Post on 09-Feb-2018
Revised manuscript: M4:02424
A potential role of 15-deoxy-∆12,14-prostaglandin J2 for induction of human articular chondrocyte
apoptosis in arthritis
Zheng-Zheng Shan, Kayo Masuko-Hongo, Sheng-Ming Dai, Hiroshi Nakamura, Tomohiro Kato and
Kusuki Nishioka.
Department of Bioregulation, Institute of Medical Science, St Marianna University School of Medicine,
2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8512, Japan.
Corresponding Author: Kayo Masuko-Hongo, M.D., Ph.D., Department of Bioregulation, Institute of
Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki,
Kanagawa 216-8512 Japan Tel: 81-44-977-8111 (ext. 4209); Fax: 81-44-978-2036
E-mail: khongo@marianna-u.ac.jp
Running Title: Prostaglandin J2 induces chondrocyte apoptosis
The abbreviations used are: PGs, prostaglandins; 15d-PG J2, 15-deoxy-∆12,14-prostaglandin J2;
PPAR γ, peroxisome proliferator-activated receptor γ; IL-1β, interleukin 1β; TNF-α, tumor
necrosis factor-α; SNP, sodium nitroprusside; PGDS, PG D2 synthase; MAPK, mitogen-activated
protein kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase;
ERK1/2, extracellular signal-regulated kinase; NF-κB, nuclear factor-κB; OA, osteoarthritis; RA,
rheumatoid arthritis
1
JBC Papers in Press. Published on June 22, 2004 as Manuscript M402424200
Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Summary
The cyclopentenone prostaglandin PG J2 is formed within the cyclopentenone ring of the
endogenous prostaglandin PG D2 by a non-enzymatic reaction. The PG J family is involved in mediating
various biological effects including the regulation of cell cycle progression and inflammatory responses.
Here we demonstrate the potential role of 15-deoxy-∆12,14-prostaglandin J2 (15d-PG J2) in human
articular chondrocyte apoptosis. 15d-PG J2 was released by human articular chondrocytes and found in
joint synovial fluids taken from osteoarthritis (OA) or rheumatoid arthritis (RA) patients.
Proinflammatory cytokines such as interleukin-1beta (IL-1β) and tumor necrosis factor-alpha (TNF-α)
upregulated chondrocyte release of 15d-PG J2. PG D2 synthase mRNA expression was upregulated by
IL-1β, TNF-α or nitric oxide. 15d-PG J2 induced apoptosis of chondrocytes from OA or RA patients as
well as control nonarthritic subjects, in a time- and dose-dependent manner, and in a peroxisome
proliferator-activated receptor (PPAR) γ-dependent manner. PPAR γ expression was upregulated by IL-
1β and TNF-α. Inhibition of NF-kappa B and the activation of p38 MAPK were also found to be
involved in 15d-PG J2-induced chondrocyte apoptosis. Such signal pathways led to the activation of the
downstream pro-apoptotic molecule p53 and caspase cascades. Together, these results suggest that 15d-
PGJ2 may play an important role in the pathogenesis of arthritic joint destruction via a regulation of
chondrocyte apoptosis.
Key words: Peroxisome proliferator-activated receptor, Interleukin-1 beta, Tumor necrosis factor-
alpha, Osteoarthritis, Rheumatoid arthritis, Signal transduction, Apoptosis
2
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Introduction
An imbalance between destructive and reparative processes affecting components of the
extracellular matrix can result in destruction of articular cartilage. Because articular chondrocytes are the
only cells residing in cartilage tissue, matrix turnover is solely dependent on these cells and thus their
survival is essential for maintaining proper architecture of the articular cartilage.
In arthropathies such as osteoarthritis (OA) and rheumatoid arthritis (RA), hypocellularity and
matrix degeneration in cartilage are believed to contribute to joint degradation [1, 2]. In OA and RA
joints, chondrocytes showing characteristic features of apoptotic death, such as chromatin condensation,
nuclear fragmentation, cellular shrinkage and apoptotic body formation [3], have been observed.
Chondrocyte death by apoptosis may therefore be of pathogenic significance in the development of
arthritis [4, 5].
There are numerous mediators which potently induce apoptosis in chondrocyte cultures, although
the mechanisms involved are not yet fully elucidated. These mediators include Fas and its ligand FasL
[6,7], nitric oxide [8] and Bcl-2/Bax family members [9]. One member of the prostaglandins (PGs)
family, PG E2, was reported to induce bovine chondrocyte apoptosis [10], but whether such effects can be
identified for other members of the PGs family, for example, PG D2 or its metabolite, PG J2, is largely
unknown.
Cyclopentenone prostaglandins are important regulators of cellular function in a variety of tissues,
including bone and cartilage. PG D2 is a mediator of allergy and inflammation [11]. Its metabolite, PG J2
is formed within the PG D2 cyclopentenone ring by dehydration. PG J2 is metabolized further to yield
∆12-PG J2 and 15-deoxy-∆12,14 PG J2 (15d-PG J2). Members of the PG J series have been reported to
mediate various biological effects including inhibition of cell cycle progression, inhibition of cytokine
production in macrophages, and involvement in inflammatory responses[12]. In contrast to classical
prostaglandins, which bind to cell surface G protein coupled receptors, 15d-PG J2 is a natural ligand of a
3
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
nuclear receptor, the peroxisome proliferator-activated receptors (PPAR) γ. This receptor behaves as a
ligand-activated transcription factor through its DNA binding domain, which recognizes response
elements in the promoter of some target genes linked to apoptosis, cell proliferation and differentiation
and inflammation [13, 14]. Recent data have shown the presence of PPAR γ in rat cartilage and human
synovial tissues [15], and indicated that 15d-PG J2 is the most potent endogenous ligand for PPAR γ yet
discovered [16].
To date, ∆12-PG J2 has been detected in human plasma or serum [17]. However, little is known
about whether 15d-PG J2 can be released from human articular chondrocytes; and the significance of the
in vivo presence of 15d-PG J2 still remains controversial [18]. Accumulating evidence documents the
induction of apoptosis in various cells, especially in tumor cells, by 15d-PG J2; and this compound also
inhibits tumor growth [19]. Nevertheless, the effect of 15d-PG J2 on chondrocyte viability has not been
defined, although the implication of 15d-PG J2 in the pathogenesis of arthritis was demonstrated [20,
21].
Here we investigated the possible role of 15d-PG J2 in chondrocyte viability and apoptosis. 15d-
PG J2 was found to be secreted by human articular chondrocytes, and induced potent chondrocyte
apoptosis; this effect was PPAR γ-dependent. We also demonstrated that 15d-PG J2-induced
chondrocyte apoptosis is dependent on the inhibition of nuclear factor-κB (NF-κB) and activation of
mitogen-activated protein kinase (MAPK) pathway member p38 kinase.
Materials and Methods
Materials. 15-Deoxy-∆12,14-prostaglandin J2, ∆12-PG J2, PG J2, PG E2, ciglitazone, pioglitazone,
GW9662 and T0070907 were obtained from Cayman Chemical (Ann Arbor, MI, USA) and sodium
nitroprusside (SNP) from Sigma (St. Louis, MO, USA). Interleukin-1β (IL-1β), tumor necrosis factor-α
(TNF-α), transforming growth factor-β1 (TGF-β1) were obtained from Wako (Osaka, Japan). Z-Val-
4
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Ala-Asp (OCH3)-fluoromethyl ketone (ZVAD-fmk) was purchased from R&D Systems (Minneapolis,
MN, USA). PD 98059 and SB 202190 were obtained from CALBIOCHEM (MERCK, Tokyo, Japan). All
other reagents were of analytical grade. The final concentration of organic solvent used to dilute 15d-PG
J2 or other reagents was not greater than 0.3%, which did not provoke any changes in cellular viability, as
demonstrated in a preliminary study (data not shown).
