Post on 26-Jun-2020
Developmental Signaling by Noggin and Wntin the Frog Xenopus
By
John Joseph Young
A dissertation submitted in partial satisfaction of the
requirements for the degree of
Doctor of Philosophy
in
Molecular and Cell Biology
in the
Graduate Division
of the
University of California, Berkeley
Committee in charge:
Professor Richard M. Harland, ChairProfessor Sharon Amacher
Professor Michael S. LevineProfessor Michael Freeling
Spring 2013
Developmental Signaling by Noggin and Wnt in the Frog Xenopus
© 2013
By John Joseph Young
Abstract
Developmental Signaling by Noggin and Wntin the Frog Xenopus
By
John Joseph Young
University of California, Berkeley
Professor Richard M. Harland, Chair
Xenopus has provided a powerful system to study cellular, developmental, and neuro-biology. The availability of their embryos and the advent of modern molecular techniques allowed investigators to revisit the observations of classical embryologists and begin to determine the molecular mechanisms underlying germ layer formation and axis induction. My thesis work took advantage of the frog Xenopus to first address the developmental role of Noggin, a Bone morphogenic protein (Bmp) antagonist, and then to determine the mechanism of Wnt-induced anterior-posterior patterning of the neural plate.
The frog Xenopus, an important research organism in cell and developmental biology, currently lacks tools for targeted mutagenesis. In the first part of this work, I address this problem by genome editing with zinc finger nucleases (ZFNs). ZFNs directed against an eGFP transgene in X. tropicalis induced mutations that are consistent with results of non homologous end joining at the target site, resulting in mosaic loss of fluorescence phenotype at high frequencies. ZFNs directed against the noggin gene produced tadpoles and adult animals carrying up to 47% disrupted alleles. Founder animals yielded progeny that carry insertions and deletions in the noggin gene with no indication of off-target effects. Furthermore, functional tests demonstrated an allelic series of activity among three germline mutant alleles. Breeding an identified null allele to homozygosity resulted in tadpoles with deformaties in the cranial skeleton. Anatomical analysis revealed severe reductions in Meckel’s cartilage with joint fusions. Gene expression analysis via in situ hybridization for chondrogenesis regulating factors in noggin mutants revealed a reduction in sox9 and col2a expression domains. Analysis of Bmp targets showed an expansion of hand2, edn1, and msx2 in the pharygeal arches (PAs) of mutants. This suggested a mechanism whereby incresed Bmp signaling inhibits chondrogenesis and ventralizes the PAs resulting in the jaw deformities observed in mutants.
Neural development in amphibians occurs as a two-step process. First, ectodermal precursors adopt a neural fate in the absence of Bmp signaling. A second signal is then required to pattern the anterior posterior neuraxis. Signaling through Fibroblast growth factor (Fgf), retinoic acid (RA), and Wnt have each been demonstrated to be both necessary and sufficient for inducing
1
posterior fates in undifferentiated neural tissue. Wnt signaling in particular has been closely studied. However, the mechanism by which this pathway induces posterior fates remains unclear. To address this question, I used RNA-Seq to identify direct transcriptional targets in neural tissue by activating Wnt signaling in Xenopus neural explants pretreated with the translation inhibitor cycloheximide. Wnt-activated neural tissue resulted in over 200 genes with expression increased greater than 2-fold when compared to anterior neural tissue. in situ hybridization analysis of highly expressed transcription factors and RNA-binding proteins showed posterior expression. Of particular interest, the transcription factor sal-like 1 (Sall1) and sal-like 4 (Sall4) showed specific posterior neural expression suggesting a role in Wnt-induced neural patterning.
The RNA-Seq screen found sall1 and sall4 expression to be induced by canonical Wnt signaling sall4 were
enriched in β-catenin chromatin imunoprecipitations. Knockdown of Sall4 resulted in the loss of spinal cord marker expression and an increase in the expression of pou25, pou60 and pou91 (pouV genes), the three Xenopus homologs of the stem cell factor pou5f1/Oct4. Overexpression of the pouV genes resulted in the loss of spinal cord identity, and knockdown of pouV function restored spinal cord marker expression in Sall4 morphants. Finally, knockdown of Sall4 blocked the posteriorizing effects of Fgf and retinoic acid signaling in the neurectoderm. These results suggest that Sall4, activated by Wnt signaling, represses the pouV genes to provide a permissive environment that allows for additional Wnt/Fgf/RA signals to posteriorize the neural plate.
2
To Nick Duesbery, Ph.D and Jeff McKelvey, Ph.D.
I’m grateful to have been your student, proud to be your colleague, and most of all, honored to be your friend.
i
Table of Contents
Table of Contents......................................................................................................................ii
Table of Figures........................................................................................................................iv
Acknowledgements..................................................................................................................vi
Chapter 1: General Introduction.............................................................................................1
Classical Embryology.....................................................................................................1
The Molecular Era and Xenopus.....................................................................................2
Open questions................................................................................................................8
Goals of this thesis..........................................................................................................9
Chapter 2: Materials and Methods.........................................................................................11
Embryo and explant culture............................................................................................11
RNA and morpholino microinjections............................................................................11
Western Blotting.............................................................................................................12
Celery Extract Preparation..............................................................................................12
Mutation Detection by Celery Extract............................................................................12
Cartilage staining............................................................................................................13
Cycloheximide and dexamethasone treatments..............................................................13
Whole-mount in situ hybridization.................................................................................13
Embedding and Sectioning.............................................................................................14
RT-PCR and qPCR..........................................................................................................14
RNA-seq..........................................................................................................................14
ii
Chromatin immunoprecipitation...................................................................................14
Chapter 3: Analysis of the developmental role of noggin in Xenopus tropicalis development via Zinc-Finger Nuclease mutagenesis...........................................................16
Introduction...................................................................................................................16
Results...........................................................................................................................17
Discussion.....................................................................................................................21
Chapter 4: Expression screen for direct targets of Wnt signaling in neural tissue.............................................................................................................................46
Introduction...................................................................................................................46
Results and Discussion..................................................................................................47
Chapter 5: Spalt-like 4 mediates Wnt-induced neural patterning via repression of pouV/Oct4 family members..................................................................................................................68
Introduction................................................................................................................................68
Results........................................................................................................................................69
Discussion...................................................................................................................................73
References...............................................................................................................................................97
Appendices.............................................................................................................................................118
I: RNA-Seq results from Chapter 3: Genes with >2-fold expression (direct Wnt activation vs. anterior neural)..................................................118
II: List of PCR primers used in this work.....................................................................128
III: List of DNA plasmids used in this work................................................................131
iii
List of Figures
Figure 3.1: Disruption of the eGFP transgene in Xenopus tropicalis using ZFNs.....................24
Figure 3.2: Tolerance and activity of ZFNs targeting noggin in Xenopus tropicalis.................26
Figure 3.3: ZFN-driven editing of the noggin locus in Xenopus tropicalis...............................28
Figure 3.4: ZFNs induce heritable loss-of-function noggin alleles mutations...........................30
Figure 3.5: Knockdown of Chordin and Follistatin results in a loss of dorsal structures in a subset of embryos produced by heterozygous noggin mutant adults..................32
Figure 3.6: Stage series of representative embryos produced by heterozygous noggin mutant adults.............................................................................................34
Figure 3.7: Homozygous noggin mutant Xenopus tropicalis have severe lower jaw deformities..................................................................................................................36
Figure 3.8: Expression of chondrogenic factors in wild-type and noggin mutant tadpoles............................................................................................................................38
Figure 3.9: Expression of Bmp pathway targets in wild-type and noggin mutant tadpoles............................................................................................................................40
Figure 4.1: Model of Wnt-induced patterning of the neural anterior-posterior axis...............................................................................................................................................52
Figure 4.2: Temporal expression of anterior posterior neural markers in Xenopus tropicalis........................................................................................................................54
Figure 4.3: TVGR activates canonical Wnt-signaling................................................................56
Figure 4.4: TVGR efficiently posteriorizes neuralized ectodermal explants..............................58
Figure 4.5: Cycloheximide treatment prior to TVGR induction enriches for direct Wnt targets in neuralized ectodermal explants...................................................................60
Figure 4.6: Expression patterns of transcription factors identified in the screen for direct Wnt targets..........................................................................................................................62
Figure 4.7: Expression patterns of RNA-binding factors identified in the screen for
iv
direct Wnt targets..........................................................................................................................64
Figure 4.8: Expression patterns of identified Wnt targets prickle1 and lmo7.............................66
Figure 5.1: sall4 is a direct transcriptional target of canonical Wnt-signaling............................77
Figure 5.2: Injected embryos express functional FLAG-tagged β-catenin..................................79
Figure 5.3: sall4 is expressed in the neurectoderm......................................................................81
Figure 5.4: sall1 is directly activated by canonical Wnt signaling and expressed during early embryogenesis...........................................................................................................83
Figure 5.5: Loss of Sall4 results in a loss of posterior neural differentiation...............................85
Figure 5.6: cdx2 is directly activated by canonical Wnt signaling and not affected by Sall4 knockdown.........................................................................................................87
Figure 5.7: Knockdown of Sall4 causes an increase in expression of the pouV/Oct4 homologs.....................................................................................................................89
Figure 5.8: A second non-overlaping Sall4 morpholino results in similar phenotypes................91
Figure 5.9: Loss of spinal cord gene expression in Sall4 morphants requires an increase in pouV/Oct4 expression..................................................................................................93
Figure 5.9: FGF and retinoic acid signaling fail to posteriorize Sall4 morphants........................95
v
Acknowledgements
First off, I want to thank Nikki, I could not have done any of this without you. I’m so excited for our lives and all the adventures we’ll have together. Mom, you always said I could do this, especially when I didn’t think I could. Thank you, I’ll always remember Melinda Mae. Dad, thanks for all the encouragement and that great weekend of baseball, darts, and beer. Em, I’m so lucky to have you as my sister. I have to thank my grandmother June, the first frog biologist I ever knew. I love you all dearly.
My advisor Richard Harland, I knew I wanted to join your lab even before coming to Berkeley. You’ve been an excellent mentor; kept me from flying too high, but propped me up when I needed it. Thank you for giving me the freedom to explore my questions. I’m so proud to have been in your lab.
To the members of my committee: Sharon Amacher, Mike Levine, and Mike Freeling, thank you for your guidance, insight, and support.
I’m entirely grateful to the past members of the Harland lab crew: Andrea and James, I learned so much about how to be a scientist from you, also how to play MarioKart, thank you for the discussions and distractions. Mike, even if it can’t be Slayer, let’s take the Prius to another metal show. Sara, thank you for scaring me first and then becoming a great friend and colleague. Isa and Jen, I’m always ready for a beer lunch. My sincerest thanks to Jess, words truly fail here, I can’t imagine grad school without you.
To my current labmates: Debbie, the warm, comfortable environment of the lab is in no small part due to you. Thank you for making this an amazing place to work. Darwin, I’ll always think of you when I need someplace to store a box of tubes and Dave, we’ll get that pig next time. Caitlin and Sofia, you’re up next, I’m looking forward to hearing about all of your discoveries. Peter, a fellow PBR lover, I’m so glad I got to know you. Hyeyoung and Lisa, thank you for setting high standards for science in our lab. Stefanie, Cameron, and Rachel you’re part of the best lab in MCB, I know you’ll do amazing science.
I have been fortunate to work with some wonderful undergraduate students here at Berkeley. Gloria, Daniel, and Sofia, I have learned so much from you. Your futures are exciting and I wish you the best in your careers.
I want to thank my lifelong friends Jason and Jeff. You are my real life heroes, thank you for all of our times together, good and bad. You’ll always be my brothers.
Finally, I couldn’t have remained sane without Copsound: Brock, Justin, Dave, Alberto, Josh, Blair and Mike. Thank you for giving me the opportunity to rock with you guys. Your creativity and energy inspired me both in lab and at the space.
vi
CHAPTER 1
General Introduction Classical Embryology
How an animal develops from a fertilized egg to a recognizable multicellular organism is a fundamental question in developmental biology. This question has intrigued countless biologists for thousands of years prompting many theories, both ingenious and ridiculous. Aristotle first used the term epigenesis to describe chick development as a series of steps whereby structures progressively induce the formation of other structures, ultimately giving rise to a complex organism with multiple cell types and tissues. While this seems like basic knowledge in modern times, his interpretations were swept aside in favor of the creationism-friendly preformationist idea that tiny humunculi are present in the germ cells. Battles raged between the ovists and spermists as to which gamete truly contained the humunculus until the mid 19th century when Schleiden and Schwann’s theory that the fertilized egg formed a cell that through division gave rise to all the cells in the body began to gain acceptance. Today, the combined theories of Aristotle and Schleiden and Schwann form the core of modern developmental biology. Every embryo contains the intrinsic information to build itself from within via cell division and epigenesis, however the question remains, how?
Embryonic induction, where a specific tissue or cell(s) induces the fate of a different tissue or group of cells, provides a general mechanism for epigenesis as described by Aristotle. The experiments of Hans Spemann and Warren Lewis demonstrated the first embryonic induction when they found that grafting an optic cup from a frog embyo to an ectopic location was sufficient to induce lens formation in the overlying epidermis (Spemann, 1901) (Lewis, 1904). Spemann then turned his attention from specific organ development to axis formation by grafting pieces of gastrulae embryos to ectopic locations in host embryos. Spemann made his greatest discovery when Hilde Mangold, a student in his lab, grafted the dorsal lip from a gastrula of the lightly colored newt Triturus cristatus to the ventral region in a gastrula of the darkly pigmented newt Triturus taeniatus. This graft generated an ectopic axis but the important discovery here was that the secondary axis was comprised of a lightly pigmented notochord and floorplate and darkly pigmented somites and neural tube. The darkly pigmented cells must have come from the host and they made the conclusion that the grafted tissue induced the surrounding host tissue to adopt a dorsal fate rather than a ventral one (Spemann and Mangold, 1924). This result prompted the idea of regional specification where cells in the dorsal lip of the gastrula, known as the organizer, specify the fates of other cells in the region (Spemann, 1938).
The discovery of mesendodermal tissue that induce surrounding cells to adopt alternate fates was not limited to amphibians. Waddington’s discovery that transplantation of Hensen’s node from chicks would induce ectopic neural tissue in host ectoderm showed this structure to be the avian equivalent of Spemann’s organizer (Waddington, 1932; Waddington, 1933). The shield in teleosts (Oppenheimer, 1936), and finally the node in mammals (Beddington, 1994) were also found to
1
be capable of patterning surrounding tissue during gastrulation. These discoveries provided great insight into how an embryo generates its pattern but they opened several more questions about how these structures are themselves induced and how they exert their effects on neighboring tissue.
Pieter Nieuwkoop’s discovery that ectoderm will change fate and give rise to mesodermal derivatives when placed next to endoderm provided insight on how the embryo generates the different germ layers (Nieuwkoop 1969). Furthermore, he noticed that the induced mesodermal derivatives were different depending on the dorsal/ventral nature of the endoderm with which the ectoderm was combined. Ventral endoderm induced blood and smooth muscle fates whereas dorsal endoderm was capable of inducing nearly all tissues in the embryo (Nieuwkoop 1969) (Boterenbrood 1973) (Dale and Slack, 1987). This observation led to the discovery of the so-called Nieuwkoop center, a portion of the dorsal endoderm that induces formation of the organizer. Transplantation of the dorsal-most endodermal cells at the 64-cell stage from embryos of the frog Xenopus laevis to the ventral side of irradiated embryos rescued axial structures in what would otherwise develop into a ball of ventral tissue known as a “belly piece” (Gimlich and Gerhart, 1984). Despite these incredible advances, the field of developmental biology would have to wait for the molecular era before the precise mechanisms of cell specification and embryonic inductions could be determined.
The Molecular Era and Xenopus The field of experimental embryology was revolutionized by the adoption of the South African Clawed Frog Xenopus laevis as a model system. In the early 20th century, the discovery that injection of a pregnant female’s urine into the dorsal lymph sac of Xenopus induced ovulation provided a robust and reliable test for pregnancy (Crew, 1939). This resulted in the export and housing of these frogs in medical institutions worldwide (Gurdon and Hopwood, 2000). The byproduct of this discovery was that amphibian eggs and therefore embryos could be made available year round and in great numbers. Researchers no longer had to wait for the breeding season to obtain their often limited experimental material. The availability of embryos and the advent of modern molecular techniques allowed investigators to revisit the observations of classical embryologists and begin to determine the molecular mechanisms underlying germ layer formation and axis induction.
