formobilization of CD"&+
stromal- like cells,” Nature Medicine, vol. $), no. -, pp. -")–-%),
"##&.
[-/] S. M. Carlton, S. Zhou, and R. E. Coggeshall, “Localization
and activation of substance P receptors in unmyelinated axons of
rat glabrous skin,” Brain Research, vol. '%-, no. $-", pp. $#%–$#(,
$&&/.
[-'] I. J. Lever, A. D. Grant, S. Pezet, N. P. Gerard, S. D. Brain,
and M. Malcangio, “Basal and activity-induced release of substance
P from primary a,erent +bres in NK$ receptor knockout mice:
evidence for negative feedback,” Neuropharmacology, vol. -), no. (,
pp. $$#$–$$$#, "##%.
[-(] A.M.Harrington, J.M. Hutson, and B. R. Southwell, “Immuno-
histochemical localization of substance P NK$ receptor in guinea
pig distal colon,”Neurogastroenterology andMotility, vol. $', no.
), pp. '"'–'%', "##).
[-&] T. Yamaza,M.A.Kido, B.Wang et al., “Distribution of
substance P and neurokinin-$ receptors in the peri-implant
epithelium
around titanium dental implants in rats,” Cell and Tissue Research,
vol. %%), no. ", pp. -#'–-$), "##&.
[)#] A. Spreca, M. Grazia Rambotti, M. Rende et al., “Immunocy-
tochemical localization of S-$##b protein in degenerating and
regenerating rat sciatic nerves,” Journal of Histochemistry and
Cytochemistry, vol. %', no. -, pp. --$–--/, $&(&.
[)$] J. Hu, S. Zou, Z. Tang, D. Wang, J. Li, and Z. Gao, “Response
of Schwann cells in the inferior alveolar nerve to distraction
osteo- genesis: an ultrastructural and immunohistochemical study,”
International Journal of Oral and Maxillofacial Surgery, vol. %",
no. %, pp. %$(–%"-, "##%.
[)"] T. Duobles, T. D. S. Lima, B. D. F. A. Levy, and G. Chadi,
“S$##$ and +broblast growth factor-" are present in cultured
Schwann cells and may exert paracrine actions on the peripheral
nerve injury,” Acta Cirurgica Brasileira, vol. "%, no. /, pp.
)))–)/#, "##(.
[)%] M.C. Brown andV. J.Hardman, “A reassessment of the accuracy of
reinnervation bymotoneurons following crushing or freezing of the
sciatic or lumbar spinal nerves of rats,” Brain, vol. $$#, no. %,
pp. /&)–'#), $&('.
[)-] A. Sipka, K. Langner, H. M. Seyfert, and H. J. Schuberth,
“Sub- stance P alters the in vitro LPS responsiveness of bovine
mono- cytes and blood-derived macrophages,”Veterinary Immunology
and Immunopathology, vol. $%/, no. %--, pp. "$&–""/,
"#$#.
[))] K. O. De Swert, K. R. Bracke, T. Demoor, G. G. Brusselle, and
G. F. Joos, “Role of the tachykinin NK$ receptor in a murine model
of cigarette smoke-induced pulmonary in!ammation,” Respiratory
Research, vol. $#, article %', "##&.
[)/] P. W. Mantyh, “Neurobiology of substance P and the NK$
receptor,” Journal of Clinical Psychiatry, vol. /%, supplement $$,
pp. /–$#, "##".
[)'] T. Goto, T. Yamaza, M. A. Kido, and T. Tanaka, “Light- and
electron-microscopic study of the distribution of axons containing
substance P and the localization of neurokinin-$ receptor in bone,”
Cell and Tissue Research, vol. "&%, no. $, pp. ('–&%,
$&&(.
[)(] D. Roosterman,G. S. Cottrell, F. Schmidlin,M. Steinho,, andN.