Samples. Articular cartilage specimens were obtained from 9 OA patients (73±8 yr; Male/Female: 6/3)
and 7 rheumatoid arthritis (RA) patients (55±13 yr; Male/Female: 3/4) who were undergoing joint
replacement surgery. Synovial fluids were obtained by regular therapeutic arthrocentesis in an outpatient
clinic from a different panel of OA and RA patients (n = 25 and 29, respectively). All patients met the
American College of Rheumatology criteria for OA [22] and RA diagnosis [23]. Arthritis-free human
cartilage was collected from 4 patients (65±2 yr; Male/Female: 3/1) with no history of arthritis who were
undergoing joint surgery after traumatic fracture. All samples were obtained with informed consent from
the patients, and the study protocol was approved by the institutional ethics committee.
Isolation and culture of chondrocytes. Cartilage slices were removed from the femoral heads or knee, and
washed with Dulbecco’s modified Eagle’s medium (DMEM). Tissues were then minced and transferred
to a digestion buffer containing DMEM, anti-yeast (GIBCO), and 0.1% collagenase (type IV). Tissue
was incubated on a shaker at 37°C until the fragments were digested. The cells were filtered through a
nylon mesh with a pore diameter of 70 µm, and washed by suspension and centrifugation in DMEM. The
pellet was resuspended in DMEM supplemented with 10% fetal calf serum (FCS), 50 U/ml penicillin and
50 µg/ml streptomycin. Cells were then seeded in 10-cm dishes at a density of 5~7×105/ml. The cells
were incubated at 37°C in a humidified atmosphere of 95% air and 5% CO2 and the medium was
changed once a week. The confluent cells were dispersed by trypsinization and then transferred to new
dishes in a split ratio of 1:2~1:4. Monolayer cultured chondrocytes of the first passage were used
throughout the experiments. The chondrocytes were starved in DMEM with 0.5% FCS for 24 hour prior
5
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
to each experiment.
15d-PG J2 Assay. The levels of immunoreactive 15d-PG J2 in cultured chondrocyte supernatants were
determined by the enzyme-linked immunosorbent assay (ELISA) method according to the
manufacturer’s instructions using commercially available kits purchased from R&D Systems
(Minneapolis, MN, USA). The minimum detectable concentration of 15d-PG J2 in this assay is typically
less than 36.8 pg/ml. Cross-reactivity was only detectable for PG J2 (49.2%), ∆2-PG J2 (5.99%) or PG
D2 (4.92%), but was less than 0.01% for other PGs according to the manufacturer’s information.
Heparin (0.3 mg/ml) was added as an anticoagulant to the synovial fluid taken from 25 OA or 29 RA
patients. The synovial fluids were then centrifuged for 10 min at 1000×g to remove particulates. The
samples were extracted through a C18 reverse phase column, then washed with 15% ethanol and
deionized water, eluted from the column by ethyl acetate. The organic solvent was then evaporated under
a stream of nitrogen. Samples were reconstituted and ELISA performed according to the manufacturer’s
instructions.
Determination of Apoptosis.
(1) Nuclear morphology. The harvested primary passage chondrocytes were seeded into 8-well chamber
slides (300 µl of cell suspension/well). When confluent, nuclear morphology was assessed by labeling
stimulated or unstimulated adherent cells or 30 min at 37°C with 1 µM Hoechst 33342 (Sigma Chemical
Co. Ann Arbor, MI, USA). Cultures were then washed three times with PBS and examined by
fluorescence microscopy.
(2) Cell Viability Assay. The chondrocytes were seeded into 6-well microplates at a density of 1×105
cells per well. After serum starvation for 24 hours, they were treated with the indicated effectors.
Untreated cells served as controls. After medium was transferred to a 15-ml conical tube, the adherent
chondrocytes were removed by trypsin/EDTA treatment and transferred to the tube containing culture
medium. Cells, debris, and apoptotic bodies were pelleted by centrifugation and then washed once with
6
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
PBS. The washed pellet was subsequently labeled with Guava ViaCount Reagent (Guava, Hayward, CA,
USA). Viable, apoptotic and dead cell populations were analyzed using a small desktop Guava personal
cytometer with ViaCount and Express software (Guava, Hayward, CA, USA). The system counts the
stained nucleated events, then uses the forward scatter (FSC) properties to distinguish free nuclei and
cellular debris from cells to determine an accurate cell count[24]. The collected chondrocytes were also
labeled with 0.5 µg/ml annexin V-FITC (Wako, Osaka, Japan) and 2 µg/ml propidium iodide (Sigma
Chemical Co., Ann Arbor, MI, USA) to document early stages of chondrocyte apoptosis. The FITC signal
of annexin V was detected at 518 nm by FL1 (FITC detector), and propidium iodide fluorescence was
detected at 620 nm by FL2 (phycoerythrin fluorescence detector).
RT-PCR and real-time PCR analysis. Total cellular RNA was extracted from confluent chondrocytes by
a single-step guanidinium thiocyanate-phenol-chlorform method using ISOGEN (Nippon Gene,
Toyama, Japan). RNA was recovered in diethyl cyanophosphonated (DEPC) water and quantified by
spectrophotometry at 260 nm and 280 nm. For reverse transcriptase-polymerase chain reaction (RT-
PCR), RNA samples were reverse-transcribed to cDNA using reverse transcriptase (Invitrogen
Corporation, New York, NY) and random hexamers (TaKaRa Biomedicals, Osaka, Japan). The primer
sequences as well as the number of cycles are shown in Table 1. The PCR conditions were as follows:
initial denaturation at 94 °Cfor 5 min, 30~35 cycles of amplification (1 min at 94 °C, 1 min at 60 °C and 1
min at 72 °C) in an automated thermal cycler (TaKaRa Biomedicals, Osaka, Japan), followed by a final
extension step of 5 min at 72 °C. The PCR products were separated on 1% agarose gels and photographed
under ultraviolet excitation after ethidium bromide staining. PPAR γ and p53 mRNA expression levels
were also determined by quantitative real-time RT-PCR using fluorescence labeled (Light Cycler-Fast
Start DNA Master SYBR Green I, Roche Molecular Biochemicals) primers and LightCycler software
(Roche Molecular Biochemicals). Normalized gene expression was calculated as the ratio between PPAR
γ or p53 and GAPDH copy number.
7
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Immunocytochemistry. Immunochemical staining was performed according to the manufacturer’s
protocol (ABC staining system, Santa Cruz, CA). Chondrocytes were cultured at a density of 5x104 cells
per well in 4-well chamber slides. Subconfluent chondrocytes were fixed with 10% methanol. The cells
were incubated with primary goat polyclonal antibody to PG D2 synthase (PGDS) or PPAR γ (Santa Cruz
Biotechnology, CA) at 4°C overnight. The cell-bound antibody complexes were then visualized by
development in a substrate solution containing 3, 3’ diaminobenzidine (DAB) to yield a red-brown
reaction product. A dilution of normal goat serum containing the same concentrations of nonspecific
immunoglobulin G as primary antibody served as a negative control.