In amphibians, the endoderm forms mostly in the vegetal region, the mesoderm forms in the marginal zone and the ectoderm comes from the animal region. Nieuwkoop’s experiments suggested that factors from the endoderm induce the overlying ectoderm to adopt a mesendodermal fate. Basic Fibroblast growth factor (bFgf) was identified as having weak mesoderm inducing activity that was enhanced when combined with Transforming Growth Factor-β (TGFβ) (Kimelman and Kirschner, 1987) (Slack et al., 1987). It was found that a pellet of Xenopus tissue culture cells had the same mesoderm inducing properties as dissected endoderm on ectodermal explants (animal caps) (Smith, 1987). This led to the discovery that the TGFβ family member ActivinA was a potent mesoderm inducer. Treatment of animal caps with
2
ActivinA alone was sufficient to induce mesodermal differentiation (Smith et al., 1990). Furthermore, increasing doses of ActivinA resulted in more dorso-anterior characteristics of the induced mesoderm (Green and Smith, 1990). While Fgf and ActivinA were demonstrated to induce mesoderm in animal caps, it’s more likely that the Xenopus nodal-related (Xnr) factors signaling through Smad2 are the molecules that induce mesoderm in the frog embryo. The Xnrs are expressed in the marginal zone and overexpression of a Nodal-specific version of the inhibitor Cerberus, Cerberus-short, blocks mesendoderm formation in embryos (Agius et al., 2000; Joseph and Melton, 1997; Kessler and Melton, 1995; Piccolo et al., 1999). Nodal induction of mesoderm is not limited to amphibians. The most direct evidence that Nodal signaling induces mesendoderm in vertebrates was provided by forward genetic screens in the zebrafish Danio rerio. Mutations in cyclops, squint and one-eyed pinhead, genes which encode the nodal homologs and their receptor, result in a failure of mesendoderm and organizer formation and can be rescued by injection of these factors(Feldman et al., 1998; Gritsman et al., 1999). In both the chick and the mouse, Nodals induce mesoderm and their antagonist Lefty restricts signaling to prevent multiple primitive streak formation (Bertocchini and Stern, 2002; Conlon et al., 1994; Perea-Gomez et al., 2002; Skromne and Stern, 2001; Skromne and Stern, 2002; Zhou et al., 1993).
Nodal secretion alone from the endoderm, however, does not explain the induction of the organizer. While high doses of ActivinA were able to induce dorsal mesoderm, this was not likely the mechanism employed by the embryo. The organizer is comprised of cells that will give rise to the notochord and head mesoderm in amphibians. Nodal signaling, while required for mesoderm induction, is necessary for organizer formation but not sufficient. Therefore, a dorsal modifying signal was proposed to be present in the embryo that would give the mesoderm induced in the presumptive dorsal region the inductive activity of the organizer. Strong evidence that this signal is mediated by Wnt signaling was provided when expression of Wnt8 on the future ventral side of the Xenopus embryo was able to induce a second axis (Smith and Harland, 1991; Sokol et al., 1991). Lineage tracing the injected cells revealed cells that inherited the wnt RNA comprised the notochord, pharyngeal tissue, and portions of the somites, reminiscent of dorsal lip grafts done with different newt species by Spemann and Mangold (Spemann and Mangold, 1924). Activation of the Wnt pathway results in the nuclear accumulation of β-catenin which complexes with T-cell factor/Lymphocte enhancer factor (TCF/LEF) to activate transcription of target genes, reviewed in (Logan and Nusse, 2004). Depletion of the maternal pool of β-catenin transcripts resulted in embryos that lacked dorsal derivatives of the mesoderm and ectoderm (Heasman et al., 1994; Wylie et al., 1996). Several wnt transcripts are maternally deposited including wnt8b (Cui et al., 1995), wnt5a (Moon et al., 1993), and wnt11 (Ku and Melton, 1993). Through the movements driven by cortical rotation, these molecules, initially located at the vegetal pole of the egg, get displaced to the presumptive dorsal side during the first cell cycle of the zygote. Similar to β-catenin-depleted embryos, depletion of wnt11 from oocytes prior to fertilization resulted in embryos lacking dorsal structures (Heasman et al., 2000; Tao et al., 2005). These results showed that Wnt signaling is the dorsal modifying signal in the embryo . Recently, it has been proposed that maternally-provided wnt8 is necessary for organizer induction in zebrafish (Lu et al., 2011).
3
The combined action of Wnt and Nodal signaling on the presumptive dorsal side is responsible for the Nieuwkoop center’s inductive activity in the blastula. These signaling pathways lead to activation of specific transcription factors and signaling molecules whose expression domain will come to define the organizer. At the blastula stage of Xenopus embryos, there is a gradient of activated Smad2 that begins on the dorsal side and spreads ventrally (Lee et al., 2001). This initial burst of Smad2 signaling on the dorsal side is the result of the early Wnt signal cooperating with maternally-provided VegT. xnr3 is directly activated by Wnt/β-catenin (McKendry et al., 1997) and stabilized maternal β-catenin on the dorsal side serves to prime the promoters of xnr3,5, and 6 for activation via recruitment of Histone Methyltranferases (Blythe et al., 2010). The combined activity of Wnts and Nodals on the future dorsal side serve to activate organizer specific transcription factors in the dorsal mesoderm. The 5’ region of the paired-like homeobox gene siamois (sia) contains a proximal element with TCF/LEF binding sites and the closely related gene twin also has a distal element that is regulated by Smad2 (Houston et al., 2002; Laurent et al., 1997; Nishita et al., 2000). Signaling by Wnt and Nodal synergistically activates twin expression in the organizer only on the dorsal side(Nishita et al., 2000). Similarly, the homeobox gene goosecoid (gsc) has a proximal region with TCF/LEF binding sites that is also bound by Twin, which serves to mediate gsc expression in response to the Wnt signal (Laurent et al., 1997). A distal enhancer with Smad2 binding elements also mediates gsc expression but requires cooperative binding with members of the Mixer homeodomain family of transcription factors (Germain et al., 2000). Bmp, however, restricts gsc to the dorsal mesoderm; injection of noggin RNA into ventral mesoderm results in a broader gsc expression domain (Eimon and Harland, 1999). Expression of gsc or sia on the ventral side of embryos results in the induction of an ectopic organizer and the generation of twinned embryos (Cho et al., 1991; Lemaire et al., 1995).
While the identification of organizer-specific transcription factors led to an understanding of how the organizer is specified, it was the discovery of secreted molecules from this specialized group of cells that provided the mechanism for axis induction observed by Spemann and Mangold in their grafting experiments. Through expression screens using cDNA libraries constructed either from dissected organizers or whole embryos treated with a dorsalizing agent such as LiCl, several secreted factors were found to have organizer-like activity. The first such factor to be discovered was noggin. It is normally expressed in the organizer and when expressed in UV-ventralized embryos, was capable of fully rescuing anterodorsal structures (Smith and Harland, 1992; Smith et al., 1993). Furthermore, treatment of animal caps with Noggin protein was sufficient to induce a neural fate (Lamb et al., 1993). Within a short time, other molecules with the same neural inducing activity were cloned including chordin (Sasai et al., 1994) and follistatin (Hemmati-Brivanlou et al., 1994). These factors bind to and inhibit Bmps (Zimmerman et al., 1996). Upon this discovery, Piccolo (Piccolo et al., 1996) suggested a mechanism for organizer function whereby the organizer cells which give rise to the head mesoderm and the notochord secrete Bmp antagonists to inhibit Bmp signaling in nearby tissue. From these experiments, and earlier ones where the Activin receptor was inhibited (Hemmati-Brivanlou and Melton, 1994), the default model for neural induction was proposed, stating that
4
ectoderm will adopt a neural (dorsal) fate in the absence of any inducing signal (Hemmati-Brivanlou and Melton, 1997). Consistent with this model, genetic knockouts of noggin and chordin result in mice lacking dorsoanterior-most structures however, they still retain neural tissue(Bachiller et al., 2000). This result suggested that there are other Bmp antagonists that function redundantly to induce neural tissue. Knockdown of three Bmp antagonists in Xenopus tropicalis resulted in a complete loss of dorsal structures and yielded fully ventralized embryos (Khokha et al., 2005). The presence of several Bmp antagonists that act redundantly in the early embryo has made assessing their individual role challenging.
There is strong evidence for the default model. In vitro culture of excised animal caps results in the adoption of an epidermal fate, however dissociation and reaggregation of caps result in a neural fate (Godsave and Slack, 1989; Grunz and Tacke, 1989; Sato and Sargent, 1989). Neural induction following dissociation can be blocked by adding Bmp to the culture medium (Wilson and Hemmati-Brivanlou, 1995). These studies provided a model where Bmp signaling through the Smad1/5/8 transcription factors serve to induce ventral fates while cells with low Bmp adopt dorsal fates. The key experiment that supported this model was performed when a truncated form of the activin receptor (which acted as a dominant negative for Bmp signaling) was expressed in animal caps and neural tissue was induced (Hemmati-Brivanlou and Melton, 1992). Taken together, these experiments support the interpretation that neural tissue is “induced” by the removal of Bmp and is thereby the default differentiation pathway of the ectodermal precursors. The default model can be applied to the other germ layers. Bmp signaling induces ventral fates: blood, body wall muscle and hindgut in the mesoderm and endoderm, respectively. Dorsal fates such as the somites and pharyngeal endoderm are induced when Bmp is blocked (Harland’s chapter in (Stern, 2004). If one were to carry this model to a logical conclusion, then depletion of the mesoderm and endoderm inducer along with Bmp inhibition would result in the entire embryo adopting a neural fate . This intriguing hypothesis awaits experimental testing.
Despite broad acceptance of the default model for neural induction, some challenges have arisen to the interpretation that Bmp inhibition alone is sufficient to induce ectoderm to adopt neural fates. Injection of a dominant negative Fgf receptor blocked the neural inducing activities of Noggin and Chordin which prompted the hypothesis that Fgf signaling is required for neural induction (Launay et al., 1996; Sasai et al., 1996). The finding that simply cutting the animal cap leads to activation of MAPK, the transducer of Fgf, called into question the interpretation of experiments where animal caps were treated with BMP antagonists (LaBonne and Whitman, 1997). Furthermore, inhibition of Smad1 also required Fgf signaling to induce neural fates in ventral epidermis (Delaune et al., 2005). This however, is due to the activity of Smad2, as inhibition of Smad1 and Smad2 is sufficient to induce neural fates ventrally (Chang and Harland, 2007). An alternative explanation could be that Fgf-mediated activation of MAPK results in phosphorylation of the linker region of SMAD1 causing its export from the nucleus and down regulation of Bmp signaling (Fuentealba et al., 2007). Recently, it was proposed that the animal cap is unsuitable for neural induction studies because of a pre-pattern imposed by other inductive signals (Linker et al., 2009). This is unlikely to be the case, animal caps will form neural tissue in the presence of a small molecule Fgf inhibitor when treated with a Bmp antagonist (Wills et
5
al., 2010). The source of the discrepancy is likely due to the use of sox2 as a marker for neural tissue differentiation. While differentiated neural cells express sox2, a population of uncommitted stem cells also express sox2 which revert to epidermis in the absence of Fgf (Wills et al., 2010).
In addition to the Bmp antagonists, screens also identified secreted Wnt antagonists expressed in a subset of organizer cells that give rise to the head mesoderm (Niehrs, 2004). The inhibitor Dickkopf (Dkk), which blocks Wnt signaling by binding to the Wnt co-receptor Lrp5/6 and thus preventing signal transduction (Semënov et al., 2001) is expressed in a subset of organizer cells (Glinka et al., 1998). Overexpression of Dkk results in enlarged heads and reduced trunks whereas loss-of-function experiments showed Dkk to be required for anterior neural development (Glinka et al., 1998; Mukhopadhyay et al., 2001). Similarly, ectopic expression of the Frizzled-related protein, Frzb induced anterior structures by binding to Wnt8 and preventing it from binding to its receptors Lrp5/6 and Frizzled (Wang et al., 1997). Several additional secreted Frizzled-related proteins were discovered in a screen for secreted proteins produced by the organizer (Pera and De Robertis, 2000). As expected, these factors result in enlarged anterior structures when overexpressed. The identification of the head inducer Cerberus as an inhibitor of Wnts, Bmps, and Nodals (Piccolo et al., 1999) led to a model of axis induction by the organizer where the Bmp antagonists induce a dorsal fate via repression of Bmp signaling and the anterior is induced by inhibition of Wnt, Bmp, and Nodal signaling (reviewed in (Niehrs, 2004). The inactivation of the repressor Tcf3 in zebrafish headless mutants further provided genetic evidence that Wnt inhibition is required for head formation (Kim et al., 2000).
The default model, now supported by molecular evidence, is not completely novel. Johannes Holtfreter and Pieter Nieuwkoop predicted that neural patterning was a two-step process whereby the ectodermal precursors are first activated to adopt a neural fate (by default anterior in nature), and then additional signals from the mesoderm posteriorize it to create the full anterior-posterior (A-P) pattern of the neural plate (HOLTFRETER, 1947; Nieuwkoop, 1952;
Xenopus
receptor results in anteriorized Xenopus
6
posterior fates. By using hox
resulted in ectopic hoxb1 and a loss of krox-20 in
Raldh mutant mice, and the raldh2 neckless can all be rescued by a uniform concentration of
gradient not by simple diffusion but by degradation anteriorly by the Cyp26 proteins.
increasingly more posterior neural markers with increasing doses of bFgf (Kengaku and
hoxb912 caps only induces the more anterior gene enrailed2 (Lamb and Harland, 1995). This result is consistent with a model where the posterior neurectoderm is in contact with the Fgf source early in gastrulation and diffusion of the ligand reaches more anterior regions as the process of
This source/sink mechanism generates a gradient that in combination with the competence of
Xenopus
Finally, Wnt/β-catenin signaling is the third transforming factor involved in posterior patterning of the neural plate. Activation of this pathway during gastrulation represses anterior development in contrast to its role of inducing the dorsoanterior axis in the early embryo. Animal caps expressed hoxb9 (spinal cord) and krox20 (hindbrain) following treatment with both Noggin and Wnt3a (McGrew et al., 1995). Introducing graded amounts of Dishevelled to neuralized animal caps resulted in increasingly more posterior fates which suggested that graded Wnt-signaling patterns the neural plate (Itoh and Sokol, 1997). Additional evidence to support that a morphogen gradient of Wnt serves to pattern the neural plate emerged when overexpressing the Wnt inhibitor Dkk in Xenopus embryos resulted in an expansion of the anteriorly expressed genes bf-1 and otx2 and a posterior shift of krox20. Conversely, increasing
7
Wnt concentration results in the opposite phenotype: an anterior shift of krox20 and a repression of anterior neural gene expression (Kiecker and Niehrs, 2001). Consistent with a graded level of Wnt signaling in the neural plate, Kiecker and Niehrs (Kiecker and Niehrs, 2001) observed an anterior-to-posterior gradient of nuclearly localized β-catenin in the neural plate of a gastrula staged embryo. Several lines of evidence point to Wnts coming form the underlying paraxial mesoderm to posteriorize the neural plate. In zebrafish, Wnt8 is expressed in the paraxial mesoderm and knockdown results in a loss of posterior neural gene expression (Erter et al., 2001; Lekven et al., 2001). Wnt3a in the dorsal paraxial mesoderm of Xenopus directly activates meis3 in the hindbrain (Elkouby et al., 2010). Ultimately, knockout studies in mice provide genetic evidence for Wnt-signaling in A-P patterning. Mice express wnt3a and wnt5a in the paraxial mesoderm and mutants lack posterior structures (Greco et al., 1996; Yamaguchi et al., 1999). Knockout of the Wnt antagonist dkk1 results in mouse embryos that lack forebrains (Mukhopadhyay et al., 2001) while genetically increasing β-catenin in the forebrain results in transformation to more posterior fates (Paek et al., 2012).
The above experiments suggested that Wnt acts as a classical morphogen to pattern the A-P axis of the neural plate. While this may indeed be the case, visualization of a graded Wnt ligand has not been reported. Furthermore, several findings have suggested that the ligand is poorly soluble. Biologically active Wnt3a requires glycosylation and palmitoylation (Komekado et al., 2007; Takada et al., 2006; Willert et al., 2003), post-translational modifications that make it hydrophobic. While co-expression with Wnt antagonists results in greater diffusion of the Wnt ligand in Xenopus (Mii and Taira, 2009), the different expression domains of these antagonists suggest that the function of Wnt antagonists is unlikely to resolve the paradox of how an insoluble protein can have long range effects. The duration of Wnt-signaling as apposed to the concentration of the ligand provides an alternative explanation to a morphogen gradient of Wnt patterning the amphibian neural plate. The more posterior regions stay in contact with the Wnt source for longer periods during gastrulation than anterior or medial regions. Certainly a uniform concentration of ligand signaling for different durations can have variable outcomes. Premature inactivation of Sonic Hedgehog (Shh) signaling in the zone of of polarizing activity (ZPA) results in a loss of posterior fates in the autopods of mice (Harfe et al., 2004). The Australian two-toed skink expresses Shh in the ZPA for a shorter duration than its five-toed relative (Shapiro et al., 2003). Therefore, it is possible that uniform doses of Wnt applied to neurectoderm for different durations may elicit a full repertoire of anterior and posterior markers. While this has yet to be carefully tested, it remains an intriguing possibility.
