Post on 25-Feb-2016
description
Lock and Key Authorized Replication System
• Research Talk • 3/11/14• Long Chen
Today’s Biotechnology
• More than 200 new therapies and vaccines.• 400 drug products and vaccines in clinical trials.• Biotechnology innovations are increasing food supplies, reducing
damage to the environment, conserving natural resources of land, water and nutrients, and increasing farm income in economies worldwide.• Biotech innovation is cleaning our environment and fighting global
climate change by reducing our dependence on petroleum and fossil fuels.
Biotech Companies: IP dependent
• Heavily dependent on scientific discoveries, bio-technologies and innovative tools.• Cost of innovation is high, protection of intellectual property is
required for profitability.• Failure rate is high.
A successful drug : ~$1-5 billion + 10-15 years
Bio-espionage • In 1997, two U.S. citizens were arrested by the FBI and charged with
attempting to steal the process for culturing Taxol from plant cells.• In 2002, a pair of medical researchers were arrested in San Diego for
allegedly stealing genetic material and laboratory equipment from Harvard Medical School.• In December 2013, a corporate agriculture espionage case happened
in Iowa. A Chinese man is accused of stealing highly valuable inbred corn seeds.
Deficiencies of DNA Protection
“GeneGuard”
Prevents DNA replication in an unauthorized host.Enables DNA replication in an authorized host.No addition of chemical inducer needed.Many specific, orthogonal Lock and Key variants
Protect high-value plasmid from being illegally reproduced and unexpected spread.
How does Lock and Key system work?
“R-Loop” “G-Cluster”
Wild Type
Synthetic
Cis-acting
Trans-acting
Stages of L&K development
I. Proof of principleII. Engineer multiple Lock and Key variantsIII. Directed-evolution of L&K variantsIV. Create Authorized Host V. Application of Lock and Key System
Experimental set-up
The R6K origin does not function in E. coli DH10B, allowing us to characterize synthetic origin.
In E.coli pir116, the R6K origin is supposed to have a
copy number up to 250.http://www.frankwu.com/R6K.html
Proof of Principle
• Removed the RNAII, leaving a truncated ColE1 origin only.
E. coli DH10B E. coli pir116
The RNA II primer is essential for plasmid replication.
Proof of Principle
• Removed truncated ColE1 origin, leaving a relocated wt-RNAII only.
Proof of Principle
• We inserted 4 to 42 polyadenylation at 3’ end of wt-RNAII to deplete its self-sufficiency.
http://mcb.asm.org/content/29/11/3124.full
Proof of Principle
• When Lock#X and Key#X are both present, the plasmid get replicated.
A. Minimize cis-acting replication (truncation and poly A insertion)
B. Maximize trans-acting replication
Design Synthetic RNAII and Origin of Replication
http://www.sciencedirect.com/science/article/pii/0092867486904915
A. Minimize cis-acting replication (truncation and Poly A insertion)
B. Maximize trans-acting replication
Synthetic RNA II and Synthetic Origin of Replication
Module of Designing LOCK and KEY Variants
Design 37 Variants
Clone and Evaluate 37 Lock and Key Variants
Sequence GC contentΔGHybrid
[Kcal/mol] Length ntGAGGGCCGC
0.89 -17.239
GGAAATTTGAAT
0.25 -15.4012
CCATGGGCCCCG
0.83 -17.5412
CCGAATGCTATCGAA
0.47 -16.5015
LOCK# Only version LOCK#X + KEY#X version
Study on TOP Four Lock and Key VariantsConstruct a dual-plasmid testing system
The rest part?
Directed-evolution on Lock and Key Complete process of Lock and Key directed-evolution
Outputs of directed-evolution on Lock and Key
Upgrading RNAII
Upgraded RNA II primer
Top Four Rescue SequenceGAGGGCCGCGGAAATTTGAATCCATGGGCCCCGCCGAATGCTATCGAA
After identifying all the mutations from third round of directed-evolution, we get a new version of RNA II primer with known beneficial point mutations.Then we cloned back the other three Top Four rescue sequence and got a series of upgraded Top Four variants.
The poly A section has dropped to 34 As.No mutations in rescue sequence.
Efficacy of directed-evolution on Lock and Key
Before Directed-evolution After Directed-evolution
Creating Authorized Hosts: Three VersionsIntegration of upgraded RNA II primers to the genome of E. coli.
KanR
RNA II primerH1 H2
H1 H2RNA II primer
KanR
yciL tonB
H1 H2
yciL tonBKanRRNA II primer
Characterization and Comparison of Authorized Strains
Application of Lock and Key System
http://www.sciencedirect.com/science/article/pii/S1074552103001030
Quantitative Analysis
? ?
? ?
RNA―cDNARt-qPCR
Total DNARt-qPCR