Western blotting analysis. Whole cell lysates were prepared from 1.5×106 chondrocytes stimulated with
the indicated effectors. The trypsinized adherent cells were pelleted by centrifugation and lysed with 0.1
ml of ice-cold lysis buffer containing 20 mM Tris-HCl, pH7.4, 250mM NaCl, 1% Nonidet P-40, and
0.1% SDS, supplemented with protease inhibitors and phosphatase inhibitors (10 mM NaF and 2 mM
Na3VO4). The lysates were transferred to Eppendorf tubes, and the protein concentration was determined by
Bradford assay. Similar amounts of protein were size-fractionated by 10% SDS-polyacrylamide gel
electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes. After blocking with 5%
skim milk in phosphate buffered saline (PBS)/0.1% Tween-20, the protein expression was determined
using specific antibodies purchased from the following sources: goat anti-phospho-ERK1/2, rabbit anti-
ERK1/2, rabbit anti-phospho-p38 and rabbit anti-p38 (Cell signaling Technology). The blots were
developed using a horseradish peroxidase-conjugated secondary antibody and an enhanced
chemiluminescent (ECL) system (Amersham Pharmacia Biotech, Piscataway, NJ).
Caspase-3 and NF-κB activity assay. Caspase-3 activity was assayed on whole cell lysates by
commercially available kit (Roche Molecular Biochemicals) according to the manufacturer’s protocols.
Briefly, after treatment of cells (1~2×106 cells in a 10-cm dish) with or without the indicated stimulation,
8
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
the adherent chondrocytes were harvested by trypsinization and lysed for 1 min on ice in 200 µl of lysis
buffer containing 10 mM dithiothreitol. The lysates were pooled and centrifuged, and the supernatant was
used to determine caspase-3 activity. The fluorescence intensity was measured with an excitation filter
420 nm and emission filter 535 nm. The whole cell lysates were also used for NF-κB p65 activity
determination using a commercially available kit (PIERCE Biotechnology, Rockford, IL, USA). Briefly,
the 96-well plate was coated with the bound NF-κB biotinylated-consensus sequence so that only the
active form of NF-κB will bind to the DNA sequence. Whole cell lysates were added to the plates and
incubated with the specific primary antibody (NF-κB p65) followed by the secondary antibody, and the
resulting signal was then captured by chemiluminescent detection.
Statistical analysis. For all results shown, at least three separate experiments with cells from different
donors were performed. Within experiments each individual measurement was performed in duplicate.
Except where specifically mentioned, one-way analysis of variance (AVOVA) was used to analyze the
differences between different groups for the production of 15d-PG J2 and the percentage of apoptosis.
The data on 15d-PG J2 concentrations in synovial fluids are nonparametric. Therefore, the Mann-
Whitney U test was used to compare the difference between OA and RA patients. p<0.05 was considered
significant.
Results
Production of 15d-PG J2 by chondrocytes and concentrations in synovial fluid. We first investigated
whether cultured human articular chondrocytes produce 15d-PG J2 in vitro. As shown in Fig. 1, both OA
and RA chondrocytes in the resting state released 15d-PG J2, as assayed by ELISA (OA: 221±14 pg/ml;
RA: 297±51 pg/ml). However, levels were lower than in normal chondrocyte cultures (579±49 pg/ml).
Stimulation with IL-1β (10 ng/ml) and SNP (2mM) led to a significantly increased production of 15d-
PG J2 in OA, RA and normal chondrocytes. We also found that 1 µM of PG E2 slightly but significantly
enhanced 15d-PG J2 production levels. TNF-α (25 ng/ml) did not significantly augment 15d-PG J2
9
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
production. On the other hand, 15d-PG J2 levels were significantly decreased by TGF β1 (10 ng/ml). In
particular, 15d-PG J2 levels in OA chondrocytes after TGF β1 treatment were below the levels of
detection (Fig. 1A).
15d-PG J2 was detectable by ELISA in synovial fluids of 25 OA and 29 RA patients whereby one of
the former had a much higher 15d-PG J2 concentration than any of the others. On the whole, however,
15d-PG J2 concentrations in synovial fluids were at picogram per ml levels, and no obvious difference
between OA and RA patients was observed (Fig. 1B).
PGD2 synthase expression and its regulation by proinflammatory cytokines. PG D2 is naturally and
rapidly converted into PG J2 by nonenzymatic pathways, and PG J2 itself is rapidly metabolized to ∆12-
PG J2 and 15d-PG J2 after elimination of one or two water molecules. Therefore, we assessed PGDS
expression as a measure of PG J2-synthesizing enzyme. The expression, at the RNA level, of two
subtypes of synthases, brain- and hematopoietic-PGDS, was evaluated using specific primers. Brain
PGDS mRNA was constitutively expressed in OA chondrocytes, at a level not influenced by
proinflammatory cytokine stimulation. In contrast, the proinflammatory cytokines IL-1β and TNF-α up-
regulated hematopoietic PGDS mRNA expression. 1 mM SNP treatment also induced increased levels of
hematopoietic PGDS mRNA in OA chondrocytes. Peak induction occurred 48 hours after stimulation
(Fig. 2A and B).
To confirm the expression and localization of PGDS in human articular chondrocytes,
immunohistochemistry was performed using polycolonal anti-PGDS antibody. We found markedly
enhanced expression of PGDS in OA chondrocytes stimulated with IL-1β (10 ng/ml, 48-hour
stimulation) or TNF-α (25 ng/ml, 48-hour stimulation). PGDS in OA chondrocytes was mainly localized
to the nucleus and cytoplasmic region (Fig. 2 D, E). OA chondrocytes treated with SNP (1 mM, 48-hour
stimulation) also upregulated PGDS, but the shape of the cells after treatment was irregular and PGDS
immunoreactivity appeared to be completely localized to the nucleus (Fig. 2F).
10
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
These data provide evidence that human chondrocytes are potent producers of PG J2 series molecules
upon activation of PGDS by inflammatory stimuli.
Prostaglandins of the J Series Induce Chondrocyte Apoptosis. Next we evaluated the potency of the PG J
series to induce chondrocyte apoptosis. First, the characteristic nuclear morphological changes, such as
nuclear condensation, cell shrinkage, appearance of small membrane-bound bodies (apoptotic bodies)
were observed by Hoechst staining (Fig. 3A). This suggests apoptotic nuclear changes of chondrocytes
after stimulation with PG J series molecules. Cytometry analyses were performed to quantify apoptosis
induced by 15d-PG J2, an end-product of the PG J series. OA chondrocyte apoptosis was first
demonstrated by Annexin V/PI staining. The inversion of phosphatidylserine from the inner to the outer
plasma membrane occurs early in the apoptotic program and is often used as a specific marker of cells
undergoing apoptosis. Flow cytometry analyses of FITC-conjugated annexin V binding to OA
chondrocytes are shown in Fig 3B. Chondrocytes were counter-stained with propidium iodide (PI) to
distinguish between viable cells (annexin V-/PI-, lower left quadrant of the histograms), early apoptotic
(annexin V+/PI-, lower right quadrant of the histograms) and late apoptotic or necrotic cells (annexin
V+/PI+, upper right quadrant of the histograms). Early (annexin V+/PI-) and late apoptotic (annexin V+/PI+)
chondrocytes constituted a much higher percentage of the total gated cells after stimulation with 10 µM
15d-PG J2, compared with unstimulated chondrocytes. The total apoptotic cell number counted by
Guava staining was in accordance with annexin V/PI staining (Fig 3B, C).