Open questions
Several questions of neural patterning remain unanswered. The lack of reverse genetic mutagenesis techniques has confounded the study of noggin in amphibian development. Loss-of-function studies were restricted to the use of morpholino oligonucleotides (MOs) that, while effective in protein knockdown, are transient and not useful for examining later phenotypes. MO knockdown of Noggin in Xenopus does not result in abnormal phenotypes while noggin mutant mice have severe neural and skeletal deformities (Brunet et al., 1998; McMahon et al., 1998).
8
Either noggin is dispensable in amphibian development or current methods are not sensitive enough to determine a role for this gene. The controversy over Bmp antagonist and neural induction has cooled in recent years, however the contribution of individual Bmp antagonists in amphibian development remains unanswered. The development of targeted mutagenesis techniques via zinc-finger nucleases, TALENs, and CRISPR presents an opportunity to mutate these genes and study their roles using genetic nulls.
The identification of Wnt, Fgf, and RA signaling as posteriorizers of the neural plate opens a series of questions. What are the targets of these pathways and how are these targets regulated? A handful of target genes have been identified, but there is yet no clear consensus on how graded levels of these morphogens elicit specific expression domains of their targets. A thorough understanding of the response elements that mediate expression will give insight to the mechanisms of A-P patterning. Modern methods such as RNA- and ChIP-seq, combined with the classical embryology techniques offered by Xenopus, make this organism an excellent model for probing these questions.
Xenopus has proven to be an important model for developmental biology. Its large embryos are well-suited for “cut and paste” experiments which provided some of the first demonstrations of embryonic inductions. Expression screens and the identification of organizer-specific genes made Xenopus extremely useful at the advent of modern molecular biology. With the dawn of the genomics age, this genus continues to be a powerful system for understanding gene function in development. The complete sequencing of the West African species Xenopus tropicalis provided the first genome of an amphibian (Hellsten et al., 2010). This brought Xenopus tropicalis into the genomics era and made whole-genome experiments possible. The recent sequencing and assembly of the Xenopus laevis genome will provide the frog community as well as the developmental biology community at large with powerful tools to uncover developmental mechanisms and address these unanswered questions.
Summary of this thesis
The work in my thesis took advantage of both the classical embryology and genomic resources offered by Xenopus. My goals were two-fold: (1) to establish reverse genetic strategies in the frog at two proof-of-principle loci, including one implicated in embryo dorsalization and (2) to utilize state-of-the art genomic approaches to investigate the role of Wnt in neural posteriorization. I was fortunate to collaborate with the biotechnology company Sangamo BioSciences that specializes in zinc-finger nuclease (ZFN) and TALEN design to induce mutagenic DNA double-strand breaks at specific loci in a genome. I used this technology to first demonstrate the efficacy by inactivating a Green Fluorescent Protein transgene. Next, I used ZFNs designed to target the noggin locus. It’s well known that Noggin is sufficient to dorsalize tissue, but evidence for its requirement in amphibian development was lacking. I was able to successfully mutate the locus and generate several lines of Xenopus tropicalis carrying noggin alleles with different levels of activity. Through breeding of a null allele to homozygosity, I
9
found noggin to be required for cranial skeletal development, specifically in the dorsoventral patterning of the pharyngeal arches.
Having demonstrated a role for noggin in dorsoventral patterning, I next turned to A-P patterning of the neural plate. As mentioned above, Wnt signaling is both necessary and sufficient to induce posterior fates in neural precursors, yet the mechanism remains poorly understood. I hypothesized that neural posteriorization via Wnt is mediated through transcriptional regulation of target genes. Therefore, it was necessary to identify genes directly regulated by this pathway. To that end, I carried out an expression screen using RNA-seq aimed at discovering genes that are directly activated by Wnt in the neural plate. This screen was successful; I found over 200 genes that were upregulated in response to Wnt. In situ hybridization analysis of selected genes showed a majority to be expressed in posterior regions of the embryo. Of particular note, two Spalt-like (Sall) transcription factor family members identified in the screen, sall1 and sall4, showed robust expression in posterior neural regions. The genes identified in this screen provide a basis for understanding the link between activation of the Wnt pathway and posterior patterning of the neural tube.
The final chapter of my thesis focuses on the function of Sall4, one of the Sall transcription factors identified in the screen for direct neural targets of Wnt. Sall4’s role in mammalian stem cell maintenance has been well documented but no role in A-P patterning has been described. I found that sall4 is specifically expressed in the neurectoderm and TCF/LEF sites found in the first intron of sall4 were enriched in β-catenin chromatin immunoprecipitations. Morpholino oligonucleotide knockdown of Sall4 resulted in a loss of spinal cord development and an upregulation of the pouV/Oct4 homologs. Ecotopic expression of pouV/Oct4 was sufficient to block neural posteriorization and reducing pouV/Oct4 in Sall4 morphants rescued spinal cord development. Finally, I found that Sall4 knockdown was epistatic to posteriorization by both Fgf and RA signaling. This data presented a novel model of Wnt-induced neural patterning whereby Wnt sends a permissive signal by activating sall4 in order to repress the pouV/Oct4 genes. The neural plate is then competent to respond to instructive signals from Wnt/Fgf/RA following the down-regulation of the pouV/Oct4 genes.
10
CHAPTER 2
Materials and Methods
Embryo and explant culture
Xenopus laevis embryos were collected, fertilized, and cultured according to (Sive et al., 2010) and staged according to (Nieuwkoop, 1967). Xenopus tropicalis embryos were collected from natural matings. To induce mating, female Xenopus tropicalis were injected with a priming dose
period. Ectodermal explants (animal caps) were cut using fine watchmaker’s forceps from stage 9 embryos and cultured in ¾ NAM.
RNA and morpholino microinjections
All ZFN plasmids were linearized by restriction enzyme digest to produce transcripts with (AscI) or without (NotI) in vitro with a
ZFN RNAs were microinjected into both blastomeres of two-cell staged Xenopus tropicalis
amounts injected. Embryos tend to orient animal pole uppermost, so injection penetrated the animal hemisphere, but mRNA was deposited near the center of the blastomere. Broad
noggin RNA was LacZ RNA and cultured in 1/3
Sall4 CS-108, Fgf8a CS-108, noggin CS-108, and β-catenin CS-108 were linearized with Asc1 and transcribed with a Sp6 mMessage mMachine kit (Ambion). The PouV genes (a gift from Joshua Brickman), TVGR (Darken and Wilson, 2001), and nuclear β-galactosidase CS2+ were linearized with Not1 and transcribed with Sp6. All RNAs were injected in either 5 or 10 ηL bursts along with GFP and β-galactosidase RNAs to serve as tracers.
All morpholinos were injected in either 5 or 10 ηL bursts along with fluorescein-labeled control morpholino (Gene Tools) to serve as a tracer. The Sall4 morpholino sequences are as follows: morpholino 1: 5’- GCCAATTATTCCCTTTCTCCACCAC-3’ and morpholino 2: 5’-GGTTCGGCTGCTTTCTCCTCGACAT-3’.
11
Western Blotting
Embryos were lysed in buffer containing 20 mM Tris pH 8.0, 50 mM NaCl, 2 mM EDTA, 1% Triton X-100 and freshly supplemented with
μL lysis buffer per embryo.
control.
Celery Extract Preparation for Cel-1 assays
(Apium graveolens var. dulce) were cut into 3-4 cm2 pieces and
μ
μ
μ
Mutation Detection by Cel-1 from Celery Extract
μL
® µg/ml proteinase K. Lysates were
μ
supernatant was decanted and the pellet allowed to air dry. Once dry, the pellet was resuspended
12
denatured and re-annealed by incubating at 94°C for 5 minutes followed by cooling at a rate of -2° ° °C/sec until the reaction reached 25°C, then incubated at
Cartilage staining
Tadpoles were fixed in 4% paraformaldehyde for 2-24 hours at room temperature in 4 mL vials. Paraformaldehyde was decanted and the embryos were suspended in a sterile filtered solution of acid/alcohol (70% ethanol and .37% HCl) containing 0.1% Alcian Blue. Vials were placed on a rotator and gently mixed for 6-12 hours at room temperature when staining of the cartilage elements becomes apparent. When staining was complete, the buffer was discarded and tadpoles were resuspended in the acid/alcohol solution without alcian blue and rotated for 20 minutes at room temperature. This was repeated until the solution no longer had any blue tint. Tadpoles were then rehydrated stepwise into water and then bleached in 1X SSC supplemented with 1.2% hydrogen peroxide and 5% formamide for 1-2 hours on a white-light table. Vial caps were removed to prevent excessive bubble formation. Following bleaching, tadpoles were resuspended in a 2% KOH solution and rotated for 1 hour. Stained tadpoles were cleared by successive 2 hour incubations in 2% KOH with increasing concentration of glycerol. Once cleared, tadpoles were either directly imaged or flat-mounted on a microscope slide by fine dissection and imaged.
Cycloheximide and dexamethasone treatments
Noggin RNA and an inducible Wnt agonist, TVGR RNA were injected animally into both blastomeres of two-cell embryos. Embryos were cultured until stage 9 when animal caps were excised and cultured with or without 10 µM dexamethasone (Sigma) to activate Wnt signaling. To block protein translation, animal caps were pre-treated with 5 µM cycloheximide (Sigma) for 1.5 hours prior to dexamethasone addition. Animal caps were cultured until the stage 15 equivalent and total RNA was harvested using Trizol (Invitrogen).
Whole-mount in situ hybridization
Embryos were stained after whole mount in situ hybridization as described in (Harland, 1991). β-galactosidase staining was carried out as described in (Fletcher et al., 2006).
13
Embedding and Sectioning
Embryos for sectioning were first equilibrated into a 30% sucrose solution and then transferred into a PBS solution containing 20% sucrose, 30% BSA, 4.9% gelatin. Embryos for sectioning were quickly transferred to fresh buffer supplemented with 1.5% glutaraldehyde and allowed to harden in peel-away plastic molds. Embedded embryos were cut to about a 0.5cm3 block with a razor blade and super-glued to an attack die from the game Heroscape®. Mounted embryos were sectioned on a Pelco 101 vibratome while submerged in PBS.
RT-PCR and qPCR
RNA was isolated from either whole embryos or animal caps using Trizol according to standard protocols and 1µg total RNA was reverse transcribed with either MMLV reverse transcriptase (Promega) or iScript (BIO-RAD) for semi-quantitative or qPCR, respectively. Semi-quantitative PCRs included trace amounts of 32P labelled dCTP (Perkin-Elmer) in the reaction and were analyzed during the log-phase of amplification. qPCR reactions were amplified on a CFX96 (BIO-RAD) light cycler. ernithine decarboxylase (ODC) and eukaryotic elongation factor-1a1 (eef1α1) were used for internal controls. All primers annealed at 60°C and are listed in appendix II.
RNA-seq
RNA-seq was performed according to standard protocols from Illumina as described in (Dichmann and Harland, 2012). mRNA was purified from 10 µg total using oligo-dT Dynabeads (Invitrogen) and fragmented using zinc ion fragmentation buffer (Ambion) for 1.5 minutes at 70°C. First strand synthesis was carried out according to standard protocols using Superscript II (Invitrogen) and second strand synthesis was performed using DNA polymerase I (NEB). cDNA fragment ends were repaired and ends were adenylated using Klenow, T4 DNA polymerase and T4 PNK (NEB). Adaptors (Illumina) were ligated using T4 Ligase and Quick Ligase buffer (NEB). AMPure XP beads (NEB) were used to select for fragments larger than 200 bp. The library was amplified with Phusion HF polymerase (NEB) and single-end 76-basepair reads were sequenced on an Illumina Genome Analyzer II. All reads were mapped to an index created from a collection of full-length Xenopus laevis mRNA sequences (http://xgc.nci.nih.gov) using TOPHAT and BOWTIE (Langmead et al., 2009; Trapnell et al., 2009). Analysis of transcript abundance differences was done using CUFFDIFF (Trapnell et al., 2010).
Chromatin immunoprecipitation
FLAG-β-catenin-injected embryos for immunoprecipitation were fixed in 1% formaldehyde/PBS for 1 hr, quenched with 0.125 M glycine/PBS for 15 minutes followed by three 10 minute washes in PBS. Lysis was performed according to (Blythe et al., 2009). Chromatin was sheared on ice using a Branson Model 450 digital sonifier with a Model 102C probe for 24 ten second bursts set at 30% amplitude. Immune complexes were pulled down using M2 FLAG antiboby
14
(Sigma) bound to anti-mouse magnetic beads (Invitrogen). Samples were washed, cross-links reversed and DNA isolated according to ChIP protocols (Blythe et al., 2009). ChIP DNA was quantified with SYBR-green PCR mix (BIO-RAD) on a CFX96 light cycler (BIO-RAD). Enrichment was calculated by comparing the %input between samples. Uninjected embryos served as a control for non-specific binding. xmlc2 (Blythe et al., 2009) and meis3 (Elkouby et al., 2010) served as negative and positive controls for β-catenin binding, respectively.
15
CHAPTER 3
Analysis of the developmental role of noggin in Xenopus tropicalis development via Zinc-Finger Nuclease mutagenesis
Introduction
Frogs of the genus Xenopus have been an important model organism for cell and developmental biologists since the 1930s (Gurdon and Hopwood, 2000). X. laevis is the standard model, but due to its allotetraploid genome, less suited for genetic approaches than the diploid X. tropicalis, whose genome sequence has been determined (Hellsten et al., 2010). Whereas embryological manipulations and gain-of-function experiments are major strengths of Xenopus, reverse genetics are currently limited to the use of antisense reagents that provide transient and often incomplete gene knock down (Eisen and Smith, 2008). The ability to introduce targeted, heritable mutations that disrupt gene function has remained elusive.
This work provides a generally applicable solution to this problem: targeted gene disruption with designed zinc finger nucleases (ZFNs). ZFNs are the fusion of the non-specific cleavage domain of the Type IIS restriction enzyme FokI to a zinc-finger protein (Miller et al., 1985; Pavletich and Pabo, 1991) that is engineered to bind a specific genomic locus in order to induce a targeted double-strand break (DSB). Pioneering studies in oocytes of X. laevis (Bibikova et al., 2001) and subsequent work in Drosophila (Bibikova et al., 2002) showed the mutagenic potential of a DSB induced by ZFNs (reviewed in ref (Carroll, 2008; Urnov et al., 2010)). Resolution of ZFN-induced DSBs via non-homologous end joining (NHEJ) generates small insertions and deletions which often produce null or hypomorphic alleles (Bibikova et al., 2002; Perez et al., 2008; Santiago et al., 2008).
The Bone morphogenic protein (Bmp) antagonist noggin is expressed in Spemann’s organizer and is a potent dorsalizing factor (Smith and Harland, 1992; Zimmerman et al., 1996). Together with two other Bmp antagonists, Chordin and Follistatin, it serves to dorsalize the ectoderm and mesoderm to give rise to neural and somitic derivatives, respectively (Khokha et al., 2005). Targeted deletion of the noggin locus in mice results in perinatal lethality, spina bifida, and skeletal deformities (Brunet et al., 1998; McMahon et al., 1998). However, antisense morpholino oligonucletide (MO) knockdown of Noggin in Xenopus does not yield a phenotype. Whether this is due to incomplete knockdown or a role for Noggin beyond the effective window of MO activity remains unknown. Genetic inactivation of the locus is required to effectively assay the function of Noggin in amphibian development, a method previously restricted to non-specific, forward genetic screens and laborious mapping efforts.
I developed an effective protocol for gene disruption in X. tropicalis. Using ZFNs designed against a reporter transgene and the noggin locus, the delivery and expression conditions for ZFNs were optimized which resulted in high frequencies of somatic and germline mutations that
16
were transmissible to the next generation. Furthermore, ZFN induced mutations in noggin were bred to homozygosity which yielded an unexpected phenotype.
Results
Xenopus eggs are large and easily manipulated (Sive et al., 2010), offering the opportunity to deliver ZFNs via injection of mRNA, a method that has been successful in driving ZFN-induced gene disruption in other organisms (Carroll, 2008; Urnov et al., 2010).
To develop conditions for gene disruption in Xenopus tropicalis, transgenic animals carrying a single-copy GFP transgene were used(Hamlet et al., 2006). Wild type X. tropicalis eggs were fertilized with sperm from a homozygous GFP transgenic male. The resulting heterozygous embryos were injected with mRNA encoding ZFNs that target the eGFP coding region (Geurts et al., 2009). Uninjected tadpoles express GFP robustly in the somites, lens, and head musculature (Figure 3.1 A-C). Injection of 20 pg eGFP ZFN RNAs led to mosaic loss of fluorescence in otherwise healthy tadpoles (Figure 3.1 D-F). At a higher dose of ZFNs, most cells had lost fluorescence, suggesting efficient somatic mutation of the transgene (Figure 3.1 G-I).