W. Bunnett, “Recycling and resensitization of the neurokinin $
receptor: in!uence of agonist concentration and Rab GTPases,”
Journal of Biological Chemistry, vol. "'&, no. "&, pp.
%#/'#– %#/'&, "##-.
[)&] E. F. Grady, A. M. Garland, P. D. Gamp, M. Lovett, D. G.
Payan, and N. W. Bunnett, “Delineation of the endocytic pathway of
substance P and its seven- transmembrane domain NK$ receptor,”
Molecular Biology of the Cell, vol. /, no. ), pp. )#&– )"-,
$&&).
[/#] S. Harrison and P. Geppetti, “Substance P,” International
Journal of Biochemistry andCell Biology, vol. %%, no. /, pp.
)))–)'/, "##$.
[/$] K. Maghni, M. C. Michoud, M. Alles et al., “Airway smooth
muscle cells express functional neurokinin-$ receptors and the
nerve-derived preprotachykinin-A gene: regulation by passive
sensitization,” American Journal of Respiratory Cell and Molec-
ular Biology, vol. "(, no. $, pp. $#%–$$#, "##%.
[/"] C. Young, M. Y. Lin, P. J. Wang, and Y. Z. Shen, “Immunocy-
tochemical studies on desmin and vimentin in neuromuscular
disorders,” Journal of the Formosan Medical Association, vol.
&%, no. $#, pp. ("&–(%), $&&-.
[/%] A. Gallanti, A. Prelle, M. Moggio et al., “Desmin and vimentin
as markers of regeneration in muscle diseases,” Acta Neu-
ropathologica, vol. (), no. $, pp. ((–&", $&&".
ISRN In!ammation $&
[/-] H.W.Koon,D. Shih, I. Karagiannides et al., “Substance Pmodu-
lates colitis-asscociated +brosis,”American Journal of Pathology,
vol. $'', no. ), pp. "%##–"%#&, "#$#.
[/)] H. Vinet-Oliphant, X. Alvarez, E. Buza et al., “Neurokinin-$
receptor (NK$-R) expression in the brains of SIV-infected rhe- sus
macaques: implications for substance P in NK$-R immune cell
tra.cking into the CNS,” American Journal of Pathology, vol. $'',
no. %, pp. $"(/–$"&', "#$#.
[//] H. Wu, C. Guan, X. Qin et al., “Upregulation of substance P
receptor expression by calcitonin gene-related peptide, a possi-
ble cooperative action of two neuropeptides involved in airway
in!ammation,” Pulmonary Pharmacology and.erapeutics, vol. "#, no.
), pp. )$%–)"-, "##'.
[/'] T. M. O’Connor, J. O’Connell, D. I. O’Brien et al.,
“Upregulation of neurokinin-$ receptor expression in the lungs of
patients with sarcoidosis,” Journal of Clinical Immunology, vol.
"%, no. ), pp. -")–-%), "##%.
[/(] Y. Zhang, A. Berger, C. D. Milne, and C. J. Paige,
“Tachykinins in the immune system,” Current Drug Targets, vol. ',
no. (, pp. $#$$–$#"#, "##/.
[/&] M. Nowicki, B. Miskowiak, and D. Ostalska-Nowicka, “Detec-
tion of substance P and its mRNA in human blast cells in child-
hood lymphoblastic leukaemia using immunocytochemistry and in situ
hybridisation,” Folia Histochemica et Cytobiologica, vol. -$, no.
$, pp. %%–%/, "##%.
['#] J. P. Lai, S. D. Douglas, and W. Z. Ho, “Human lymphocytes
express substance P and its receptor,” Journal of Neuroimmunol-
ogy, vol. (/, no. $, pp. (#–(/, $&&(.
['$] A. Schmassmann, B. Waser, B. Flogerzi, and J. C. Reubi,
“Expression of functional neurokinin-$ receptors in regenera- tive
glands during gastric wound healing in rodents,” Gastroen-
terology, vol. $"/, no. %, pp. '(-–'&), "##-.