As summarized in Fig. 4, 15d-PG J2 induced chondrocyte apoptosis in a dose-dependent manner at
concentrations of 0~10 µM in RA, OA and normal samples (Fig. 4A), and in a time-dependent manner in
OA chondrocytes (Fig. 4B). The magnitude of apoptosis induction by 15d-PG J2 was similar in RA and
OA chondrocytes. The arthritic chondrocyte apoptosis was further documented by significantly increased
caspase-3 activity after stimulation with 15d-PG J2 (Fig 7E). Furthermore, the effects of PG E2, SNP
and several proinflammatory cytokines on cell viability were compared with the effect of 15d-PG J2.
Added as an exogenous donor of nitric oxide (NO), 2mM SNP exerted a potent apoptotic effect. 1µM PG
E2 also induced chondrocyte apoptosis. However, no significant apoptotic effect of IL-1β (10 ng/ml),
11
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
TNF-α (25 ng/ml) or TGF-β1 (20 ng/ml) on chondrocytes was observed (Fig 4C). We next explored
whether a low dose of 15d-PG J2 (0.1 µM) could enhance NO-induced chondrocyte apoptosis. Neither
0.1 µM 15d-PG J2 nor 0.2 mM SNP alone could induce chondrocyte apoptosis. Nevertheless, a
synergistic effect was obtained in OA chondrocytes following combined 15d-PG J2 and SNP treatment
(Fig 4D).
Induction of OA chondrocyte apoptosis by PPAR γ ligands. The above data clearly demonstrated a
proapoptotic effect of 15d-PG J2. Because 15d-PG J2 is a known ligand of PPAR γ, we hypothesized
that 15d-PG J2-induced apoptosis might depend on the PPAR γ pathway. To investigate whether
apoptosis is induced by PPAR γ activation, we tested three different classes of PPAR γ agonists, 15d-PG
J2, ciglitazone and pioglitazone; and the PPAR γ antagonists GW9662 and T0070907, for their capacity
to induce or alter chondrocyte apoptosis. The two synthetic compounds ciglitazone and pioglitazone did
induce OA chondrocyte apoptosis, but were not as potent as 15d-PG J2 (Fig 5A). Although apoptosis
could still be observed when a much higher concentration of 15d-PG J2 (50 µM) was added to the cell
cultures, a large amount of dead cells was present (unpublished data). This implies a cytotoxic effect at
this high dose of 15d-PG J2. Here we show that pretreatment of OA chondrocytes with the PPAR γ
antagonists T0070907 (1 µM) decreased chondrocyte apoptosis by almost 50% (Fig 5B). Moreover, 15d-
PG J2-induced chondrocyte apoptosis was almost completely prevented by GW9662 (Fig 5C), another
PPAR γ antagonist which is more potent than any of the other antagonists, according to the manufacturer.
Taken together, these data suggested that activation of PPAR γ is involved in chondrocyte apoptosis, and
that PPAR γ might mediate the apoptotic effect induced by 15d-PG J2.
PPAR γ expression in human chondrocytes. First, immunocytochemistry using the polyclonal anti-human
PPAR γ antibody was performed to evaluate the constitutive expression of PPAR γ in human
chondrocytes. Fig. 6A shows the nuclear localization of PPAR γ in OA chondrocytes, while the negative
controls treated with non-immune serum showed no positive reaction. Effects of the proinflammatory
12
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
cytokines IL-1β and TNF-α on PPAR γ mRNA expression were next investigated. Both IL-1β and
TNF-α stimulation up-regulated the expression of PPAR γ. Induction appeared after 1 hour, peaked at 6
hours, and thereafter decreased with time (Fig. 6B, C). 15d-PG J2 stimulation also increased PPAR γ
expression level. The peak fold-increase occurred at 6 hours, and lasted until 12 hours after stimulation
(Fig 6D).
Evaluation of the signaling pathway involved in 15d-PG J2-induced apoptosis. NF-κB is a transcription
factor interfering with the induction of apoptosis [25, 26]. To determine the involvement of NF-κB in
15d-PG J2-induced chondrocyte apoptosis, three approaches were used in the present study. First, we
assayed the active form of NF-κB p65 in OA chondrocytes stimulated with 15d-PG J2 for different
periods of time. Significantly decreased NF-κB p65 activity was found after treatment with 10 µM 15d-
PG J2. Inhibition became noticeable 1 hour after treatment and lasted up to 6 hours, after which p65
activity began to be restored, as compared with the control group (Fig 7A). Second, we measured the
effect of NF-κB pathway inhibitors on 15d-PG J2-induced chondrocyte apoptosis. Bay11-7085, which
specifically inhibits IκB-α phosphorylation and degradation from NF-κB complex, significantly
enhanced the apoptotic effects induced by 10 µM 15d-PG J2 (Fig 9A). Third, western blot analysis was
used as a reliable readout of NF-κB pathway proteins. As shown in Fig. 7B, 15d-PG J2 downregulated
the level of phosphorylated IκB-α protein whereas it had no significant effect on the level of NF-κB in
OA chondrocytes. These data show that inhibition of NF-κB activity is involved in chondrocyte
apoptosis induced by 15d-PG J2.
We further studied the effects of 15d-PG J2 on MAPK activation pathways by focusing on
extracellular signal-regulated kinase (ERK) and p38 kinase, the two key kinases involved in cellular
apoptosis [27]. Changes in the activities of ERK1/2 and p38 kinase were assessed by Western blot
analysis. Interestingly, 15d-PG J2 was found to differentially regulate the activities of the two subtypes
of MAPK. p38 kinase activity was transiently increased, whereas ERK1/2 was inhibited following
stimulation with 15d-PG J2, as determined by the phosphorylation status of the proteins. Levels of
13
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
phosphorylated-p38 kinase protein expression began to increase at 30 min, reached peak levels at 6 hours
and were maintained up to 12 hours after stimulation. Phosphorylated ERK1/2 protein expression began
to decrease from 6 hours after 15d-PG J2 stimulation, and remained depressed for 24 hours (Fig 7B).
Confluent OA chondrocytes were then challenged with MAPK inhibitors to evaluate which kinases are
involved in the chondrocyte apoptosis induced by 15d-PG J2. OA chondrocytes were preincubated for 1
hour with PD98059 (25 µM), a specific inhibitor of mitogen-activated protein kinase/extracellular
signal-regulated kinase (MEK). Thereafter, the cells were challenged with 10 µM of 15d-PG J2 for 48
hours. PD98059 was found to enhance apoptosis induced by 15d-PG J2, whereas 10 µM of SB202190, a
specific p38 MAPK inhibitor, significantly counteracted the apoptotic effect induced by 15d-PG J2 (Fig
9B).
To further elucidate the mechanism of 15d-PG J2-induced OA chondrocyte apoptosis, RT-PCR and
quantitative real-time PCR analyses were performed to quantify the transcriptional expression of p53, a
signaling molecule which is downstream of MAPK [27]. p53 mRNA expression began to increase 30
minutes after 15d-PG J2 stimulation and was maintained up to 6 hours after treatment (Fig 7C). Western
blotting analysis showed that p53 protein expression level began to increase from 30 min after 15d-PG J2
stimulation and persisted up to 12 hours (Fig 7B). Significantly decreased p53 expression was found
following the chemical inhibition of p38 MAPK, while no such effect was obtained after ERK1/2
inhibition (Fig 8), suggesting that only p38 MAPK contributed to the activation of the downstream
molecule p53. We also examined caspase-3 activity, an important pro-apoptotic protease that was
reported to be downstream of p53 [27]. Compared with the control group, caspase-3 activity was
significantly increased when 10 µM of 15d-PG J2 was added to both RA and OA chondrocyte cultures
(Fig 7E). The observation that chondrocyte apoptosis was almost completely abrogated by the general
caspase inhibitor ZVAD-fmk further demonstrated that 15d-PG J2-induced chondrocyte apoptosis is
caspase-dependent (Fig 9C).