To determine whether loss of fluorescence resulted from a ZFN-induced mutation in the eGFP transgene, the target locus was genotyped using an assay based on the mismatch-sensitive endonuclease, Cel-1 (Miller et al., 2007). This analysis (Figure 3.1 J) demonstrated that ZFN-treated, but not control, tadpoles had acquired a DNA sequence alteration in the stretch targeted by the ZFNs. Sequencing subsequently revealed that individual tadpoles often carried multiple distinct indels ranging from 5 to 20 bp centered over the ZFN recognition site (Figure 3.1 K), a signature of mutagenic NHEJ. Taken together, these experiments show that ZFN mRNA injection into the two-cell embryo yields tadpoles without detectable developmental defects and exhibit both genetic and phenotypic mosaicism for the ZFN-targeted locus and trait, respectively.
To determine whether this approach can be used to disrupt an endogenous gene, ZFNs that target the noggin locus were designed. Noggin is a Bmp antagonist that contributes to dorsal/ventral patterning during gastrulation in Xenopus (Smith and Harland, 1992). Although its function in later development has been studied in human patients (Marcelino et al., 2001) and mice (Bachiller et al., 2000; Brunet et al., 1998; McMahon et al., 1998; Warren et al., 2003), its developmental role in non-mammalian vertebrates remains poorly understood. Therefore, mutant alleles of the endogenous noggin gene are required to probe its role throughout amphibian development.
A panel of ZFNs targeting noggin was designed by Sangamo Biosciences Inc., screened in a budding yeast proxy system (Doyon et al., 2008; McCammon et al., 2011), and cloned into an expression construct that allows the synthesis of an efficiently translated mRNA with a stabilizing polyadenylation signal (Turner and Weintraub, 1994). Embryos were injected in the animal pole with the RNA deposited in the center of each blastomere at the two-cell stage, raised to stage 40, and DNA was isolated from tadpoles that exhibited broad mCherry (i.e., tracer)
17
expression. Use of ZFNs that carry a wild-type FokI endonuclease domain yielded a significant fraction of embryos with developmental defects (Figure 3.2 A). However, this was not observed when RNA expressing the same zinc finger DNA recognition domains fused to the obligate heterodimer forms of FokI was injected. The point mutations in FokI are made in the nuclease domain to prevent the formation of a homodimeric and functional nuclease (Miller et al., 2007). These mutations, E490K, I538K and Q486E, I499L, are made in the FokI domain of the left and right ZFN, respectively (referred to as EL+KK). Even at the highest tested doses of such ZFN mRNA, greater than 60% of the injected embryos developed normally (Figure 3.2 A).
To optimize the delivery of ZFNs, I also tested whether unstable, non-adenylated RNA, which would be translated early and deliver a transient burst of ZFN, might be superior to the extended expression of ZFNs from transcripts that are cleaved and polyadenylated after injection (Turner and Weintraub, 1994). As expected, the non-adenylated transcripts led to considerably less protein expression (Figure 3.2 C). Even at higher doses, they did not induce noggin gene disruption at a frequency measurable by Cel-1. Thus, the prolonged presence of ZFNs from adenylated RNA is superior for effective genome editing in Xenopus.
Because it is difficult to predict a priori the extent to which ZFN overexpression may cause embryonic defects, Sangamo tested a panel of ZFNs in a yeast-based single-strand annealing assay (Doyon et al., 2008) and I tested them in embryos (Figure 3.2 B, Table 3.1). Six ZFN pairs shown to have activity in the yeast assay were chosen for testing in Xenopus. The ZFN pairs found to be active in yeast and well tolerated in tadpoles also showed efficient genome editing in Xenopus embryos as measured by sequencing noggin amplicons from injected tadpoles.
Since no Xenopus strains carrying noggin mutations existed, it wasn’t possible to screen for phenotypes on a heterozygous background (Doyon et al., 2008), therefore I screened the ZFNs for activity by genotyping the targeted region using the Cel-1 endonuclease (Figure 3.3 A). All of the ZFNs that were well tolerated produced targeted gene disruption. Direct sequencing of the nuclease-targeted region in tadpoles injected with ZFNs revealed a broad panel of insertions and deletions ranging in size from 5 to 195bp (Figure 3.3 B), with frequencies of mutant amplicons from 10-47%. Such high rates of somatic mutagenesis suggested that tadpoles might also carry mutations in the germline, allowing the establishment of lines carrying novel noggin alleles.
I injected wild-type embryos at the two-cell stage with 100 pg of mRNA encoding ZFNs that target noggin and were tolerated by greater than 60% of injected embryos (Figure 3.2 B). Successful somatic genome editing in tadpoles and froglets was confirmed by isolating genomic DNA from tail or toe clips, respectively, and genotyping the noggin locus by Cel-1 and sequencing (Table 3.1). Injected embryos were raised to sexual maturity and outcrossed to wild-type animals. Offspring from this cross were raised to stage 40, lysed and analyzed via Cel-1 for mutations in the noggin locus. Genotyping offspring from a cross using a ZFN-treated male founder revealed that three of eighteen tadpoles had inherited a ZFN-induced Δ12 allele of noggin (Figure 3.4 A,B). A second male founder produced six out of fifty embryos heterozygous for a ZFN-induced three base pair insertion allele (Figure 3.4 A,B) and a third male produced
18
twelve of fifty tadpoles heterozygous for a four basepair insertion. The latter ZFN-induced noggin allele induces a frameshift mutation that results in a premature stop codon at position 55. Therefore, it is likely to behave as a null allele because the resulting protein lacks most of the Bmp binding residues and all of the residues required for dimerization (Groppe et al., 2002).
The recovery of these mutations in the offspring of adult animals raised from injected embryos demonstrates that ZFN-induced alleles of an endogenous gene can be transmitted to the next generation. Of significant note, the parent and heterozygous tadpoles carrying mutant alleles were indistinguishable from wild type siblings, indicating this is an effective approach to establish lines of animals carrying novel alleles of investigator-specified genes. To test whether ZFN-induced mutagenesis caused off-target mutations, gynogenotes from noggin ZFN injected females that lacked mutant noggin alleles in their germline were made. These were siblings of the germline mutated males, and from clutches that showed a high frequency of somatic mutation. Gynogenesis diploidizes activated eggs by preventing the extrusion of the second polar body and serves to homozygose recessive mutations (Khokha et al., 2009). While off-target mutations would result in high frequencies of mutant embryos in gynogenotes produced from these females, I did not detect such mutations; indeed 87% of gynogenotes were indistinguishable from wild-type tadpoles and the remaining 13% had various mediolateral and dorsoventral defects, consistent with reported phenotypes and frequencies from young wild-type females (Grammer et al., 2005). This result demonstrates that potentially confounding off-target mutations in founder animals are negligible.
Noggin induces ectopic dorsal tissue when expressed on the ventral side of Xenopus embryos (Smith and Harland, 1992), which serves as an excellent test for whether the ZFN-induced noggin alleles produce loss-of-function proteins. Full-length mutant alleles were cloned and corresponding mRNAs for injection were synthesized. 5 or 10pg was injected into the ventral vegetal blastomeres of 4-cell stage Xenopus laevis embryos (Figure 3.4 C). Embryos were cultured to stage 28 and scored for the presence or absence of an ectopic axis (Figure 3.4 D). The four basepair insertion allele failed to induce any ectopic dorsal tissues in embryos (Figure 3.4 H,I,J,J’), consistent with a loss-of-function frameshift mutation. LacZ mRNA was used as a tracer and showed that injected cells populated the ventral posterior of injected tadpoles. The ∆12 allele induced ectopic axes in 8 and 16 percent of embryos when injected with 5 pg and 10 pg mutant noggin RNA, respectively. Interestingly, the induced axes in these embryos were underdeveloped, suggesting that this allele functions as a hypomorph (Figure 3.4 M arrowheads). Finally, the three basepair insertion allele was indistinguishable in activity from wild-type noggin (Figure 3.4 N,O,P). These results demonstrate that specific loss-of-function mutant lines of X. tropicalis can be generated via targeted ZFN mutagenesis. Furthermore, the mutations in noggin form the basis of an allelic series that will be useful to examine noggin function in later development.
Knocking down Noggin, Chordin, and Follistatin results in a loss of dorsal structures and yield embryos without neural or somitic derivatives whereas knocking down any two in combination results in a redution but not a complete loss of these structures (Khokha et al., 2005). To test if
19
the 4-basepair insertion allele is truly a null allele, heterozygous adults were crossed and the resulting embryos were injected with morpholinos targeting Chordin and Follistatin. These embryos were raised to stage 14 and assayed for sox2 and myoD expression. Uninjected embryos expressed sox2 throughout the neural plate and myoD in the underlying mesoderm (Figure 3.5 A,D). Chordin and Follistatin morpholino injection resulted in a reduction of both sox2 and myoD in ~75% of the embryos (Figure 3.5B,E). However, in approximately 25% of injected embryos, presumably those homozygous for the 4-bp insertion allele, there was a complete loss of both sox2 and myoD expression (Figure 3.5C,E). These results, taken with the failure of RNA bearing the 4-basepair insertion noggin allele to induce ectopic axes suggest that the 4-bp insertion noggin allele is a true functionally null allele.
noggin null mice die at birth due to numerous defects including open neural tubes and several skeletal abnormalities including chondrocyte hypertrophy and joint formation failure (Brunet et al., 1998; McMahon et al., 1998). Conversely, morpholino knockdown of Noggin in Xenopus does not yield a phenotype (Khokha et al., 2005). This discrepancy can be due to either incomplete knockdown by the morpholino or because the requirement for Noggin occurs when morpholinos are no longer effective. To distinguish between these possibilities, heterozygous adults carrying the 4-bp insertion allele were crossed and the resulting embryos were cultured and observed for phenotypic abnomalities. Unexpectedly, I did not observe defects in neural tube closure in any of the embryos produced from heterozygous parents (Figure 3.6 A-J). No defects were observed in any embryos until stage 45 where a dorsal-rostral protuberance was noticed in a subset of the clutch . Sorting tadpoles based on the presence or absence of this dorsal “horn” resulted in 2533 (75.1%) wild-type and 824 (24.9%) abnormal (Figure 3.6 K-N and Figure 3.7 A-F). Genotyping 10 wild-type and 10 horned tadpoles revealed the horned tadpoles were homozygous for the noggin null allele.
To determine the nature of the horn observed in noggin mutants, alcian blue staining was used to viualize the cartilage skelton of the cranium. Staining and flatmounting cartilage preparations from wild-type (Figure 3.7 G,G’) and mutant tadpoles revealed overall smaller cartilage elements, deformed ceratobranchial cartilage, and most notably severely reduced Meckel’s cartilage that are fused to the palatoquadrate in mutant tadpoles (Figure 3.7 H,H’). There are no major differences in the superostral plate between the wild-type and mutant, indicating that the horn observed in the mutants is due to a deformation and loss of ventral structures (i.e. Meckel’s catilage and ceratohyals) rather than an overgrowth of the superostral plate. Mutant tadpoles did not display sensory defects as they responded to gentle tapping on the culture dish. Finally, the mutants began to die off rapidly by two weeks post fertilization (Figure 3.7 I), presumably due to malnutrition because of an inability to feed effectively.
Next, expression of the neural crest gene sox9 was examined because it directly activates col2a, which is required for cartilage differentiation(Lefebvre et al., 1997). A reduction in cartilage differentiation could explain the overall smaller cranium size observed in mutants. Since the mutant phenotype doesn’t manifest until after patterning and differentiation of the pharyngeal arches, it was necessary to genotype tadpoles prior to analyzing gene expression. To that end,
20
the heads from stage 33 and stage 39 tadpoles were excised and processed for in situ hybridization while the tails were genotyped. There was a marked reduction in sox9 expression (Figure 3.8 A,B) and a corresponding loss of col2a expression in the mandibular arch of mutants at stage 33 (Figure 3.8 C,D arrowhead), consistent with the observed reduction in Meckel’s cartilage. However, there was no noticeable difference in col2a expression between wild-type and mutant tadpoles at stage 39 (Figure 3.8 E,F).
Bmp signaling plays a major role in the dorsal-ventral patterning of the pharyngeal arches, which in turn develop into the cranial skeleton. Previous work in zebrafish has shown that Bmp signaling is sufficient to induce ventral arch fates in intermediate and dorsal regions (Alexander et al., 2011; Zuniga et al., 2011). Given that Noggin functions as a Bmp antagonist, I examined wild-type and mutant tadpoles for the expression of Bmp responsive genes that function in pharyngeal arch development. bmp7 is expressed in the ventral portion of the pharyngeal arches but did not show any appreciable differences between wild-type and mutant tadpoles at stage 33 or 39 (Figure 3.9 A-D). At stage 33, expression of the Bmp responsive gene msx2 (Hollnagel et al., 1999; Tríbulo et al., 2003) showed slight dorasl expansion (Figure 3.9 E,F) but was indistinguishable from wild-type at stage 39 (Figure 3.9 G,H). Another Bmp target, endothelin1 (edn-1) was not differently expressed at stage 33 between the two genotypes (Figure 3.9 I,J). However, it showed a more diffuse expression pattern in the mutant at stage 39 (Figure 3.9 K,L). Finally, the BMP target gene hand2 (Howard et al., 2000; Xiong et al., 2009) had a broader expression domain in the mutants at stage 33 (Figure 3.9 M,N) and was ectopically expressed in the mandibular arch of stage 39 mutants (Figure 3.9 O,P). In zebrafish, Hand2 is known to repress bapx1 which is required for joint formation between Meckel’s cartilage and the palatoquadrate (Miller et al., 2003).
Discussion
These results show that Xenopus can be added to the growing list of important model organisms for which ZFN-encoding mRNA has allowed facile reverse genetics, including Drosophila (Bibikova et al., 2001), zebrafish (Doyon et al., 2008; Meng et al., 2008), and the rat (Geurts et al., 2009; Mashimo et al., 2010). An important requirement for the use of ZFNs is a streamlined protocol to predict and implement effective gene disruption. This work confirmed that a proxy assay in budding yeast is efficient in identifying ZFNs that will function effectively in the developing embryo. Furthermore, I have determined an expression vector architecture and dose of mRNA that allow optimal expression of the ZFNs to generate both tadpoles and fertile adult animals that carry disrupted alleles of target genes in both the soma and germline. Remarkably, the injection of ZFN mRNA into a relatively small cohort of two-cell embryos was sufficient to raise adults carrying mutant alleles in the germline. Our results demonstrate that with optimal husbandry (Grammer et al., 2005), homozygous mutants can be generated within one year of the initial mutagenesis, and potentially 7 months if female founders are generated.
21
The Cys2-His2 zinc finger protein (Miller et al., 1985; Pavletich and Pabo, 1991) is the most common DNA recognition motif in metazoa, and ZFNs can be engineered against any locus of interest (Urnov et al., 2010). This work here showed that ZFNs built using an archive of pre-validated two-finger modules that either target eGFP or noggin and carry high-fidelity FokI endonuclease domains (Miller et al., 2007) induced mutations at a high rate when injected at doses that were well tolerated by the majority of injected embryos. Direct sequencing of both targets showed a variety of indels that are likely to result in null alleles. Indeed, there was a ZFN-induced loss of eGFP fluorescence phenotype in injected tadpoles that are heterozygous for the eGFP transgene. The absence of a phenotype in founder noggin animals could be due to several factors, including the mosaic nature of the injected founders, non-autonomy of secreted Noggin, and a compensatory role of other Bmp antagonists in the early embryo (Khokha et al., 2005). However, artificial ventral expression of mRNAs encoding the ZFN-induced noggin mutants demonstrated that ZFNs induced both null and hypomorphic alleles of an endogenous X. tropicalis gene. The normal development of gynogenotes derived from females with high frequencies of somatic mutations in noggin (but no detectable noggin mutations in the germline) shows that off-target mutations in the germline must be rare.
Breeding the induced noggin mutant alleles to homozygosity revealed that Noggin functions in the development and differentiation of the pharyngeal arches. Specifically, Noggin appears to be required to restrict expression of the Bmp target gene hand2. Mutant tadpoles express hand2 in a broader domain, including the mandibular arch which gives rise to Meckel’s cartilage. This provides a potential mechanism to explain the loss of joint formation between Meckel’s cartilage and the palatoquadrate observed in mutant tadpoles. Hand2 represses the homeobox gene bapx1 (Miller et al., 2003). It is plausible that in noggin mutant tadpoles, the increase in Bmp signaling due to a loss of Noggin, results in the expansion of Hand2 and a concomitant repression of bapx1, causing the fusion of Meckel’s cartilage to the palatoquadrate (Figure 3.7 H,H’). This may also explain the cause of death observed in mutants two weeks post fertilization. Meckel’s cartilage forms the mandible and the severe reduction/loss of this structure in noggin mutants impedes the tadpole’s ability to feed effectively and likely results in starvation. This is consistent with the inverse sigmoidal survival curve observed in the mutants.
