Post on 28-Dec-2015
Genomics and Personalized Care in
Health Systems
Lecture 9 RNA and Protein Structure
Leming Zhou, PhD
School of Health and Rehabilitation Sciences
Department of Health Information Management
Department of Health Information Management
Outline• RNA structure
• Protein structure
• Pharmacogenomics
Department of Health Information Management
Two Types of Genes• Protein coding genes
– Common patterns: promoter region, start codon, codons, stop codon
– Translated to protein sequence
• RNA genes– No consistent patterns common to all RNA genes
– Not translated to proteins
– Functional as RNA molecules
Department of Health Information Management
Types of RNA• mRNA: messager RNA
• tRNA: transfer RNA for providing codons and amino acids
• rRNA: ribosomal RNA for protein translation
• miRNA: MicroRNAs are small (22 nucleotides) non-coding RNA gene products that seem to regulate translation
• snRNAs: small nuclear RNAs– Spliceosomal RNAs found in spliceosome which is
involved in splicing
– Small nucleolar RNA located in the nucleolus
Department of Health Information Management
RNA Genes• RNA has various functions
• There are software developed to search for RNA genes in the genome.– tRNAscan searched for tRNA
Department of Health Information Management
RNA Databases• Ribosomal RNA database
– Ribosomal Database Project: http://rdp.cme.msu.edu/
• tRNA Databases– Genomic tRNA Database: http://gtrnadb.ucsc.edu/
• snoRNA Databases– Yeast snoRNA Database:
http://people.biochem.umass.edu/fournierlab/snornadb/main.php
Department of Health Information Management
Secondary and Tertiary Structure• RNA sequence RNA structure
– folding and pairing of bases within the sequence
• Canonical pairing: G-C and A-U– G-C pairing give more energetic stability (3 bonds)
• Non-canonical pairing: G-U (very common), A-C, A-G, etc.
• Double stranded regions and loop regions are the secondary structure elements
• Tertiary structure is the interaction between secondary structure elements
Department of Health Information Management
RNA Secondary Structure• For RNAs, secondary structures are conserved,
but primary sequences are not necessarily conserved
http://rnajournal.cshlp.org/content/10/10/1541/F1.expansion
Department of Health Information Management
RNA Structure Prediction Methods
• Sequence and base pairing patterns
• Energy minimization– Find the energetically most stable structure
– Energy calculations based on base pairings
– All possible structures are sampled using the Monte Carlo method
– Zuker and Stiegler (1981) used dynamic programming and energy rules to get the energetically most favorable structure.
– Mfold is software developed by Zuker and co-workers. It is very computationally expensive and can be used on a maximum of about 1000 nucleotides.
Department of Health Information Management
Exercises
Use mfold to predict the secondary structure of a RNA sequence
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCACACGCGAAAGG
TCCCCGGTTCGAAACCGGGCGGAAACA
http://mfold.rna.albany.edu/?q=mfold
Protein Structure
Department of Health Information Management
Four Levels of Protein Structure• Primary Structure – Sequence of amino acids
• Secondary Structure – Local Structure such as
alpha-helices and beta-sheets
• Tertiary Structure – Arrangement of the secondary structural elements to give 3D structure of a protein
• Quaternary Structure – Arrangement of the subunits to give a protein complex its 3D structure
Department of Health Information Management
Protein Basic Structure• A protein is made of a chain of amino acids
• A amino acid sequence is generally reported from the N-terminal end to the C-terminal end
J. Biol. Chem. 1973, 248, p. 7670
Department of Health Information Management
Secondary Structure (Helices)
Department of Health Information Management
Helix Examples
Department of Health Information Management
Secondary Structure (Beta-sheets)
Department of Health Information Management
Beta Sheet Examples
Parallel beta sheet Anti-parallel beta sheet
Department of Health Information Management
Beta Sheet Examples (Cont’d)
Department of Health Information Management
Protein Structure Example
Beta Sheet
Helix Loop
ID: 12as2 chains
Protein Classification
Department of Health Information Management
Domain and Motif• Domain: a discrete portion of a protein assumed
to fold independently of the rest of the protein and possessing its own function.– Most proteins have multiple domains
• Motif:– Frequently occurring structure patterns among multiple
proteins
Department of Health Information Management
Protein Classification• Family: the proteins in the same family are
homologous, evolved from the same ancestor. Usually, the identity of two sequences are very high.
• Super Family: distant homologous sequences, evolved from the same ancestor. Sequence identity is around 25%-30%.
• Fold: only shapes are similar, no homologous relationship. Usually, sequence identity is very low.