['"] J. R. Scott, P. Muangman, and N. S. Gibran, “Making sense of
hypertrophic scar: a role for nerves,” Wound Repair and
Regeneration, vol. $), no. $, pp. S"'–S%$, "##'.
['%] P. Burssens, A. Steyaert, R. Forsyth, E. J. Van Ovost, Y. De
Paepe, and R. Verdenk, “Exogenously administered substance P and
neutral endopeptidase inhibitors stimulate +broblast proliferation,
angiogenesis and collagen organization during Achilles tendon
healing,” Foot and Ankle International, vol. "/, no. $#, pp.
(%"–(%&, "##).
['-] A. E. Steyaert, P. J. Burssens, C. W. Vercruysse, G. G.
Vander- straeten, and R. M. Verbeeck, “*e e,ects of substance P on
the biomechanic properties of ruptured rat Achilles’ tendon,”
Archives of Physical Medicine and Rehabilitation, vol. (', no. ",
pp. ")-–")(, "##/.
[')] O. Carlsson, N. Schizas, J. Li, and P. W. Ackermann,
“Substance P injections enhance tissue proliferation and regulate
sensory nerve ingrowth in rat tendon repair,” Scandinavian Journal
of Medicine and Science in Sports, vol. "$, no. -, pp. )/"–)/&,
"#$$.
['/] G. Andersson, L. J. Backman, A. Scott, R. Lorentzon, S. Fors-
gren, andP.Danielson, “Substance P accelerates hypercellularity and
angiogenesis in tendon tissue and enhances paratendinitis in
response to Achilles tendon overuse in a tendinopathy model,”
British Journal of Sports Medicine, vol. -), no. $%, pp. $#$'–$#"",
"#$$.
[''] M. Dib, Z. Zsengeller, A. Mitsialis et al., “A paradoxical
protec- tive role for the proin!ammatory peptide substance P
receptor (NK$R) in acute hyperoxic lung injury,” American Journal
of Physiology, vol. "&', no. -, pp. L/('–L/&',
"##&.
['(] T. Goode, J. O’Connell, D. O’Brien, T. Goode, C. Bredin, and
F. Shanahan, “*e role of substance P in in!ammatory disease,”
Journal of Cell Physiology, vol. "#$, pp. $/'–$(#, "##-.
['&] M. Gad, A. E. Pedersen, N. N. Kristensen, C. D. F.
Fernandez, and M. H. Claesson, “Blockage of the neurokinin $
receptor and capsaicin-induced ablation of the enteric a,erent
nerves protect SCID mice against T-cell-induced chronic colitis,”
In-ammatory Bowel Diseases, vol. $), no. (, pp. $$'-–$$(",
"##&.
Submit your manuscripts at http://www.hindawi.com
Hindawi Publishing Corporation http://www.hindawi.com Volume
2013
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Hindawi Publishing Corporation http://www.hindawi.com Volume
2013
The Scientific World Journal
9ROXPH
Oncology Journal of
PPAR Re sea rch
Ophthalmology Journal of
ISRN Allergy Hindawi Publishing Corporation http://www.hindawi.com
Volume 2013
BioMed Research International
Obesity Journal of
ISRN Addiction Hindawi Publishing Corporation
http://www.hindawi.com Volume 2013
Hindawi Publishing Corporation http://www.hindawi.com Volume
2013
Computational and Mathematical Methods in Medicine
ISRN AIDS Hindawi Publishing Corporation http://www.hindawi.com
Volume 2013
Clinical & Developmental Immunology
Evidence-Based Complementary and Alternative Medicine
Volume 2013 Hindawi Publishing Corporation
http://www.hindawi.com
Hindawi Publishing Corporation http://www.hindawi.com Volume
2013
Gastroenterology Research and Practice
ISRN Biomarkers
MEDIATORS INFLAMMATION