As mentioned above, noggin mutant mice show neural tube closure defects (McMahon et al., 1998). While the skeletal deformaties are consistent between mutant frogs and mice, why are there no defects in the neural tube observed in noggin mutant Xenopus tadpoles? One explanation could be the presence of other Bmp antagonists. Chordin and Follistatin are expressed in a similar domain during early embyogenesis of Xenopus (Khokha et al., 2005) and could compensate for the loss of noggin in neural patterning. Indeed, there is redundancy in the function of these Bmp antagonist during neural induction and dorsalization of the mesoderm (Khokha et al., 2005). A second explanation could be that the paralog noggin2 partially compensates for the loss of noggin (Fletcher et al., 2004).
Genome editing using ZFNs has the potential to enable numerous lines of experimentation that were previously impossible with existing Xenopus methodology. Permanent, heritable mutations
22
will allow for the study of specific genes and later developmental processes without concern for the off-target or transient effects associated with morpholino oligonucleotides (Eisen and Smith, 2008). Furthermore, the variety and size of ZFN-induced indels can be used to generate an allelic series of mutations. We note that several noggin alleles we generated were deletions of substantial size (~200 bp), indicating that ZFNs provide an attractive method for not only disrupting specific coding sequences, but also for targeting regulatory elements in the genome.
Recently, alternative methods for genome editing have been developed that have replaced the use of ZFNs . Transcription activator-like effectors (TALEs) from the plant pathogenic bacteria Xanthomonas that consist of repeated motifs, each of which binds a single nucleotide (Boch et al., 2009; Moscou and Bogdanove, 2009), have been fused with FokI nucleases to generate TALE-Nucleases (Cermak et al., 2011; Christian et al., 2010). The modular nature of TALENs allows for easy design and synthesis. Other groups have been successful in using TALENs to generate biallelic mutations in Xenopus tropicalis (Lei et al., 2012). The CRISPR-CAS method provides an additional alternative to nuclease fusion proteins for inducing targeted mutations. This system uses an RNA molecule engineered to target specific sites that flank common repeat sequences in the genome and recruit the Cas-9 endonuclease to induce double strand breaks (Hwang et al., 2013; Jinek et al., 2012). The CRISPR-CAS system relies on basepair complementarity and requires only two plasmids to synthesize targeting constructs. The zebrafish genome has CRISPR sites every 8-128 basepairs thus, this system is likely applicable to any gene of interest (Blackburn et al., 2013). My thesis work demonstrates that induced mutations can result in heritable null mutations and allow for analysis of gene function in amphibian development.
Due to the large size, abundance, and ready manipulation of their eggs and embryos, Xenopus has provided important insights in both cell biology (King et al., 1996) and embryology (Harland and Gerhart, 1997). Completion of the genome sequence of X. tropicalis brought this model system into the genomics age (Hellsten et al., 2010), but the genetic engineering tools essential for comprehensive study of biological mechanism were lacking. My studies add a robust method for genome editing so that gene function can be analyzed throughout development.
23
Figure 3.1: Disruption of the eGFP transgene in Xenopus tropicalis using ZFNs. (A-C) Uninjected tadpoles (UC). (D-F) Tadpoles injected with 20 pg of eGFP ZFN mRNA and 200 pg mCherry RNA (to monitor injection). (G-I) Heterozygous eGFP tadpoles injected with 50 pg eGFP ZFN mRNA and 200 pg mCherry RNA (tracer). (A,D,G) Brightfield. (B,E,H) eGFP expression in tadpoles from A,D, and G, respectively. (C,F,I) Enlarged view of eGFP expression in B, E, and H, respectively. (J) Cel-1 digestion of eGFP amplicons. Bands migrating at 345 bp are full-length amplicons, Cel-1 cleavage products migrate at 246 bp and 99 bp. The fraction of modified chromatids detected by Cel-1 are quantified as % NHEJ. “UC,” uninjected control. (K) Sequence alignment of ZFN-induced mutant eGFP transgene alleles from tadpoles injected with 50 pg ZFN mRNA. Red nucleotides indicate insertions and dashes represent deletions. Horizontal bold lines indicate ZFN binding sites.
24
25
Figu
re 1
AA BB CC
DD EE FF
GG HH IIU
.C.
U.C
.
U.C
.U
.C.
20 p
g eG
FP Z
FNs
20 p
g eG
FP Z
FNs
20 p
g eG
FP Z
FNs
20 p
g eG
FP Z
FNs
50 p
g eG
FP Z
FNs
50 p
g eG
FP Z
FNs
50 p
g eG
FP Z
FNs
50 p
g eG
FP Z
FNs
JJKK
eGFP
ZFN
LeG
FP Z
FN L
eGFP
ZFN
ReG
FP Z
FN R
WT
WTCAACTACAACAGCCACAACGTCTATATCATGGCCGACAAG
CAACTACAACAGCCACAACGT---TATCATGGCCGACAAG(
∆3)
CAACTACA------------TCTATATCATGGCCGACAAG(
∆12)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAGCCACAACGT-----------CCGACAAG(
∆11)
CAACTACAACAGCCACAAC-----TATCATGGCCGACAAG(
∆5)
CAACTACAACAGC--------------CATGGCCGACAAG(
∆14)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAGC--------------CATGGCCGACAAN(
∆14)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAG--------------------CCGACAAG(
∆20)
CAACTACAACAGC--------------CATGGCCGACAAG(
∆14)
CAACTACAACAGCCACAA--------TCATGGCCGACAAG(
∆8)
GAACTACAACAGCCACAACGTGTGT--CATGGCCGACAAG(
∆6,+4)
CAACTACAACAGCCACAACAA------CA--GCCGACAAG(
∆12,+4)
CAACTACAACAGT--------------CATGGCCGACAAG(
∆15,+1)
CAACTACAACAG----AA------------AGCCGACAAG(
∆19,+3)
CAACTACAACAGCCACAAC----GGATCATGGCCGACAAG(
∆6,+2)
CAACTACAACAGCCACAACGTCTATATATCATGGCCGACA(+2)
Gln
LeuGln
Gln
ProGln
Arg
Leu
TyrHisGlyArgGln
Del
etio
nsD
elet
ions
Inde
lsIn
dels
Inse
rtion
sIn
serti
ons
50 p
g50
pg
UC
UC
20 p
g20
pg
345
bp34
5 bp
11111111
19191717
24241616
% N
HE
J%
NH
EJ
246
bp24
6 bp
99 b
p99
bp
1122
3311
2233
Figure 3.2: Tolerance and activity of ZFNs targeting noggin in Xenopus tropicalis. (A) Optimization of ZFN delivery in Xenopus tropicalis. EL+KK: ZFNs with the EL and KK modifications in the FokI domain (Miller et al., 2007), numbers represent different noggin ZFN pairs (Table 3.2). WT: ZFNs with wildtype Fok1 nuclease domains. PA-: ZFN transcripts lacking a poly-adenylation signal. UC: Uninjected control. (B) Comparison of activities of different noggin ZFN pairs in the yeast activity assay and in injected tadpoles. Tadpoles were injected with 100 pg of ZFN mRNA. Yeast activity values represented as a percentage relative to expression of ZFNs targeting the human CCR5 gene (Perez et al., 2008). Activity in tadpoles as calculated by the percent of mutant amplicons sequenced from injected embryos. ND: No Data. (C) Western blot for FLAG tagged ZFN proteins.
26
27
0%
20%
40%
60%
80%
100%
Tad
po
le %
Ph
eno
typ
e
UC 100 100 100 10050 50 50 50 5020 20 pg ZFN RNAeGFP ZFN EL+KK Noggin
26EL+28KKNoggin
60EL+66KKNoggin
60+66 (WT)Noggin
60+66 (WT)PA-
50 100 50 100 50 100 50 100 50 100UCFLAG eGFP ZFN
Noggin26EL+28KK
Noggin60EL+66KK
Noggin60+66 (WT)
Noggin60+66 (WT)PA-
pg ZFN RNA
B
C
0
20
40
60
80
100
28EL+29KK 30EL+31KK 26EL+28KK 58EL+66KK 60EL+66KK 63EL+66KK
NormalMild Axial DefectsSevere Axial DefectsGastrulation DefectsLethalTa
dpol
e
Relative Activity in Yeast% Mutant Amplicons
Tad
po
le %
Ph
eno
typ
e
Noggin ZFN Pair
0
20
40
60
80
100
120
140
160
180
Yea
st A
ssay
% C
on
tro
l
A
ND ND
Figure 3.3: ZFN-driven editing of the noggin locus in Xenopus tropicalis. (A) Somatic mutations in noggin detected by Cel-1. Bands migrating at 450 bp are full-length noggin amplicons. Bands migrating at 300 bp and 150 bp bands are Cel-1 digest products. (B) Sequence alignment of noggin alleles induced by indicated ZFN pairs. Red nucleotides indicate insertions and dashes represent deletions. Horizontal bold lines indicate ZFN binding sites. EL+KK: ZFNs with the EL and KK modifications in the FokI domain (Miller et al., 2007), numbers represent different noggin ZFN pairs (Table 3.2).
28
29
A
B
Wild Type 58EL+66KK 60EL+66KK 63EL+66KK
300bp
150bp
100pg Noggin ZFN mRNA
450bp
Noggin ZFN L Noggin ZFN R
WT
58EL+66KK
60EL+66KK
63EL+66KK
TGGACCTTATTGAGCATCCGGATCCTATCTATGATCCCAAGGAGAAGGATCTTATGGACCTTATTGAGCATCCGGATCC------------CAAGGAGAAGGATCTTA( 12)--------------------------ATCTATGATCCCAAGGAGAAGGATCTTA( 181)TGGACCTTATTGAGCATCCGGA---------------------GAAGGATCTTA( 21)TGGACCTTATTGAGCATCCGGATCC----TATGATCCCAAGGAGAAGGATCTTA( 4)--------------------------ATCTATGATCCCAAGGAGAAGGATCTTA( 195)-----------------------------TATGATCCCAAGGAGAAGGATCTTA( 95)--------------------------------GATCCCAAGGAGAAGGATCTTA( 101)TGGACCTTATTGAGCATCCGGATCC------------CAAGGAGAAGGATCTTA( 12)TGGACCTTATTGAGCATCCGGA---------------------------TCTTA( 27)-------------------------TATCTATGATCCCAAGGAGAAGGATCTTA( 80)TGGACCTTATTGAGCATCCGGATCC------------CAAGGAGAAGGATCTTA( 12)TGGACCTTATTGAGCATCCGGATCC------------CAAGGAGAAGGATCTTA( 12)TGGACCTTATTGAGC-----------------GATCCCAAGGAGAAGGATCTTA( 17)TGGACCTTATTGG--------------------------AGGAGAAGGATCTTA( 26)TGGACCTTATTGAGCATCC------------------CAAGGAGAAGGATCTTA( 18)----------------------------------------GGAGAAGGATCTTA( 116)
TGGACCTTATTGAGCATCCGGATCCTATCCTATGATCCCAAGGAGAAGGATCTT(+1)TGGACCTTATTGAGCATCCGGATCCTATATCTATGATCCCAAGGAGAAGGATCT(+2)TGGACCTTATTGAGCATCCGGATCCTATCTATCTATGATCCCAAGGAGAAGGAT(+4)TGGACCTTATTGAGCATCCGGATCCTATCCTATCTATGATCCCAAGGAGAAGGA(+5)TGGACCTTATTGAGCATCCGGATCCTATCCTATCTATGATCCCAAGGAGAGGGA(+1)
Leu Ile Glu His Pro Asp Pro Ile Tyr Asp Pro Lys Glu Lys Asp
58EL+66KK
60EL+66KK63EL+66KK
Figure 3.4: ZFNs induce heritable loss-of-function noggin alleles mutations. (A) Cel-1 digests of noggin amplicons from sibling heterozygous mutant and homozygous wild type F1 tadpoles produced from three mutant line founders. Bands migrating at 450 bp are full-length noggin amplicons. Bands migrating at 300 bp and 150 bp are Cel-1 digest products. (B) Sequence alignments of the targeted noggin locus from Cel-1-positive F1 mutants. Genomic and translated sequences are shown for each mutant line. Asterisk indicates a stop codon. Red nucleotides and amino acids indicate insertions and dashes represent deletions. (C) Schematic of synthetic RNA injections into ventral vegetal blastomeres of 4-cell stage embryos to test functionality of the induced mutant noggin alleles. (D) Quantification of secondary axis induction following wild-type or mutant noggin RNA and scored for presence of ectopic dorsal axes. Bars represent results of two (5 pg) or three (10 pg) independent experiments (±SD) White bars show 5 pg RNA injections, black bars show 10 pg RNA injections. Two asterisks indicate significantly different (p<0.01) from uninjected controls. (E-G’) Uninjected control embryos. (H-J’) Embryos injected with 10 pg of 4 bp insertion mutant noggin and 200 pg LacZ RNA. (K-M’) Embryos injected with 10 pg of 12 bp deletion mutant noggin and 200 pg LacZ RNA. (N-P) Embryos injected with 10 pg of 3 bp insertion mutant noggin and 200 pg LacZ RNA. (Q-S) Embryos injected with 10 pg wild-type noggin and 200 pg LacZ RNA. (E,H,K,N,Q) Dorsal view stage 19. (F,I,L,O,R) Dorsal view stage 28. (G,J,M,P,Q) Embryos stained with 12/101 antibody. (G.J) Lateral view. (G’,J’,M,P,Q) Dorsal view. Arrowheads show weak ectopic dorsal axis induction.
30
31
450b
p
300b
p
150b
p
HH
WT
Fou
nder
2
HW
T
Fou
nder
1
WT
Fou
nder
3A
EF
G G’
HI
J J’
KL
M
NO
P
QR
S
UC 4bp Insertion 12bp deletion 3bp Insertion WT
WT CCGGATCC---TAT-CTATGA
Mut CCGGATCCCAAGATCCCATGA
WT EHPDPIYDPKEKDL
Mut EHPDKIP*
Fou
nder
3:
4bp
Inse
rtio
n
WT GGATC---CTATCTATGATC
Mut GGATCTATCTATCTATGATC
WT EHPDP-IYDPKEKDL
Mut EHPDLSIYDPKEKDL
Fou
nder
2:
3bp
Inse
rtio
nWT GATCCTATCTATGATCCCAAG
Mut GATCC------------CAAG
WT EHPDPIYDPKEKDL
Mut EHPD----PKEKDL
Fou
nder
1:
12bp
Del
etio
n
Mut
ant o
rW
ild T
ype
Nog
gin
RN
A
B
C
100
5 pg
10
pg
80 60 40 20 0U
C4b
p In
sert
ion
12bp
D
elet
ion
3bp
Inse
rtio
nW
T
% Embryos with Ectopic Axis
D
**
****
****
Figure 3.5: Knockdown of Chordin and Follistatin results in a loss of dorsal structures in a subset of embryos produced by heterozygous noggin mutant adults. (A-C) sox2 expression. (D-E) myoD expression. (A,D) Uninjected control embryos. (B,C,E,F) Embryos injected with 20 ng Chordin morphino and 20 ng Follistatin morpholino. Dorsal views with anterior towards the top.
32
33
sox2
myoD
UninjectedControl
20 ng Chordin MO+ 20 ng Follistatin MO
9/9
6/6
8/10 2/10
11/15 4/15
A B C
D E F
Figure 3.6: Stage series of representative embryos produced by heterozygous noggin mutant adults. (A-J) Phenotypically wild-type embryos and tadpoles. (K-L) Wild-type tadpoles. Total number of tadpoles and percentage within each phenotypic class. (M-N) Abnormal tadpoles with dorsal “horn.” Total number of tadpoles and percentage within each phenotypic class. (A,B,D,F,I,K,M) Dorsal views. (C,E,G,H,J,L,M) Lateral views. Anterior to the left.
34
35
Sta
ge 2
1/22
Sta
ge 2
5/26
Sta
ge 3
3/34
Sta
ge 3
9
Sta
ge 4
1S
tage
44
Sta
ge 4
5
AAB
DF
CE
G
H
IK
M NJ
L
2533
(75
.1%
)82
5 (2
4.9%
)
Figure 3.7: Homozygous noggin mutant Xenopus tropicalis have severe lower jaw deformities. (A-C) Wild-type stage 46 tadpoles. (D-F) Homozygous noggin mutant stage 46 tadpoles. Anterior towards the left. (A,D) lateral views. (B,E) dorsal views. (C,F) Ventral views. (G-H) Flat-mounted cartilage from wild-type (G) and mutant (H) tadpoles. (G’-H’) Schematic of skeletal elements in (G-H). (I) Survival curve of 100 wild-type (closed boxes) and 100 mutant tadpoles open triangles).