Discussion
14
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Our present study is the first to report the in vitro- and in vivo-production of 15d-PG J2 by human
articular chondrocytes, and that 15d-PG J2 potently induces apoptotic death in these cells, thus
suggesting an important contribution of this eicosanoid to the pathogenesis and/or pathophysiology of
arthritis in humans.
Prostaglandins are derived from fatty acids. The main sources of prostaglandins are arachidonates,
which are released from membrane phospholipids by the action of phospholipases. Arachidonic acid is
first converted to the unstable endoperoxide intermediate PG H2 by cyclooxygenases and subsequently
converted to related products, including PG D2, PG E2, PG F2, PG I2 and thromboxane A2, by the action
of specific PG synthases. PG D2 is short-lived and is rapidly metabolized in vivo through different
pathways including conversion to PG J series molecules. The apparent half-life of PG D2 in the blood
has been reported to be 1.5 min [28]. 15d-PG J2 is abundantly produced by mast cells, platelets and
macrophages and has been proposed as a key immunoregulatory lipid mediator [29]. Recently Shibata et
al.[30] reported the endogenous production of 15d-PG J2 in human atherosclerotic lesions and
hypothesized that this compound is involved in atherosclerotic inflammation. In the present study, we
clarified the ability of human articular chondrocytes to produce 15d-PG J2, a regulatory lipid involved in
inflammatory responses. We found that both two types of PGDS, an enzyme that regulates PG J2
synthesis, are expressed in OA chondrocytes (Fig. 2). Increased levels of mRNA following stimulation
with IL-1β or TNF-α were observed only for hematopoietic-PGDS, which was originally recognized as
a splenic enzyme expressed by antigen-presenting dendritic cells as well as in mast cells [31]. On the
other hand, mRNA for brain-PGDS, which is reported to be involved in the regulation of sleep and pain
responses [32], was not altered after cytokine stimulation. These data suggest that hematopoietic PGDS is
enhanced in the inflammatory milieu of joint diseases, whereas the brain-type PGDS is not induced. The
expression of PGDS was also documented by immunocytochemistry, which demonstrated the localization
of PGDS in cartilage. Because PGDS is abundant in arthritic chondrocytes, especially when challenged
with inflammatory cytokines, it is likely that the cyclopentenone-type PG D2 metabolites are locally
15
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
produced, may reach functionally significant levels during inflammation, and may play a role in cartilage
destruction. The finding that significant amounts of 15d-PG J2 accumulated in the culture medium of
human arthritic chondrocytes when challenged with an inflammatory stimulus (Fig. 1A), suggests a
potential autocrine action of 15d-PG J2, which might be involved in chondrocyte destruction. In this
regard, recent data suggest that 15d-PG J2 is a key regulator of negative feedback in the arachidonate
cascade of the cyclooxygenese (COX) pathway [33]. Our study also showed that another prostaglandin
analogue, PG E2, enhanced the release of 15d-PG J2 by chondrocytes (Fig. 1A), suggesting interactions
between different members of the PG family. These findings may provide new insights into the feedback
mechanism of the arachidonate cascade and the regulatory role of 15d-PG J2 in inflammatory responses.
Thus far, controversy still remains regarding the role of 15d-PG J2 in inflammatory responses [21,
34]. Moreover, the in vivo significance of endogenous 15d-PG J2 has even been questioned [18], because
of the technical difficulties in determining its in vivo levels. However, our present study demonstrated the
presence of 15d-PG J2 in arthritic synovial fluids, though at picomolar levels, using a recently-
developed ELISA assay (Fig. 1B). Hence, technical improvements to the experimental system, especially
regarding sensitivity, will help our better understanding of the role of the cyclopentenone prostaglandins
in vivo. In addition, it should be noted that arachidonate metabolism is greatly increased under several
pathogenic conditions, including hyperthermia and inflammation, and local PG concentrations in the
micromolar range have been detected at the sites of the acute inflammation [30]. Systemic or local
administration of non-steroidal anti-inflammatory drugs may prevent PG secretion in patients. In
particular, it is very important that articular chondrocytes secrete PG J2 in an autocrine fashion, because
these cells are embedded in the extracellular matrix, which prevents them from having contact with pro-
apoptotic stimuli in synovial fluids or synovial tissues. Thus, autocrine release of PG J2 might play a
pivotal role in inducing chondrocyte apoptosis.
It has been proposed that 15d-PG J2 might act as a "dual agent" regulating COX-2 expression in
human chondrocytes [35]. It is therefore possible that 15d-PG J2 might have diverse effects on
16
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
chondrocyte metabolism, depending on the different cellular circumstances. Thus, the role of 15d-PG J2
in the regulation of cartilage metabolism is complex and remains under intense investigation. Our present
study demonstrated the pro-apoptotic effect of 15d-PG J2 in articular chondrocytes, suggesting a
catabolic role of 15d-PG J2 in the cartilage. The potency of apoptosis induction by 15d-PG J2 is
consistent with reports on various cell lines, such as human hepatic myofibroblasts[36], vascular
endothelial cells[16] and synoviocytes[21]. However, it has been claimed that the in vitro dose used in
these experiments is far higher than the levels of 15d-PG J2 detectable in vivo. In this context, we
demonstrated that a low dose of 15d-PG J2 cooperated with low dose SNP treatment to enhance the
apoptotic effect (Fig. 4D). Specifically, in a comparative study, neither IL-1β nor TNF-α alone could
induce chondrocyte apoptosis. Instead, these cytokines induced the release of 15d-PG J2 by the
chondrocytes. However, the amount of 15d-PG J2 secretion was unlikely to have been high enough to
induce chondrocyte apoptosis by itself. Similarly, levels of 15d-PG J2 in synovial fluid were insufficient
for apoptosis induction. Nevertheless, 15d-PG J2 was shown to cooperate with other proinflammatory
factors such as NO, which together would be able to mediate enhanced apoptotic effects. In addition, we
confirmed that not only 15d-PG J2 but also PG J2 and ∆12-PG J2 show pro-apoptotic effects (data not
shown), implying that the concomitant presence of these factors might mutually enhance their catabolic
effects. These results collectively emphasize that there could be a hitherto unrecognized role of 15d-PG
J2 and other cyclopentenones in cartilage degradation in arthropathies such as OA and RA, despite their
very low levels thus far detected.
Of the naturally occurring PPAR γ agonists, 15d-PG J2 is among the most potent for both
transactivating PPAR γ [13, 37] and inducing apoptosis [38]. We therefore sought to determine whether
15d-PG J2 exerted its effects via activation of PPAR γ. Constitutive expression of PPAR γ in human
articular chondrocytes was documented here (Fig. 6A) and has also been reported by others [21].
Furthermore, we showed that the PPAR γ mRNA expression level was up-regulated by the
proinflammatory cytokines IL-1β or TNF-α (Fig. 6B, C). Our present study provided evidence that the
17
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
transcriptional activation of PPAR γ is a critical event in 15d-PG J2-induced chondrocyte apoptosis (Fig.