• Protein classification databases: SCOP, CATH
Department of Health Information Management
SCOP• The SCOP database aims to provide a detailed
and comprehensive description of the structural and evolutionary relationships between all proteins whose structure is known.
• Proteins are classified to reflect both structural and evolutionary relatedness. – Many levels exist in the hierarchy
– The principal levels are family, super family and fold
Department of Health Information Management
CATH• CATH is novel hierarchical classification of
protein domain structures, which clusters proteins at four major levels:– Class
– Architecture
– Topology
– Homologous super family
Department of Health Information Management
CATH-Protein Structure Classification
Class
Architecture
Topology
Protein Structure Determination
Department of Health Information Management
Experimental Methods for Protein Structure Determination• X-ray crystallography
– Crystallize proteins
– Measure X-ray diffraction pattern
• NMR spectroscopy– NMR – Use nuclear magnetic resonance to predict distances
between different Functional groups in a protein in solution.
– Calculate possible structure using these distances.
• Neutron diffraction
• Electron microscopy
• Atomic force microscopy
Department of Health Information Management
Limitations of Experimental Methods• X-ray Diffraction
– Only a small number of proteins can be made to form crystals
– A crystal is not the protein’s native environment
– Very time consuming
• NMR Distance Measurement– Not all proteins are found in solution
– This method generally looks at isolated proteins rather than protein complexes
– Very time consuming
Department of Health Information Management
Computational Structure Prediction• The functions of a protein is determined by its
structure.
• Experimental methods to determine protein structure are time-consuming and expensive.
• Big gap between the available protein sequences and structures.
Department of Health Information Management
Observations• Sequences determine structures
• Proteins fold into minimum energy state.
• Structures are more conserved than sequences. If two protein sequences share 30% identical residues, then they have a very good chance to have the same fold.
Department of Health Information Management
Prediction Methods• Ab initio folding: build a structure without
referring to an existing structure
• Homology Modeling: sequence-based method
• Protein Threading: sequence-structure alignment
• Consensus Method: vote a prediction from some candidates generated by several prediction programs
Department of Health Information Management
Ab Initio Folding• Based on the “first-principle”
• Build structures purely from protein sequences, no templates used
• Unaffordable computing demands
• Paradigm is changing, knowledge-based methods are proposed
Department of Health Information Management
Secondary Structure Prediction• Three-state model: helix (H), strand (E), coil (L)
• Given a protein sequence:– NWVLSTAADMQGVVTDGMASGLDKD…
• Predict are secondary structure sequence:– LLEEEELLLLHHHHHHHHHHLHHHL…
– Accuracy: 50-85%
Department of Health Information Management
Predict Protein Secondary Structure Using PredictProtein• Protein Sequence>gi|22330039|ref|NP_683383.1| unknown protein; protein id:
At1g45196.1 [Arabidopsis thaliana]
MPSESSYKVHRPAKSGGSRRDSSPDSIIFTPESNLSLFSSASVSVDRCSSTSDAHDRDDSLISAWKEEFEVKKDDESQNLDSARSSFSVALRECQERRSRSEALAKKLDYQRTVSLDLSNVTSTSPRVVNVKRASVSTNKSSVFPSPGTPTYLHSMQKGWSSERVPLRSNGGRSPPNAGFLPLYSGRTVPSKWEDAERWIVSPLAKEGAARTSFGASHERRPKAKSGPLGPPGFAYYSLYSPAVPMVHGGNMGGLTASSPFSAGVLPETVSSRGSTTAAFPQRIDPSMARSVSIHGCSETLASSSQDDIHESMKDAATDAQAVSRRDMATQMSPEGSIRFSPERQCSFSPSSPSPLPISELLNAHSNRAEVKDLQVDEKVTVTRWSKKHRGLYHGNGSKM
• PredictProtein web server:– http://www.predictprotein.org
Department of Health Information Management
Read the Results
Department of Health Information Management
Evolutionary Methods• Taking into account related sequences helps in
identification of “structurally important”residues.
• Algorithm:– Find similar sequences
– Construct multiple alignment
– Use alignment profile for secondary structure prediction
• Additional information used for prediction– Mutation statistics
– Residue position in sequence
– Sequence length
Department of Health Information Management
Sequence Similarity Methods for Structure Prediction• These methods can be very accurate if there is
>50% sequence similarity
• They are rarely accurate if the sequence similarity <30%
• They use similar methods as used for sequence alignment such as the dynamic programming algorithm, hidden markov models, and clustering algorithms.