36
37
Wild Type MutantA
BC
DE
F
MutantWild Type
G H
G’
H’
Su
pra
rost
ral P
late
Pal
ato
qu
adra
teM
ecke
l’s C
arti
lag
eIn
frar
ost
ral C
arti
lag
eC
erat
oh
yal
Cer
ato
bra
nch
ial
0 20
40
60
80
100
8 9
10
11
12
13
14
15
16
Day
s p
ost
-fer
tiliz
atio
n
% Survival
Wild
typ
e
Mu
tan
t
I
Figure 3.8: Expression of chondrogenic factors in wild-type and noggin mutant tadpoles. (A-B) sox9 expression in the head of a representative wild-type (A) and mutant (B) tadpole at stage 33. (C-F) col2a expression in the head of stage 33 (C-D) and stage 38 (E-F) tadpole. (C,E) Representative wild-type tadpoles and (D,F) mutant tadpoles. Anterior to the left and dorsal towards the top.
38
39
sox9Wildtype Mutant
col2aWildtype Mutant
A B C D
E F
Figure 3.9: Expression of Bmp pathway targets in wild-type and noggin mutant tadpoles. (A-D) Expression of bmp7 in the head of representative wild-type (A,C) and noggin mutant (B,D) tadpoles. (E-H) Expression of msx2 in the head of representative wild-type (E,G) and noggin mutant (F,H) tadpoles. (I-L) Expression of edn-1 in the head of representative wild-type (I,K) and noggin mutant (J,L) tadpoles. (M-P) Expression of hand2 in the head of representative wild-type (M,O) and noggin mutant (N,P) tadpoles. (A-B,E-F,I-J,M-N) Stage 33. (C-D,G-H,K-L,O-P) Stage 38. Anterior to the left and dorsal towards the top.
40
41
hand2
msx2
edn1
bmp7
Wildtype Mutant Wildtype Mutant
Wildtype Mutant Wildtype Mutant
M N
E FA B
O P
G HC D
I J
K L
Table 3.1: noggin mutation induction and generation of germline mutants by Zinc-Finger Nucleases in Xenopus tropicalis. Percent mosaic embryos in cohort calculated by
Founder percent germline mutagenesis calculated by the percentage of heterozygous offspring produced by founder in an outcross.
42
43
Foun
der
(Mal
es)
Nog
gin
ZFN
Pai
rE
mbr
yos
inje
cted
in
coh
ort
% M
osai
c em
bryo
s in
co
hort
Adu
lts
rais
ed in
co
hort
Foun
der
%
germ
line
mut
agen
esis
Mut
atio
n
126
EL+
28K
K30
016
.14
16.7
12bp
Del
etio
n
226
EL+
28K
K56
860
1712
3bp
Inse
rtio
n
363
EL+
66K
K11
610
02
244b
p In
sert
ion
Table 3.2: noggin ZFN recognition sequences. sites.
44
45
Nog
gin
ZFN
Bin
ding
Seq
uenc
e (u
nder
lined
)ZF
NFi
nger
1Fi
nger
2Fi
nger
3Fi
nger
4Fi
nger
5Fi
nger
6
AGCATCCGGATCCTAtctatGATCCCAAGGAGAAG
25729KK
RSDNLSV
RSANLTR
RSDNLSVIRSTLRDTSSNLSR
TCGTAGGCCTAGGATa
gataCTAGGGTTCCTCTTC
25728EL
QSSDLSR
TSANLSR
RSDTLSETSANLSRRSDYLTK
ATCCGGATCCTATCTatgatCCCAAGGAGAAGGAT
25731KK
TSSNLSR
RSDNLSV
RSANLTRRSDNLSVIRSTLRD
TAGGCCTAGGATAGAt
actaGGGTTCCTCTTCCTA
25730EL
TSSNLSR
RSDTLSE
TSANLSRRSDYLSTQNAHRKT
TTATTGAGCATCCGGATCctatcTATGATCCCAAGGAGAAG
15026EL
RSDNLSV
RSANLTR
RSDNLSVDNRDRIKQSSNLAR
TSSNRKT
AATAACTCGTAGGCCTAG
gatagATACTAGGGTTCCTCTTC
15028KK
RSDALST
ASSNRKT
QSSDLSRTSANLSRRSDTLSE
TSANLSR
TTATTGAGCATCCGGATCctatcTATGATCCCAAGGAGAAG
25766KK
RSDNLSV
RSANLTR
RSDNLSVIRSTLRDTSGNLTR
NRGNLVT
AATAACTCGTAGGCCTAG
gatagATACTAGGGTTCCTCTTC
25758EL
RSDALST
ASSNRKT
QSSDLSRTSANLSRRSDTLSE
TSANLSR
TTATTGAGCATCCGGATCctatcTATGATCCCAAGGAGAAG
25766KK
RSDNLSV
RSANLTR
RSDNLSVIRSTLRDTSGNLTR
NRGNLVT
AATAACTCGTAGGCCTAG
gatagATACTAGGGTTCCTCTTC
25760EL
RSDALST
ASSNRKT
QSSDLSRTSANLSRRSDTLSE
TSANLSR
TTATTGAGCATCCGGATCctatcTATGATCCCAAGGAGAAG
25766KK
RSDNLSV
RSANLTR
RSDNLSVIRSTLRDTSGNLTR
NRGNLVT
AATAACTCGTAGGCCTAG
gatagATACTAGGGTTCCTCTTC
25763EL
RSDALST
ASSNRKT
QSSDLSRTSANLSRRSDDLSE
TNSNRKR
CHAPTER 4
Expression Screen for Direct Targets of Wnt-Signaling in Neural Tissue
Introduction
(NieuwkoopOthers, 1952b), postulates that neural tissue (by default anterior in nature) is induced
Xenopus (Lamb et al., 1993).
. A role for the Bmp antagonists Chordin , Noggin (Lamb et al., 1993), and Follistatin
in the induction step is well supported in Xenopus. Reduction of these three antagonists results in a complete loss of neural tissue in Xenopus
induced by Bmp antagonism will adopt an anterior fate in the absence of additional signals .
in Xenopus,
al., 1995) and Fgf
Xenopus was shown to
marker hoxB1 .
and LRP6 , leading to cytoplasmic enrichment and nuclear translocation of β-catenin. Once inside the nucleus, β
hindbrain marker krox20
Xenopus . Furthermore, a gradient of nuclear localized βneural plate of late gastrula/early neurula stage frog embryos ,
46
posteriorizes the neural plate from mesodem in the dorsal-lateral marginal zone of Xenopus embryos meis3,
mesoderm, induces a more posterior neural fate such as spinal cord and intermediate doses induce more medial fates like mid and hindbrain (Figure 4.1).
markers (e.g. hoxb9) posterior to hindbrain markers (e.g. krox20
Here, I describe a screen that I performed to
Results and Discussion
Before assaying for Wnt-induced posterior neural gene expression, it is important to determine the normal temporal and spatial expression of A-P neural markers at the onset of gastrulation through neurulation. Therefore, Xenopus tropicalis embryos were fixed and stained for the following factors: otx2, expressed in the forebrain and midbrain (Blitz and Cho, 1995), en2, expressed at the midbrain-hindbrain boundary (Hemmati-Brivanlou et al., 1990; Hemmati-Brivanlou et al., 1991), krox20, expressed in rhombomeres 3 and 5 (Bradley et al., 1993), and hoxb9, a marker for the spinal cord (Wright et al., 1990). Consistent with the two-step model for neural patterning, otx2 is expressed broadly throughout the presumptive neural plate at the onset of gastrulation but becomes more restricted to the anterior with time (Figure 4.2 A-F). The more posterior markers begin to be expressed at the onset of neurulation and the embryo exhibits a full A-P pattern by the mid neurula stage (Figure 4.2 G-X). These results show that the neural plate is fully patterned by stage 15 and therefore, an optimal stage to assay for Wnt targets in neural tissue.
To allow temporal control over the activation of Wnt signaling, an inducible activator is required. I used a fusion protein with the DNA binding domain of TCF fused to the transactivating domain of VP-16 all in turn fused to a glucocorticoid receptor (TVGR) (Darken and Wilson, 2001). Canonical Wnt signaling is sufficient to specify the dorsal axis during cleavage stages of Xenopus embryos, and thus provides an excellent readout for Wnt activity (Smith and Harland, 1991; Sokol et al., 1991). To confirm the results of Darken and colleagues that TVGR efficiently activates Wnt-signaling (Darken and Wilson, 2001), TVGR RNA was injected into the ventral-vegetal blastomeres of 4-cell stage embryos and the resulting tadpoles were assayed for secondary axis induction. Ventral-vegetal injection of TVGR alone or injection followed with 0.2% EtOH (vehicle) treatment resulted in normal development in 80% of injected tadpoles. The remaining 20% showed only partial secondary axes (Figure 4.3A-C). Conversely, dexamethasone (DEX) treatment of TVGR injected embryos resulted in 80% of injected tadpoles with robust secondary axes induction as measured by the presence of eyes in the ectopic axis
47
(Figure 4.3A,D). The results from this experiment show that TVGR is a potent activator of Wnt signaling upon DEX addition with minimal activation in the absence of the inducer.
In order to discover Wnt targets in neural tissue, ectodermal explants (animal caps) were induced to become neural tissue via noggin expression followed by Wnt activation (Figure 4.4 A) Therefore, the activity of TVGR in posteriorizing neural tissue was tested by assaying for known A-P markers in animal caps under different treatments. As expected, uninjected animal caps showed high expression of the epidermal marker epidermal keratin. Animal caps treated with noggin alone expressed the anterior neural marker otx2 but not the epidermal marker epidermal keratin or any posterior neural gene, demonstrating that this tissue adopted an anterior neural fate. TVGR-injected animal caps that were neuralized by noggin showed robust expression of the posterior neural markers krox20 and hoxb9 upon induction with DEX. While EtOH treatment of TVGR-expressing animal caps express the hindbrain marker krox20, activation via DEX is required to induce spinal cord fates as assayed by hoxb9 expression (Figure 4.4 B). Consistent with these results, DEX treatment of neuralized animal caps expressing TVGR induced the caps to undergo convergent-extension like morphogenesis that is consistent with differentiation into spinal cord (Elul et al., 1997) (Figure 4.4 C). The observed morphogenesis and neurulation are not due to mesodermal contamination of the ectodermal explants as there is no expression of the mesodermal marker muscle actin.
Next, I validated the use of TVGR in neuralized animal caps to find direct transcriptional targets of Wnt signaling. Detection of direct transcriptional targets requires inhibition of protein synthesis to prevent activation of secondary targets following translation of Wnt-induced transcripts. Cycloheximide (CHX) is a potent inhibitor of protein translation (Obrig et al., 1971) and provides a convenient tool to prevent the expression of secondary targets upon activation of a signaling pathway. To determine the dose of CHX I used was effective, I pretreated neuralized animal caps that were injected with TVGR with CHX, then induced with DEX, and assayed for known direct and indirect transcriptional targets of Wnt (Figure 4.5 A). CHX treatment prior to activation of TVGR did not prevent activation of the direct transcriptional target meis3 (Elkouby et al., 2010) but blocked expression of the indirect target hoxb9 (Domingos et al., 2001) (Figure 4.5 B). These results demonstrated that the conditions I used were sufficient to induce neural tissue, posteriorize it via Wnt activation and finally, enrich for direct targets.
Next, total RNA from animal caps treated with noggin alone (anterior neural sample), neuralized caps with activated TVGR (posteriorized neural sample) and neuralized animal caps treated with CHX prior to TVGR activation via DEX addition (direct target sample) was harvested. The RNA from these samples were used to construct RNA-seq libraries which were then 76-basepair single-end sequenced. The resulting sequence reads were mapped to a collection of 10,088 non-redundant, full-length Xenopus laevis cDNA sequences (http://xgc.nci.nih.gov). Data analysis was preformed by first aligning the reads using the programs TOPHAT(Trapnell et al., 2009) and BOWTIE (Langmead et al., 2009) to map the reads to cDNA sequences and then using CUFFDIFF (Trapnell et al., 2010) to determine differences in read quantities between samples. This analysis identified 228 genes greater than 2-fold increased in the direct target sample when
48
compared to the anterior neural sample (Appendix 1). Enrichment of the direct target meis3 (Elkouby et al., 2010) as well as cdx2 (Wang and Shashikant, 2007) in the direct target sample reads provided confirmation that this screen and analysis were successful in identifying Wnt target genes and suggests that candidates are likely to be direct targets.
While I found over 200 genes with enriched expression when directly activated by Wnt, this method of analysis was limited because the reads were mapped to a cDNA library in lieu of a full genome. Any genes absent from this library would have been missed and it is likely that there are more potential Wnt targets to be identified. With the recent sequencing of Xenopus laevis, it is now possible to repeat the bioinformatic analysis using the genome and potentially reveal more candidate target genes. Furthermore, comparing the results from the screen described here to those obtained from β-catenin chromatin immunoprecipitation (ChIP) will provide a complementary approach for detection of direct Wnt targets. ChIP-Seq will also identify the enhancers and promoters that mediate Wnt regulation of the identified target genes allowing for insight into the mechanism of gene regulation via Wnt signaling.
This screen aimed to identify novel factors that mediate Wnt signaling to posteriorize the neural plate, therefore I prioritized the candidate genes that are likely to function in patterning by first assaying expression of transcription factors, RNA binding proteins, and various signaling proteins. These genes need to be expressed at the right developmental timepoint and relevant tissue to play a role in Wnt mediated neural patterning. Accordingly, I assayed expression of selected candidates via in situ hybridization in Xenopus tropicalis embryos during gastrulation and neurulation to identify those that are expressed in the posterior neurectoderm. In addition to the known neural Wnt targets identified in the screen, several of the selected transcription factors had detectable expression in neurula stages. The transcription factors ahctf1 (Figure 4.6, A-C), foxi4.2 (Figure 4.6, D-F), and churchill (Figure 4.6 G-I) were barely expressed over background staining but show some weak staining in the posterior. zmiz1 is first detected in the posterior neural plate at the onset of neurulation and becomes restricted to two posterior stripes in the spinal cord anlage by stage 15 (Figure 4.6, J-L). In mice, ahctf1, the gene responsible for the Elys mutation, and zmiz1 are expressed in the developing spinal cord (Beliakoff et al., 2008; Kimura et al., 2002). However their roles in A-P patterning have not been established. max (Figure 4.6 M-O), originally reported to be ubiquitously expressed (Newman and Krieg, 1999), and znf384 are expressed in the presumptive neural plate at gastrulation and show enrichment in the posterior neural region at neurulae stages (Figure 4.6 P-R). The Spalt-like genes sall1 (Figure 4.6 S-U) and sall4 (Figure 4.6 V-X) are expressed at gastrulation in the presumptive neural plate and show robust expression in the posterior neural plate in later stages. The role of the sall genes in human diseases (Kohlhase et al., 2002; Kohlhase et al., 1998), stem cell maintenance (Zhang et al., 2006), and limb development (Neff et al., 2005) have been studied but a neural patterning role has not been described. Unexpectedly, sox11 was identified in the screen and is expressed in the neural plate but is absent from the most posterior region. This could be the result of secondary repression wherein the function of a different factor that normally represses sox11 expression in this region is relieved when the tissue was treated with CHX (Figure 4.6 Y-Aa).
49
The splicing factor fus was shown to be crucial for gastrulation via regulation of multiple developmental pathways (Dichmann and Harland, 2012). It is possible that RNA-binding proteins may play a previously unappreciated role in A-P patterning. Both heterologous nuclear ribonuclear proteins hnRNPk (Figure 4.7 A-C) and hnRNP H3 (Figure 4.7 D-F) are expressed in the posterior neural plate. The genes encoding splicing factors sf3b4 (Figure 4.7 G-I) and sap130 (Figure 4.7 J-L) show specific expression dorsally around the blastopore at stage 12 which becomes more enriched at the midneurula stage. These factors are known to interact with each other (Kotake et al., 2007; Menon et al., 2008) and sf3b4 has been implicated in bone development (Watanabe et al., 2007), a process that is also regulated by Wnt signaling (reviewed in (Williams and Insogna, 2009). Two additional genes encoding splicing factors sfrs7 and sfrs6 were also identified in this screen (Figure 4.7 M-R). sfrs7 is specifically expressed in posterior regions and sfrs6 also shows a posterior neural expression domain at stage 12. However the staining is faint and does not show specific expression at stage 15. A role for RNA-binding proteins and splicing factors in mediating neural A-P patterning has not been described or implicated. The neural expression of identified RNA binding factors is strong evidence that these proteins are important in neural patterning. It will be interesting to determine if the splicing factors identified in this screen comprise a core of Wnt-regulated splicing proteins that function in cell fate specification.
In addition to transcription and RNA binding factors, the planar cell polarity gene prickle1 (Wallingford et al., 2002) is expressed in the midline and enriched in the posterior (Figure 4.8 A-C). Prickle homologs have been shown to mediate movements during gastrulation, but morpholino studies in Xenopus and zebrafish have not revealed a role in neural A-P patterning (Takeuchi et al., 2003). It remains to be tested if there is functional redundancy between the prickle genes in neural patterning or if there simply is not a role for Prickle in this process. Finally, the adhesion molecule Lmo7 (Ooshio et al., 2004)shows punctate expression in the neural plate, although no function in neural development for this gene has been established previously (Figure 4.8 D-F).
