Lock and Key Authorized Replication System

• Research Talk • 3/11/14• Long Chen

Today’s Biotechnology

• More than 200 new therapies and vaccines.• 400 drug products and vaccines in clinical trials.• Biotechnology innovations are increasing food supplies, reducing

damage to the environment, conserving natural resources of land, water and nutrients, and increasing farm income in economies worldwide.• Biotech innovation is cleaning our environment and fighting global

climate change by reducing our dependence on petroleum and fossil fuels.

Biotech Companies: IP dependent

• Heavily dependent on scientific discoveries, bio-technologies and innovative tools.• Cost of innovation is high, protection of intellectual property is

required for profitability.• Failure rate is high.

A successful drug : ~$1-5 billion + 10-15 years

Bio-espionage • In 1997, two U.S. citizens were arrested by the FBI and charged with

attempting to steal the process for culturing Taxol from plant cells.• In 2002, a pair of medical researchers were arrested in San Diego for

allegedly stealing genetic material and laboratory equipment from Harvard Medical School.• In December 2013, a corporate agriculture espionage case happened

in Iowa. A Chinese man is accused of stealing highly valuable inbred corn seeds.

Deficiencies of DNA Protection

“GeneGuard”

Prevents DNA replication in an unauthorized host.Enables DNA replication in an authorized host.No addition of chemical inducer needed.Many specific, orthogonal Lock and Key variants

Protect high-value plasmid from being illegally reproduced and unexpected spread.

How does Lock and Key system work?

“R-Loop” “G-Cluster”

Wild Type

Synthetic

Cis-acting

Trans-acting

Stages of L&K development

I. Proof of principleII. Engineer multiple Lock and Key variantsIII. Directed-evolution of L&K variantsIV. Create Authorized Host V. Application of Lock and Key System

Experimental set-up

The R6K origin does not function in E. coli DH10B, allowing us to characterize synthetic origin.

In E.coli pir116, the R6K origin is supposed to have a

copy number up to 250.http://www.frankwu.com/R6K.html

Proof of Principle

• Removed the RNAII, leaving a truncated ColE1 origin only.

E. coli DH10B E. coli pir116

The RNA II primer is essential for plasmid replication.

Proof of Principle

• Removed truncated ColE1 origin, leaving a relocated wt-RNAII only.

Proof of Principle

• We inserted 4 to 42 polyadenylation at 3’ end of wt-RNAII to deplete its self-sufficiency.

http://mcb.asm.org/content/29/11/3124.full

Proof of Principle

• When Lock#X and Key#X are both present, the plasmid get replicated.

A. Minimize cis-acting replication (truncation and poly A insertion)

B. Maximize trans-acting replication

Design Synthetic RNAII and Origin of Replication

http://www.sciencedirect.com/science/article/pii/0092867486904915

A. Minimize cis-acting replication (truncation and Poly A insertion)

B. Maximize trans-acting replication

Synthetic RNA II and Synthetic Origin of Replication

Module of Designing LOCK and KEY Variants

Design 37 Variants

Clone and Evaluate 37 Lock and Key Variants

Sequence GC contentΔGHybrid

[Kcal/mol] Length ntGAGGGCCGC

0.89 -17.239

GGAAATTTGAAT

0.25 -15.4012

CCATGGGCCCCG

0.83 -17.5412

CCGAATGCTATCGAA

0.47 -16.5015

LOCK# Only version LOCK#X + KEY#X version

Study on TOP Four Lock and Key VariantsConstruct a dual-plasmid testing system

The rest part?

Directed-evolution on Lock and Key Complete process of Lock and Key directed-evolution

Outputs of directed-evolution on Lock and Key

Upgrading RNAII

Upgraded RNA II primer

Top Four Rescue SequenceGAGGGCCGCGGAAATTTGAATCCATGGGCCCCGCCGAATGCTATCGAA

After identifying all the mutations from third round of directed-evolution, we get a new version of RNA II primer with known beneficial point mutations.Then we cloned back the other three Top Four rescue sequence and got a series of upgraded Top Four variants.

The poly A section has dropped to 34 As.No mutations in rescue sequence.

Efficacy of directed-evolution on Lock and Key

Before Directed-evolution After Directed-evolution

Creating Authorized Hosts: Three VersionsIntegration of upgraded RNA II primers to the genome of E. coli.

KanR

RNA II primerH1 H2

H1 H2RNA II primer

KanR

yciL tonB

H1 H2

yciL tonBKanRRNA II primer

Characterization and Comparison of Authorized Strains

Application of Lock and Key System

http://www.sciencedirect.com/science/article/pii/S1074552103001030

Quantitative Analysis

? ?

? ?

RNA―cDNARt-qPCR

Total DNARt-qPCR