5). Specifically, the two synthetic PPAR γ agonists ciglitazone and pioglitazone both induced
chondrocyte apoptosis, although the effects of these two compounds were not as potent as 15d-PG J2. On
the other hand, 15d-PG J2-induced chondrocyte apoptosis was abrogated by the PPAR γ antagonist
GW9662 or T0070907. These data provided pharmacological evidence that PPAR γ is critical for
chondrocyte apoptosis. In this regard, however, controversy still exists as to the molecular mechanisms of
15d-PG J2 activity. It can also exert effects that are independent of PPAR γ, for example, induction of
formation of reactive oxygen species that lead to cell death [39]. For this reason, pharmacological
activation of PPAR γ by highly selective synthetic compounds did not completely reproduce the potency
of 15d-PG J2. Thus, there might be different mechanisms, some involving PPAR γ and some
independent of it, by which 15d-PG J2 induces chondrocyte apoptosis.
Mounting evidence indicates that NF-κB regulates apoptosis, in most cases exerting a protective
effect [40, 41]. However, it was also reported that NF-κB had pro-apoptotic function, depending on cell
type and extracellular stimuli [42]. Therefore, we evaluated the role of NF-κB in 15d-PG J2-induced
chondrocyte apoptosis. The findings of decreased NF-κB p65 activity (Fig 7A, B) and enhanced
apoptotic effects after NF-κB inhibition (Fig 9A) strongly support the role of NF-κB activation in
rescuing chondrocytes from apoptosis.
MAPK pathways play a key role in a variety of cellular responses, such as cell proliferation,
differentiation, and cell death [43, 44], including NO-induced chondrocyte apoptosis [27]. In the present
study, we established that 15d-PG J2 treatment activated the MAPK pathway in chondrocytes. However,
two subtypes of MAPK, i.e. ERK1/2 and p38, showed divergent responses (Fig 7B). Specifically, the
activation of p38 kinase appeared to play a predominant role in apoptosis induction, whereas ERK1/2
acted rather to inhibit apoptosis (Fig. 9B). Such opposing regulatory effects are in accordance with reports
by Kim et al.[27] and Shakibaei et al. [45]. In fact, previous reports indicated that ERK1/2 activation was
mainly involved in cellular dedifferentiation and phenotype maintenance, rather than inducing cellular
18
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
apoptosis [45, 46]. To further elucidate the precise mechanism involved in 15d-PG J2-induced
chondrocyte apoptosis, we focused on the expression of the pro-apoptotic molecules p53, and caspase-3,
which was reported to be downstream of p53 [27, 47]. Increased p53 expression levels and caspase-3
activity were found in our present study (Fig 7B-E); also caspase inhibitor completely blocked the
increased caspase-3 activity (Fig. 9C). The effect of MAPK inhibition on p53 expression confirmed the
interrelationship of MAPK and p53. In our study, p38 kinase contributed to activation of the downstream
p53, while ERK1/2 seemed not to have such an effect (Fig 8). Kim et al. [27] previously reported that
increased p53 expression was accompanied by ERK1/2 inhibition in rabbit chondrocytes after stimulation
with SNP, so use of different cell types or stimuli might account for the different regulatory effects
observed. The above results collectively suggest that 15d-PG J2-induced chondrocyte apoptosis is
accomplished via a p53 and caspase-3-dependent pathway, as depicted in Figure 10.
In conclusion, our present study demonstrated the ability of human articular chondrocytes to
produce PG J2 in an autocrine fashion, and a potential role of 15d-PG J2 in the induction of chondrocyte
apoptosis. Because this implies an involvement of chondrocyte apoptosis in the pathogenesis of arthritis,
pathways affected by prostaglandin analogues may be an important focus of investigation to establish
novel therapeutic strategies for preventing cartilage degradation in joint diseases, in the pathogenesis of
which the COX/PG system is closely involved.
19
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Acknowledgments
The authors gratefully acknowledge Ms. Toshiko Mogi, Ms. Hiroe Ogasawara for their excellent
technical assistance. We thank Dr. Atsuyuki Shibakawa and Prof. Haruhito Aoki, Department of
Orthopedic Surgery, St. Marianna University School of Medicine, for providing clinical samples.
This study was partly supported by grants-in-aids from the Ministry of Health, Labour and Welfare
of Japan and the Japan Rheumatism Foundation.
20
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
References
1. Hashimoto, S., Ochs, R.L., and Koniya, S. (1998) Arthritis Rheum. 41,1632-1638
2. Choy, E.H., and Panayi, G.S., (2001) N Engl J Med. 344, 907-916
3. Green, D.R. (2003) Immunological Rev. 193, 5-9
4. Blanco, F.J., Guitian, R., Vazquez-Martul, E., de Toro, F.J. and Galdo, P. (1998) Arthritis Rheum
41, 284-289
5. Kim, H.A., and Song, Y.W. (1999) Arthritis Rheum. 42, 1528-1537
6. Lotz. M., Hashimoto, S. and Kuhn, K. (1999) Osteoarthritis Cart. 7, 389-391
7. Hashimoto, H., Tanaka, M. Suda, T., Tomita, T., Hayashida, K., Takeuchi, E. et al. (1998) Arthritis
Rheum 41, 57-62
8. Blanco, F.J., Ochs, F.L., Schwarz, H. and Lotz, M. (1995) Am J Pathol. 146, 75-85.
9. Feng, L., Precht, P., Balakir, R., Horton, W.E. Jr. (1998) J Cell Biochem. 71, 302-309.
10. Miwa, M., Saura, R., Hirata, S., Hayashi, Y., Mizuno, K. and Itoh, H. (2000) Osteoarthritis Cart 8,
17-24.
11.Matsuoka, T., Hirata, M. and Tanaka, H. (2000) Science. 287, 2013-2017
12. Cuzzocrea, S., Wayman, N.S., Mazzon, E., Dugo, L., Paola, R.D. Serraino, I. et al. (2002) Mol
Pharmacol. 61, 997-1007.
13. Kliewer, S,A., Lenhard, J.M. and Willson, T.M. (1995) Cell 83, 813-819.
14. Tugwood, J.D. and Montague, C.T. (2002) Hum Exp Toxicol. 21, 429-437.
15. Bordji, K., Grillasca, J.P., Gouze, J.N., Magdalou, J., Schohn, H. Keller, J.M. et al. (2000) J Biol
Chem 275, 12243-12250.
16. Bishop-Bailey, D. and Hla, T. (1999) J Biol Chem 274, 17042-17048.
17. Fukushima, M., Sasaki, H. and Fukushima, S. (1994) Ann N Y Acad Sci. 744, 161-165.
18. Bell-Parikh, L.C., Ide, T. and Lawson, J.A. (2003) J Clin. Invest. 112, 945-955.
19. Hashimoto, K., Ethridge, R.T. and Evers, B.M. (2002) Int J Gastrointest Cancer 32, 7-22.
20. Fahmi, H., Di Battista, J.A., Pelletier, J.P., Mineau, F., Ranger, P. and Martel-Pelletier, J. (2001)
21
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Arthritis Rheum 44, 595-607.
21. Kawahito, Y., Kondo, M., Tsubouchi, Y. et al. (2000) J Clin Invest. 106, 189-197.
22. Altman, R., Asch, E., Bloch, D., Bole, G., Borenstein, D., Brandt, K., et al. (1986) Arthritis Rheum
29, 1039–1049.
23. Arnett, F.C., Edworthy, S.M., Bloch, D.A., McShane, D.J., Fries, J.F., Cooper, N.S. et al. (1988)
Arthritis Rheum 31, 315-324.