Many of the candidates identified in the screen are enriched in the posterior neural region demonstrating the effectiveness of this method to identify novel targets of Wnt signaling. However, not all of the candidates identified in the screen were expressed in the neural plate or were detectable via in situ hybridization. One explanation could be that the expression of these genes is below the threshold of detection by this method. This does not explain however, why some genes found to be highly expressed in the RNA-seq data were not detected via in situ hybridization. These could be false positives that result from the nature of the analysis. The software packages used to align and quantitate reads also find splice junctions which could lead to spurious results when reads are aligned to an index of spliced cDNAs as was done for this screen. An alternative explanation is that the activation of Wnt signaling in the animal caps is not physiological and results in activation of targets that are not normally expressed during early or mid-neurula stages. However, this is likely to be a minority of the data set as 17 of 22 previously unknown posterior neural genes showed specific posterior expression. Another
50
possibility is that some of the identified genes are subject to repression via secondary targets. Therefore, these genes would not be detected in wild-type embryos but would be highly expressed in conditions where Wnt was activated in the presence of CHX.
While I prioritized transcription factors and RNA-binding proteins, there are other important classes of genes identified in the screen that could play crucial roles in meditating A-P neural patterning. For example, molecules involved in signal transduction and chromatin remodeling likely have significant effects in Wnt-signaling and downstream gene expression. Further analysis of candidates identified in this screen will provide a more complete understanding of Wnt-mediated neural patterning.
51
Figure 4.1: Model of Wnt-induced patterning of the neural anterior-posterior axis. Schematic of a proposed Wnt gradient and anterior-posterior patterning of the neural plate.
52
53
Fore
brai
nM
idbr
ain
Hin
dbra
inSp
inal
Cor
d
Not
ocho
rdSo
urce
of B
MP
anta
goni
sts
Hea
d M
esod
erm
Sour
ce o
f BM
P an
d W
nt a
ntag
onis
ts
Wnt
Sou
rce:
par
axia
l mes
oder
m
1. B
MP
anta
goni
sts
indu
ce n
eura
l tis
sue
from
e
ctod
erm
al p
recu
rsor
s.
2. N
eura
l tis
sue
is th
en p
oste
rioriz
ed b
y a
g
radi
ent o
f FG
F, R
A, a
nd W
nt.
Figure 4.2: Temporal expression of anterior posterior neural markers in Xenopus tropicalis. In situ hybridization for otx2 (A-F), engrailed2 (en2) (G-L), krox20 (M-L), and hoxb9 (S-X). Dorsal views with anterior towards the top.
54
55
10.5
1112
1314
15otx2 en2 krox20 hoxb9
NF
Stag
e
AB
CD
EF
GH
IJ
KL
MN
OP
QR
ST
UV
WX
Figure 4.3: TVGR activates canonical Wnt signaling. (A) Quantification of secondary axis induction by ventral-vegetal injection of TVGR at the 4-cell stage. (B) Uninjected control tadpole. (C) TVGR injected tadpole. (D) TVGR injected tadpole treated with 0.4% EtOH. (E) TVGR injected tadpole treated with 10 µM DEX, red staining shows β-galactosidase (tracer).
56
57
0%20%
40%
60%
80%
100%
Com
plet
e 2º
Axi
sPa
rtia
l 2º
Axis
Norm
al
TV
GR
/Dex
Ind
ucti
on o
f W
nt S
igna
ling
U.C
.0.
2%E
tOH
DE
X0.
4%E
tOH
DE
X
U.C
.
AB C D E
Figure 4.4: TVGR efficiently posteriorizes neuralized ectodermal explants. (A) Strategy to use TVGR to induce Wnt signaling in animal caps. (B) RT-PCR on 5 embryos or 25 animal caps treated with the indicated reagents. -RT: reaction done in the absence of Reverse Transcriptase, epi. ker: epidermal keratin (epidermis), mus. act.: muscle actin (mesoderm). When indicated the following doses were used: noggin 10 pg, TVGR 4 pg, Dexamethasone: 10 µM (C) Animal caps treated with the indicated reagents.
58
59
A
B
Inje
ctno
ggin
+TV
GR
Exci
sean
imal
ca
ps10
uM
DEX
isol
ate
RN
A a
tst
age
15eq
uiva
lent
2-ce
llst
age
9 C
noggin
-RT
otx2
krox
20en2
hoxb
9
epi.
ker.
mus
. act
.
eef1
a1
UC
nogg
in
nogg
in/T
VGR
+EtO
Hno
ggin
/TVG
R+D
EX
Figure 4.5: Cycloheximide treatment prior to TVGR induction enriches for direct Wnt targets in neuralized ectodermal explants. (A) Strategy to use animal caps to screen for direct transcriptional targets of Wnt signaling in neural tissue. (B) Semi-quantitative qPCR on either 5 whole embryos or 25 animal caps treated with the indicated reagents and used for RNA-seq library synthesis. meis3 and hoxb9 serve as controls for direct and indirect targets of Wnt signaling, respectively. When indicated, the following doses were used: noggin 10 pg, TVGR 4 pg, Dexamethasone 10 µM.
60
61
Inject
noggin+
TVGR
Excise
animal
caps
5 uM
CHX
10 uM
DEX
1.5hrs
isolate
RNA at
stage 15
equivalent2-cell stage 9
A
noggin
TVGR
EtOH
Dex - - - - - - +
- - - - - + -
- - + - - + +
- + + - + + +
Whole Embryo Animal Caps
hoxb9
hoxb9
meis3
eef1a1
5 µ
M C
yclo
hexim
ide
-RT
B
Figure 4.6: Expression patterns of transcription factors identified in the screen for direct Wnt targets. In situ hybridization of selected genes in Xenopus tropicalis. Dorsal-vegetal views of stage 10.5 embryos, dorsal views of stage 12 and 15 with anterior toward the top. NF stage: Nieuwkoop Faber stage (Nieuwkoop, 1967).
62
63
sall1
ahctf1
10.5 12 15
foxi4.2
sox11
sall4
10.5 12 15
max
zmiz1
znf384
churchill
NF stage
A B C D E F
G H I J K L
M N O P Q R
S T U V W X
Y X Aa
Figure 4.7: Expression patterns of RNA-binding factors identified in the screen for direct Wnt targets. In situ hybridization selected genes in Xenopus tropicalis. Dorsal-vegetal views of stage 10.5 embryos, dorsal views of stage 12 and 15 with anterior toward the top. NF stage: Nieuwkoop Faber stage (Nieuwkoop, 1967).
64
65
sf3b
4sf
rs7
sfrs
6
hnR
NPk
10.5 12 15
hnR
NP
H3
A B C D E F
G H I J K L
P Q R
sap1
30
10.5 12 15
NF stage
M N O
Figure 4.8: Expression patterns of identified Wnt targets prickle1 and lmo7. In situ hybridization in Xenopus tropicalis for indicated genes. Dorsal-vegetal views of stage 10.5 embryos, dorsal views of stage 12 and 15 with anterior toward the top. NF stage: Nieuwkoop Faber stage (Nieuwkoop, 1967).
66
67
prickle1
lmo7
10.5 12 15
NF stage
A B C
D E F
CHAPTER 5
Spalt-like 4 mediates Wnt-induced neural patterning via repression of pouV/Oct4 family members.
Introduction
Pieter
NieuwkoopOthers, 1952a). This hypothesis states that neural tissue is induced as an anterior state by the organizer, and then posteriorized by additional signals from the mesoderm to create
manipulation that blocks Bmp signaling in ectoderm results in cells adopting anterior neural fates
β
factors as mediators of anterior-posterior (A-P) neural patterning, the mechanism by which gene expression and discrete neural fates
remains poorly understood.
gbx2 is a
meis3,
cdx1 and cdx4
Xenopus, simultaneous
Drosophilaspalt result in
68
sall1 and sall4 cause the autosomal
sall4 is the best studied of the spalt homologs because of its role in maintaining and inducing pluripotency. sall4
sall4 null embryos fail to pou5f1 cdx2
sall4oct3/4, sox2, and klf4; sall4 along with oct3/4,
sox2 and klf4
sall2, sall3, and sall4early Xenopus
sall2of-function alleles of sall1, sall2 and sall4 result in mouse embryos with neural tube closure
sall genes in neural differentiation and/or
role for the sall genes in caudalization has not been elucidated.
Here, I show that sall4sall4 represses the stem cell factor pouV/Oct4 in order
to release cells from an undifferentiated state.
Results
In the previous chapter, I described a screen to identify direct targets of Wnt in neural tissue. That screen identified sall1 and sall4 as candidate Wnt targets that are involved in neural posteriorization. Since the sall genes were identified in a high-throughput screen, it was important to confirm that they were not false positives. To that end, I confirmed the results of my screen via the animal cap assay described in Figure 4.5 and quantitated transcript abundance with qPCR. Incubation with CHX prior to activation of TVGR in neuralized caps resulted in increased cdx2 (Figure 5.6A), sall1 (Figure 5.4A), sall4, and meis3, but not hoxb9, expression (Figure 5.1A). The activation of the sall genes by canonical Wnt activation in the absence of protein translation strongly suggests that they are direct targets of Wnt signaling in neural tissue.
As a complementary approach to using CHX-treated animal caps, I used chromatin immunoprecipitation (ChIP) followed by qPCR to examine whether β-catenin is bound to the sall4 genomic locus. β-catenin forms an activation complex with TCF/LEF in response to Wnt signaling to activate target genes (Behrens et al., 1996). Due to a lack of effective commercial β-catenin antibodies, I overexpressed a C-terminal FLAG-tagged version of X. laevis β-catenin.
69
Expression of the FLAG epitope was confirmed by immunoblotting (Figure 5.2A). The activity, dosage and specificity of FLAG-tagged β-catenin were tested by rescuing the β-catenin knockdown phenotype. β-catenin morphants lack dorsal structures, resulting in ventralized “belly pieces” (Heasman et al., 2000). Injection of β-catenin morpholino resulted in over 60% of embryos lacking dorsal tissue. Co-injection of FLAG-tagged β-catenin RNA restored dorsal structures, demonstrating both the specificity and activity of this construct (Figure 5.2B). Finally, I assayed dorsalization resulting from overexpression of FLAG-tagged β-catenin without morpholino injection. Consistent with Yost and colleagues (Yost et al., 1996), injection of 500 pg of RNA encoding tagged β-catenin did not significantly alter dorsal structures as measured by the dorsoanterior index (Kao and Elinson, 1985) (Figure 5.1B). I assume that the injected RNA results in β-catenin that enters the normal pool of unstable protein, and whose amount is subject to regulation by the normal signaling pathway (Yost et al., 1996).
The sall4 locus in Xenopus laevis contains four exons and three introns (Figure 5.1C). Scanning for consensus binding sequences within 3 kb of flanking sequence of the sall4 locus revealed six putative TCF/LEF binding sites (Elkouby et al., 2010; McKendry et al., 1997) within the first intron. Three of these sites are tightly clustered within a 150 bp span at positions +2347, +2387, and +2456 (relative to the predicted transcription start site) and are conserved in Xenopus tropicalis. The conservation and clustering of these sites suggested that this region could be regulated by β-catenin. Using FLAG antibodies for ChIP, this region was found to be significantly enriched compared to a negative control (xmlc2) region (Figure 5.1D). A –2.7 Kb region upstream of meis3 was used as a positive control for β-catenin binding (Elkouby et al., 2010). Anti-FLAG immunoprecipitations in uninjected control embryos resulted in negligible enrichment of any loci assayed. Taken together, activation via TVGR in the presence of CHX along with β-catenin binding to TCF/LEF sites in the first intron provide strong evidence that sall4 is a direct transcriptional target of Wnt signaling in the neurectoderm.
During gastrulation, sall4 is initially expressed in a broad domain throughout the marginal zone and the animal pole (Figure 5.3A). At stage 10, sall4 expression is restricted to the sensorial neurectodermal cells (cells that will give rise to the central nervous system) in animal dorsal regions (Fig 3E). At the onset of neurulation, sall4 is strongly expressed throughout the sensorial neurectodermal layer of cells in the neural plate (Fig 3B,F,G). Neural expression of sall4 in stage 15 (mid-neurula) embryos is in the hindbrain and spinal cord anlage (Figure 5.3C,H,I). Later stage neurulae (stage 18) strongly express sall4 in the posterior neural tube, hindbrain, developing placodes, and epidermis (Figure 5.3D,J,K). The posterior neural expression of sall4 and regulation by β-catenin and TCF/LEF make it a candidate for mediating Wnt-induced posteriorization of the neural plate.
sall1 is expressed in the dorsal ectoderm and involuting mesoderm during gastrulation (Figure 5.4 B,B’). Expression becomes restricted to the notochord and circumblastoporal collar at the early neurula stage (Figure 5.4C-C’’). Similar to sall4, sall1 is expressed in the spinal cord anlage at mid and late neurula stages (Figure 5.4D-D’’,E-E’’).
70
Given the neural expression of sall4 and its identification as a Wnt target in neuralized animal caps, I hypothesized that loss of Sall4 would affect neural patterning. To test this, I used morpholinos targeting sall4 and assayed for neural gene expression. Morphant embryos had neural tube closure defects and began to disintegrate and die at mid-tailbud stages. The neural tube closure defect is consistent with defects in neural patterning, so I assayed several markers of neural differentiation. The pan-neural marker sox2 was expressed in the neural plate in uninjected and Sall4 morphants, demonstrating that the dorsal ectoderm of morphants still retained a neural identity (Figure 5.5A,B). Conversely, the expression of n-tub, a marker for differentiating neurons, was markedly reduced but still present in morphants, suggesting that Sall4 is required for the second wave of neurogenesis in the tailbud tadpole (Figure 5.5C,D). Another marker for early motor neuron differentiation, nkx6.1, was expressed in the central nervous system of morphants. Neural crest cells were present as determined by the expression of snai2 (Figure 5.5E,F). Though present, these markers were expressed in a pattern more similar to early neurulae, suggesting either a delay or failure of terminal differentiation. Sall4 morphants expressed the dorsal mesoderm marker myoD in a similar pattern to uninjected control embryos, therefore, neural defects were not due to a major loss of paraxial mesoderm (Fig. G,H).
It is well understood that Wnt is a caudalizing factor in neural patterning, therefore if Sall4 mediates this process I predicted that Sall4 morphants would lose posterior neural identity. To test for this, Sall4 morpholinos were injected into one animal dorsal cell of 4-cell stage embryos to allow for comparison between injected and uninjected sides. Strikingly, the injected side of embryos showed a significant posterior shift in the expression of otx2 and krox20 relative to the control side (Figure 5.5I,J,Q). This shift suggested that knockdown of Sall4 results in an expansion of anterior neural identity at the expense of posterior neural differentiation, consistent with a Wnt loss-of-function phenotype. Accordingly, the injected side had a significant reduction in the expression domain of the spinal cord marker hoxb9 (Figure 5.5K,L). Furthermore, the expression of two other markers for spinal cord differentiation, hoxc10 (Figure 5.5M,N) and hoxd10 (Figure 5.5O,P) was significantly reduced following Sall4 knockdown (Figure 5.5R,S,T). However, Sall4 knockdown does not equally reduce cdx2 expression, another identified direct Wnt target (Figure 5.6B,C). These results demonstrate that Sall4 is required for specification of posterior neural tissue.
The failure of Sall4 morphants to induce posterior fates in neural tissue suggested that the caudal tissue remained in an undifferentiated stem-like state. Sall4 positively regulates the stem cell factor Oct4/pou5f1 locus in the inner cell mass of mouse embryos to maintain pluripotency (Zhang et al., 2006). Since the posterior neurectoderm failed to differentiate in Sall4 morphants, I hypothesized that Oct4 prevents neural differentiation in the morphants because Sall4 was negatively regulating pou5f1 in the neural tissue of Xenopus. There are three class V Pou-domain proteins in Xenopus with similar sequence and syntenic organization to mammalian pou5f1/Oct4: pou25, pou60, and pou91, henceforth referred to as pouV/Oct4 (Morrison and Brickman, 2006).
71
If Sall4 negatively regulates pouV/Oct4, Sall4 morphants should have increased expression of these factors. Indeed, knockdown of Sall4 in unilateral and bilateral injections resulted in ectopic expression of pou25 (Figure 5.7A,B,C), pou60 (Figure 5.7D,E,F), and pou91 (Figure 5.7G,H,I). Accordingly, the increase in expression of pou25 and pou91 was the greatest in the neural tube where sall4 is normally expressed. pouV/Oct4 expression in Sall4 morphants relative to control embryos was quantified via qPCR and displayed a significant increase in all three of the pouV/Oct4 genes (Figure 5.7O,P,Q). Co-injection of Xenopus tropicalis sall4 RNA that is not targeted by the Sall4 morpholino resulted in a partial rescue of the pou25 expression level and restored pou60 and pou91 expression to wild-type levels (Figure 5.7O,P,Q). These experiments demonstrate that loss of Sall4 relieves repression of the pouV/Oct4 homologs, resulting in an overexpression of pouV/Oct4 stem cell factors in the neural plate.