24. Phi-Wilson, J., Harvey, J. and O’Neill, R. (2001) Am Biotechnol. Lab. May: 34-36.
25.Ward, C., Chilvers, E.R., Lawson, M.F., Pryde, J.G., Fujihara, S. and Farrow, S.N. et al. (1999) J Biol
Chem. 274, 4309-4318.
26.Van Antwerp, D.J., Martin, S.J., Kafri, T., Green, D.R. and Verma, I.M. (1996) Science 274, 787-789.
27.Kim, S.J., Ju, J.W., Oh, C.D., Yoon, Y.M., Song, W.K. Kim, J.H. et al. (2002) J Biol Chem. 277,
1332-1339.
28.Heinemann, A., Schuligoi, R., Sabroe, I., Hartnell, A. and Peskar, B.A. (2003) J Immunol. 170, 4752-
4758.
29. Ito, S., Narumiya, S. and Hayaishi, O. (1989) Prostaglandins Leukotrienes Essent. Fatty Acids. 37,
219-234.
30.Shibata, T., Kondo, M., Osawa, T., Shibata, N., Kobayashi, M. and Uchida, K. (2002) J Biol Chem.
277, 10459-10466.
31. Murakami, Y., Akahoshi, T., Hayashi, I., Endo, H., Hashimoto, A., Kono, S. et al. (2003) Arthritis
Rheum. 48, 2931-2941.
32.Urade, Y. and Hayaishi, O. (2000) Biochim Biophys Acta. 1482, 259-271.
33. Tsubouchi, Y., Kawahito, Y., Kohno, M., Inoue, K., Hla, T., and Sano, H. (2001) Biochem Biophys
Res Commun. 283, 750-755
34. Harris, S.G., Smith, R.S. and Phipps, R.P. (2002) J Immunol. 168, 1372-1379.
35. Fahmi, H., Pelletier, J.P., Mineau, F. and Martel-Pelletier, J. (2002) Osteoarthritis Cartilage. 10,
845-848.
22
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
36. Li, L., Tao, J., Davaille, J., Feral, C., Mallat, A., Rieusset, J., Vidal, H., Lotersztajn, S. et al. (2001) J
Biol Chem. 276, 38152-38158.
37. Forman, B.M., Tontonoz, P., Chen, J., Brun, R.P., Spiegelman, B.M. and Evans, R.M. (1995) Cell
83, 803-812.
38. Clay, C.E., Namen, A.M., Astumi, G., Willingham, M.C., High, K.P. Kute, T.E. et al. (1999)
Carcinogenesis; 20, 1905-1911.
39. Kondo, M., Oya-Ito, T., Kumagai, T., Osawa, T. and Uchida, K. (2001) J Biol. Chem. 276, 12076-
12083.
40. Kühn, K. and Lotz, M. (2001) Arthritis Rheum. 44, 1644-1653.
41.Kim, S.J., Hwang, S.G., Shin, D.Y., Kang, S.S. and Chun, J.S. (20020 J Biol Chem. 277, 33501-
33508.
42. Su, B. and Karin, M. (1996) Curr Opin Immunol. 8, 402-411.
43. Egan, S.E., Giddings, B.W., Brooks, M.W., Buday, I., Sizeland, A.M. and Weinberg, R.A. (1993)
Nature 363, 45-51.
44. Shakibaei, M., Schulze-Tanzil, G., de Souza, P., John, T., Rahmanzadeh, M., Rahmanzadeh, R. et
al. (2001) J Biol Chem. 276, 13289-13294.
45. Yoon, Y.M., Kim, S.J., Oh, C.D., Ju, J.W., Song, W.K., Yoo, Y.J. et al. (2002) J Biol Chem. 277,
8412-8420.
46. Kondo, M., Shibata, T., Kumagai, T., Osawa, T., Shibata, N. Kobayashi, M. et al. (2002) Proc Natl
Acad Sci U S A. 99, 7367-7372.
23
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Figure Legends
Fig 1. 15d-PG J2 concentrations in osteoarthritis (OA) and rheumatoid arthritis (RA) patients. (A) 15d-
PG J2 production by OA, RA and normal chondrocytes. Chondrocytes were stimulated with IL-1β (10
ng/ml), TNF-α (25 ng/ml), TGF β1 (10 ng/ml), PG E2 (1 µM) or SNP (2 mM). Cell culture supernatants
were collected and subjected to ELISA 48 h after stimulation. Data are expressed as mean ± SD. *p<0.05,
**p<0.01 vs control. The data represent the results of three separate experiments conducted with at least
three different donors. (B) Concentrations of synovial fluid 15d-PG J2 were measured by ELISA in OA
(n = 25) and RA (n = 29) patients. Boxes represent 25th and 75th percentiles; horizontal lines within
boxes represent 50th percentiles; vertical lines below and above boxes represent 10th and 90th
percentiles; solid dots represent values outside 10th and 90th percentiles. P=0.840, OA patients versus
RA patients excluding the values (solid dots) outside 90th percentiles, according to the Mann-Whitney U
test.
Fig 2. Prostaglandin D synthase (PGDS) expression in osteoarthritic chondrocytes. (A) RT-PCR results
of brain-PGDS expression in OA chondrocytes stimulated with IL-1β (10 ng/ml), TNF-α (25 ng/ml) or
SNP (1 mM) for the indicated time. (B) RT-PCR results of hematopoietic-PGDS expression in OA
chondrocytes stimulated with IL-1β (10 ng/ml), TNF-α (25 ng/ml) or SNP (1 mM) for the indicated
time. (C-F) Immunocytochemistry confirms the expression of PGDS in OA chondrocytes. Less
immunoreactivity was found in untreated chondrocytes (C). The nuclear localization of PGDS
immunoreactivity (arrows) in IL-1β (D) and TNF-α (E)-treated chondrocytes. Chondrocytes appeared
to have an irregular shape with potent nuclear translacation of PGDS after stimulation with SNP (F).
Fig 3. Induction of nuclear morphological changes and apoptosis by 15d-PG J2 in human articular
chondrocytes. (A) Normal, RA and OA chondrocytes were incubated with or without 15d-PG J2 (10 µM)
for 48 h and then stained with Hoechst 33342. Cells with morphological changes such as condensed
nuclei are suggested to be apoptotic. (B) Representative data of Annexin V/PI staining of OA
24
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
chondrocytes. Serum-starved OA chondrocytes were treated with solvent only or 10 µM 15d-PG J2 for
48 hours. The harvested adherent cells including culture medium and washings were pelleted for analyses
of Annexin V and PI staining by flow cytometry. Annexin V and PI staining is represented on the X-axis
(FL1) and Y-axis (FL2), respectively. Analyses represent data collected on 10000 gated cells. Values in
the quadrants represent the percentage of total gated cells. Similar data were obtained in two additional
independent experiments. (C) Representative histogram data of Guava ViaCount assay of OA
chondrocytes. Cell culture and 15d-PG J2 stimulation were the same as for Annexin V/PI staining. The
harvested adherent cells including culture medium and washings were pelleted prior to labeling for Guava
ViaCount assay. Analyses represent data collected on 5000 gated cells. The viability marker (red)
separating viable cells (left) from apoptotic cells (right). Apoptosis marker (purple) separating apoptotic
cells (left) from dead cells (right).
Fig 4. 15d-PG J2 induces chondrocyte apoptosis of OA, RA and normal samples. Chondrocytes were
plated in monolayer cultures in DMEM supplemented with 10% FCS. After 24 h-starvation (culture
medium was changed to DMEM supplemented with 0.5% FCS), chondrocytes were incubated with the
different concentrations of 15d-PG J2 for 48 h. Untreated cells served as controls. (A) The harvested
adherent cells including culture medium and washings were pelleted and labeled with the Guava
ViaCount reagent for analysis of the percentage of apoptotic cells. (B) OA chondrocytes were incubated
with 10 µM 15d-PG J2 for the indicated time. (C) Effects of inflammatory mediators on chondrocyte
apoptosis. Chondrocytes were incubated with PG E2 (1 µM), SNP (2 mM), IL-1β (10 ng/ml), TNF-α
(25 ng/ml), TGF β1 (10 ng/ml) and 15d-PG J2 (10 µM) for 48 h, and then were collected to perform
Guava ViaCount apoptosis assay. (D) The effect of 15d-PG J2 (0.1 µM) together with SNP (0.2 mM) on
OA chondrocyte apoptosis. Data are expressed as mean ± SD, *p<0.05, **p<0.01 vs control. #p<0.05 vs
15d-PG J2 treatment alone. The data represent the results of three separate experiments conducted with at
least three different donors.
Fig 5. PPAR γ ligands induce chondrocyte apoptosis. (A) OA chondrocytes were grown in the presence of
25
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
vehicle or the indicated PPAR γ agonists. Chondrocyte apoptosis was induced by 15d-PG J2, ciglitazone
or pioglitazone. (B) Pharmacologic antagonism of PPAR γ by1 µM T0070907 counteracted the apoptotic
effect of 15d-PG J2. (C) Pharmacologic antagonism by GW9662 (25 µM) completely blocked the
apoptotic effect of 15d-PG J2. Serum-starved OA chondrocytes were incubated with PPAR γ agonists
for 48 h; or with antagonists for 1 h, followed by coincubation with 15d-PG J2 (10 µM) for 48 h.
Untreated cells served as controls. The number of apoptotic cells was determined by flow cytometry
using the Guava ViaCount Assay. Values are expressed as mean±SD of three separate experiments.
*p<0.05, **p<0.01 vs control. #p<0.05, ##p<0.01 vs 15d-PG J2 alone. The data represent the results of
three separate experiments conducted with at least three different donors.
Fig 6. Expression of PPAR γ in human articular chondrocytes. (A) Immunocytochemistry showed that
PPAR γ was constitutively expressed in OA chondrocytes. (a) No immunoreactivity was found in
chondrocytes treated with non-immune serum. (b) Immunoreactive PPAR γ was localized to the nuclear
region in OA chondrocytes. (B) RT-PCR analysis showed PPAR γ mRNA expression in OA
chondrocytes stimulated with 10ng/ml IL-1β, 25 ng/ml TNF-α or 10 µM 15d-PG J2 for the indicated
periods of time. Total RNA was isolated as described in Materials and Methods, RT-PCR conditions
were as reported in Table 1. (C) Quantitative real-time RT-PCR analysis showed that PPAR γ mRNA
expression was up-regulated by IL-1β or TNF-α, and that peak induction occurred at 6 h after
stimulation. 15d-PG J2 also upregulated PPAR γ mRNA expression levels, with peak induction 6 h after
stimulation.
Fig 7. Signaling pathways involved in chondrocyte apoptosis induced by 15d-PG J2. Serum-starved OA
chondrocytes were incubated with 15d-PG J2 (10 µM) for the indicated time periods. Chondrocytes
treated with vehicle served as controls. (A) DNA binding activity of NF-κB p65 was determined by
chemiluminescent assay as described in Materials and Methods. (B) NF-κB, phosphorylated IκB-α
(pIκB-α), ERK1/2, phosphorylated ERK1/2 (p-ERK1/2), p38, phosphorylated p38 (p-p38) and p53
26
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
expression were detected by Western blotting analysis. (C) RT-PCR analysis of p53 expression. (D)
Real-time RT-PCR analysis of p53 expression. (E) Caspase-3 activity of OA and RA chondrocytes was
increased after stimulation with 15d-PG J2. Values are expressed as mean±SD of three separate
experiments. **p<0.01 vs control.
Fig 8. p38 MAPK contributed to the activation of p53. OA chondrocytes were incubated with PD98059
(25 µM) or SB202190 (10 µM) for 1 hour, then with 15d-PG J2 (10 µM) for a further 6 h. (A) Real-time
RT-PCR analysis of p53 expression. (B) Western blotting analysis of p53 protein expression. *p<0.05 vs
15d-PG J2 treatment only.
Fig 9. Effect of pharmacological antagonism of NF-κB, MAPK and caspase-3 on chondrocyte apoptosis
induced by 15d-PG J2. (A) Effect of specific IκB-α inhibitor Bay11-7085 (20 µM) on OA chondrocyte
apoptosis. (B) Divergent effects of ERK inhibitor PD98059 (25 µM) and p38 kinase inhibitor SB202190
(10 µM) on OA chondrocyte apoptosis. (C) Caspase inhibitor ZVAD-fmk completely blocked the
apoptotic effects of 15d-PG J2 on OA chondrocytes. Serum-starved OA chondrocytes pretreated with
antagonists for 1 h, followed by coincubation with 10 µM 15d-PG J2 for 48 h. Apoptotic cell number
was quantified by the Guava ViaCount Assay. *p<0.05, **p<0.01, vs control; #p<0.05, ##p<0.01, vs
15d-PG J2 treatment alone. The data represent the results of three separate experiments conducted with
three different donors.
Fig 10. Schematic summary of the potential role of 15d-PG J2 in human articular chondrocyte apoptosis.
15d-PG J2 is released from human articular chondrocytes and its production is stimulated by
inflammatory mediators such as IL-1β, TNF-α, nitric oxide and PG E2. 15d-PG J2 induces human
arthritic chondrocyte apoptosis and the effect is dependent on PPAR γ activation. PPAR γ is constitutively
expressed in human articular chondrocytes and its expression is up-regulated by inflammatory cytokines
such as IL-1β and TNF-α. Inhibition of NF-κB and ERK1/2, and activation of p38 kinase are involved
27
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
in chondrocyte apoptosis induced by 15d-PG J2. 15d-PG J2-induced chondrocyte apoptosis is
dependent on the activation of p53 and caspase-3, which are downstream of p38 MAPK.
28
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Table 1. Sequences of primers used for PCR amplification of cDNA, product sizes, and PCR cycle
numbers
Gene Primer Seqence Size (bp) Cycle Accession number
PGDS-Hematopoietic 5’ GAACAAGCTGACTGGC 273 35 NM_014485
3’ AGGCGCATTATACGTG
PGDS-Brain 5’ CACCGACTACGACCAG 204 35 BC005939
3’ TGTTCCGTCATGCACTTATC
PPAR γ 5’ TTCCCGCTGACCAAAG 356 35 BC006811
3’ CCCTCGGATATGAGAACC
P53 5’ AGCATCTTATCCGAGTGG 300 35 NM_000546
3’ TCTTGCGGAGATTCTCTT
GAPDH 5’ CCCTCGGATATGAGAACC 226 30 NM_002046
3’ GAAGATGGTGATGGGATTTC
29
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Kato and Kusuki NishiokaZheng-Zheng Shan, Kayo Masuko-Hongo, Sheng-Ming Dai, Hiroshi Nakamura, Tomohiro
articular chondrocyte apoptosis in arthritisA potential role of 15-deoxy-delta12,14-prostaglandin J2 for induction of human
published online June 22, 2004J. Biol. Chem.
10.1074/jbc.M402424200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from