A second, non-overlapping Sall4 morpholino (MO2) was used as an additional control for specificity. If the above results are indeed due to Sall4 knockdown, then this second morpholino should result in the same phenotype. As seen with the first Sall4 morpholino, I found that injection of the Sall4 MO2 resulted in a similar loss of hoxb9 (Figure 5.8A,B) and hoxd10 (Figure5.8C,D) expression as well as a posterior shift in oxt2 and krox20 expression (Figure 5.8A,B). The Sall4 MO2 also resulting in ectopic expression of pou91 (Figure 5.8E,F). These results demonstrate that the morpholinos targeting Sall4 are specific and effective. Next, I asked whether ectopic pouV/Oct4 expression is sufficient to block posterior neural differentiation by injecting RNA for the three pouV/Oct4 genes unilaterally into embryos and assaying A-P neural gene expression. Neural plate cells expressing ectopic pouV/Oct4 as traced by the co-injected marker β-galactosidase did not express hoxb9, whereas cells on the uninjected side expressed this spinal cord marker (Figure 5.7J,K,L,M,N). The increase in pouV/Oct4 expression in Sall4 morphants, together with the result that ectopic expression of these genes inhibited posterior neural differentiation, provides evidence that the loss of caudal identity in morphants is due to pouV/Oct4 overexpression.
The observed pouV/Oct4 increase following knockdown of Sall4 suggested a mechanism for the loss of posterior neural identity whereby the ectopic pouV/Oct4 expression prevents differentiation of neural tissue into spinal cord. I therefore reasoned that depleting pouV/Oct4 in Sall4 morphants would restore posterior neural identity. To that end, morpholinos targeting the three pouV/Oct4 homologs(Morrison and Brickman, 2006) were co-injected with Sall4 morpholinos. Consistent with results described above, knockdown of Sall4 resulted in a loss of expression of the spinal cord markers hoxb9 (Figure 5.9A,E), hoxc10 (Figure 5.9B,F), and hoxd10 (Figure 5.9C,G) but not in a loss of the pan-neural marker sox2 expression (Figure 5.9D,H). Co-injection of the pouV/Oct4 morpholinos with Sall4 morpholinos restored posterior neural gene expression lost by Sall4 knockdown alone (Figure 5.9I,J,K). Though reduced, sox2 was expressed in the neural plate of Sall4-pouV/Oct4 morphants (Figure 5.9L). Finally, comparing the length of the hox gene expression domains in Sall4 and Sall4-pouV/Oct4 morphants revealed a significant rescue of all three spinal cord markers in the quadruple morphants (Figure 5.9N). pouV/Oct4 knockdown resulted in anterior defects, evidenced by
72
mispatterning of the otx2 and krox20 expression domains and a lateral expansion of hoxb9, consistent with a role for the Oct4 homologs in repressing posterior neural identity (Figure 5.9M). My results demonstrated that Wnt-signaling induces Sall4 expression, which represses pouV/Oct4 allowing posterior neural differentiation. Yet posterior patterning of the neural plate also occurs in response to Fgf and RA signaling. If Sall4 were required to repress pouV/Oct4 in order to allow for caudal differentiation, then depletion of Sall4 should block posteriorization by Fgf and RA. Therefore, I tested whether repression of pouV/Oct4 via Sall4 is required for both Fgf- and RA-induced caudalization.
To address the question of whether Fgf-induced caudalization requires Sall4, uninjected and Sall4 morphant embryos were injected with fgf8a RNA. Again, Sall4 knockdown resulted in a loss of hoxb9 expression (Figure 5.10A,B) without major alterations to sox2 expression (Figure 5.10E,F). Overexpression of fgf8a in the dorsal ectoderm resulted in an expansion of hoxb9 (spinal cord) expression, lateral expansion of krox20 expression, and repression of otx2 (brain) (Figure 5.10C) (Fletcher et al., 2006). Overexpressing fgf8a in Sall4 morphants resulted in otx2 repression, but also resulted in a loss of hoxb9 expression (Figure 5.10D). krox20 expression in rhombomere 5 was severely reduced in the Sall4 morphants despite fgf8a overexpression while rhombomere 3 expression remained expanded. These results support the conclusion that Sall4 is required for Fgf-induced posterior neural differentiation.
To address the question of whether RA-induced caudalization requires Sall4, uninjected and Sall4 morphant embryos were incubated in RA. Increasing RA signaling results in severe loss of anterior neural tissue and expansion of posterior identities (Blumberg et al., 1997; Durston et al., 1989; Ruiz i Altaba and Jessell, 1991; Shiotsugu et al., 2004; Sive et al., 1990). Uninjected control embryos treated with 1 µM all-trans retinoic acid (ATRA) lacked otx2 and krox20 but had hoxb9 expression (Figure 5.10I). Sall4 morphant embryos treated with 1 µM ATRA failed to express otx2 and krox20, however, they also failed to express hoxb9 (Figure 5.10J). The reduction of these markers was not due to a loss of neural tissue as sox2 expression was similar among control embryos, embryos treated with ATRA, and Sall4 morphant embryos treated with ATRA (Figure 5.10E,K,L). Thus, Sall4 is required for caudalization of the neural plate via both Fgf and RA signaling.
Discussion
Wnt, Fgf, and RA signaling are caudalizing factors required for posteriorization of the neural plate. However, the transcription factors identified to mediate patterning signals from these pathways have largely been restricted to those specifying midbrain and hindbrain fates. In this study, I show that canonical Wnt signaling directly activates sall4, which is required for spinal cord differentiation. The primary role of Sall4 in Wnt-induced posterior patterning is the repression of the pouV/Oct4 homologs. This repression is necessary for spinal cord differentiation; Sall4 knockdown as well as pouV/Oct4 overexpression results in a loss of spinal
73
cord fate. Furthermore, the posterior defects in Sall4 morphants can be rescued via pouV/Oct4 knockdown. The data presented here suggest a model whereby the repression of pouV/Oct4 via Sall4 provides a permissive environment, allowing cells in the neural plate to respond to posteriorizing signals from Fgf, RA, and Wnt (Figure 5.10M).
Other studies have shown interactions between Wnt signaling and Sall factors. Sall2 (published as XsalF) functions as a Wnt antagonist in anterior neural tissue (Onai et al., 2004). Our work found sall4 to be directly activated by Wnt signaling in the neurectoderm. TCF/LEF binds to and activates the sall4 gene in human cell culture lines at a conserved binding site within the promoter (Böhm et al., 2006). This conservation is restricted to mammals: the chick Gallus gallus and Xenopus lack TCF/LEF sites in the promoter regions of sall4. However, the first intron of Xenopus laevis sall4 contains six putative consensus TCF/LEF binding sites, three of which are found within a 150 bp region and conserved in Xenopus tropicalis, though not in chickens. Our finding that this region is enriched upon β-catenin ChIP demonstrates that β-catenin is bound to it during late gastrulation at the appropriate time to transduce the Wnt signal and activate sall4, resulting in the down-regulation of pouV/Oct4. In the future, mutagenesis of the consensus binding sites will test whether they are indeed required for Wnt-induced sall4 expression.
Our results provide a novel mechanism of neural posteriorization wherein Wnt signaling activates sall4 in order to repress inhibitors of neural differentiation. A key prediction of this mechanism is that a requirement for Sall4 in adoption of posterior fates would not be restricted to Wnt-induced posteriorization. Therefore, one would expect that the increase in pouV/Oct4 expression resulting from Sall4 knockdown would inhibit differentiation that was induced by other caudalizing factors. Indeed, I found Sall4 knockdown prevented induction of hoxb9 by Fgf or RA. Future experiments will test whether overexpression of pouV/Oct4 is sufficient to block posteriorization by Fgf and RA. While I show that sall4 is a target of Wnt signaling, it remains possible that sall4 is also regulated by other signaling pathways. In flies, spalt is regulated by Dpp (BMP), Hedgehog and EGF signaling, depending on tissue type (de Celis et al., 1996; Elstob et al., 2001; Sturtevant et al., 1997). sall1 is regulated by both Fgf and Wnt signaling in the chick limb (Farrell and Münsterberg, 2000) and sall4 is expressed in the Xenopus limbs during development and regeneration (Neff et al., 2011). The expression pattern of sall4 at early neurula stages is broader than what would be expected for a gene solely regulated by Wnt. This suggests possible activation via multiple pathways. One possibility could be that sall4 expression is regulated through different enhancers, each responsible for different expression domains. In the chick, sox2 is expressed throughout the neural plate but is regulated by five different enhancers, each responsible for a portion of the full expression domain (Uchikawa et al., 2003). Furthermore, Fgf and Wnt signaling converge on one such enhancer, N-1, to mediate the most posterior expression of sox2 in the neural plate (Takemoto et al., 2006).
74
Fgf signaling is sufficient to posteriorize neurectoderm (Christen and Slack, 1997; Fletcher et al., 2006; Kengaku and Okamoto, 1995; Lamb and Harland, 1995), and I found this activity requires Sall4. Therefore, it is possible that FGF and canonical Wnt signaling converge on an as-yet unidentified enhancer to regulate sall4 expression. As in the sox2 N-1 enhancer, Wnt- and Fgf- responsive elements in the enhancers of pax3 and zic genes cooperatively regulate their expression (Garnett et al., 2012), and both pathways are required for expression of these genes at the neural plate border (Monsoro-Burq et al., 2005). Multiple studies have identified Wnt signaling as a key factor in stem cell maintenance and differentiation (Wang and Wynshaw-Boris, 2004). In amphibians, caudalization of the neural plate via canonical Wnt signaling induces undifferentiated neural precursors to commit to posterior fates. This induction requires repression of stem cell factors and the activation of differentiating factors. In Xenopus, pouV/Oct4 play a conserved role in maintaining pluripotency of uncommitted cells (Morrison and Brickman, 2006). pouV/Oct4 are first expressed animally in cleavage stages and throughout the mesoderm and ectoderm of amphibian gastrulae (Frank and Harland, 1992; Morrison and Brickman, 2006). Knockdown of pouV/Oct4 results in precocious cell fate commitment in the three germ layers (Morrison and Brickman, 2006; Snir et al., 2006). The spatiotemporal expression of pouV/Oct4 serves to prevent these cells from adopting inappropriate fates due to premature response to differentiating signals. Accordingly, pouV/Oct4 overexpression prolongs the undifferentiated state (Archer et al., 2011; Morrison and Brickman, 2006). Our results suggest that pouV/Oct4 expression must be down-regulated in the neurectoderm to allow for cells to respond to instructive Wnt/Fgf/RA signals and commit to posterior fates. Wnt signaling activates cdx1 (Pilon et al., 2007; Prinos et al., 2001) and in frogs, Cdx1 represses pouV/Oct4 gene expression at the onset of gastrulation (Rousso et al., 2011). However, knockdown of Cdx1 does not result in a loss of spinal cord differentiation, and combinatorial knockdown of Cdx1/2/4 is required before hoxb9 and hoxc10 expression is reduced (Faas and Isaacs, 2009). There is, however, a dramatic loss of hoxb9, hoxc10, and hoxd10 expression in Sall4 morphants. In the absence of Sall4, pouV/Oct4 expression remains high, resulting in neural cells being unable to commit to a posterior neural fate and differentiate into spinal cord. Our results suggest that Sall4, and not Cdx1, acts as the main negative regulator of pouV/Oct4 in the neurectoderm.
My findings are consistent with described roles for the cdx genes in Wnt-mediated neural patterning. Several studies have shown the Cdx factors function to regulate posterior hox gene expression in vertebrates (Gaunt et al., 2004; Gaunt et al., 2008; Isaacs et al., 1998; van den Akker et al., 2002). Therefore, Wnt acts as an instructive signal through activation of cdx genes to induce posterior hox genes, thereby transforming the neural precursors into a posterior fate. Here, I find that canonical Wnt also induces the expression of sall4 to repress pouV/Oct4, providing a parallel, permissive signal for the induction of posterior hox gene expression via Cdx factors. Wnt still signals in posterior neural regions of Sall4 morphants - presumably activating cdx genes - but the prolonged expression of pouV/Oct4 prevents hox gene expression and
75
adoption of spinal cord fates. Conversely, it’s likely that Wnt induces sall4 expression in Cdx morphants, priming the neural plate to respond to other instructive signals that induce posteriorization. This mechanism could explain the finding that knockdown of individual Cdx homologs results in minor phenotypes.
The interaction between Sall4 and Oct4 has been well studied in cell culture and mouse embryos. In the ICM of mouse embryos and in iPS cells, Sall4 positively regulates Oct4/pou5f1 expression allowing for self-renewal and suppression of differentiation (Tsubooka et al., 2009; Zhang et al., 2006). However, I found Sall4 knockdown resulted in increased pouV/Oct4 gene expression in neural tissue, which suggests that Sall4 negatively regulates the Oct4 homologs in Xenopus neurectoderm. One explanation for this apparent discrepancy is that cellular context affects whether Sall4 will act as a transcriptional activator or repressor. The N-terminus of Sall4 recruits DNA methyltranferases and the NuRD complex resulting in transcriptional inhibition of target genes in HEK293 cells(Yang et al., 2012). Conversely, in embryonic stem (ES) cells, Sall4 was found to directly bind to the promoter of pou5f1/Oct4 and activate transcription (Zhang et al., 2006). Additionally, Sall4 regulates distinct circuitries between ES and extra-embryonic endoderm cells, presumably due to the presence of different co-factors (Lim et al., 2008). Therefore, it is likely that the regulation of pouV/Oct4 via Sall4 is conserved but is repressive in the context of Xenopus neurectoderm. It remains unclear, however, if this regulation is direct or indirect. While the mechanistic role of Sall4 in the neural plate is likely to be complex, our experiments demonstrate Sall4 to be a pivotal factor in neural patterning.
76
Figure 5.1: sall4 is a direct transcriptional target of canonical Wnt-signaling. (A) qPCR on 5 whole embryos or 15-25 animal caps treated according to the conditions indicated on the X-axis. The Y-axis shows relative expression to odc. meis3 and hoxb9 serve as controls for known direct and indirect targets of Wnt-signaling, respectively. (B) Quantification of dorsalization in uninjected embryos (open bars) and embryos injected animally with 500 pg FLAG-tagged β-catenin RNA (250 pg/blastomere) at the 2-cell stage (filled bars) as scored by the dorsoanterior index (DAI). Error bars show 1 standard deviation from the mean. Images show a representative uninjected (UC) embryo with an DAI of 7 (normal) and a representative embryo with a DAI of 6 (kinked axis). (C) Schematic of the sall4 genomic locus in Xenopus laevis. Blue boxes indicate exons and yellow circles indicate the location of putative TCF/LEF binding sites. Black ovals show the locations of the zinc-finger domains. Numbers indicate the position of putative binding sites relative to the transcription start site (TSS). Red octagon shows the stop codon. (D) Chromatin immunoprecipitation of FLAG-tagged β-catenin in late gastrulae/early neurulae. Open bars represent uninjected embryos and closed bars represent embryos injected with 500 pg FLAG-tagged β-catenin (250 pg/blastomere at the 2-cell stage). Error bars represent one standard deviation from the mean per cent input for each measurement. meis3 and xmlc2 serve as positive and negative controls for β-catenin binding, respectively. Means were compared to the negative control (xmlc2) by one-way ANOVA followed by Tukey post-hoc analyses (*: p<0.05).
77
78
0
1
2
3
4
5
6
7
8
0
100
200
300
400 meis3
0
1
2
3
4
5
6hoxb9
50
150
250
350
450 sall4
nogginTVGREtOHDEXCHX
- - + + + +- - - + + +- - - + - -- - - - + +- - - - - +
Animal CapsWE
sall4
+2347
+2387
+2456
+2882
+3085
+3885+0 TSSE1 E2 E3 E4
AA B
C
0
0.02
0.04
0.06
0.08
0.1
0.12
0.14
0.16
0.18
sall4intron 1
FLAGUC
% In
put
meis3xmlc2
DA
I
500 pg FLAG -catenin
UC
DAI:7
DAI:6
D*
Figure 5.2: Injected embryos express functional FLAG-tagged β-catenin. (A) Western blot for the FLAG epitope in injected embryos. Actin serves as the loading control. (B) Ventralization of embryos injected with β-catenin MO or co-injection of β-catenin MO with different doses of FLAG-tagged β-catenin RNA. F-βcat: FLAG-tagged β-catenin.
79
80
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
UC 250 pgF- cat
350 pgF- cat
500 pgF- cat
750 pgF- cat
+ 10 ng -catenin MO
Normal
Partiallyventralized
Ventralized
B
UC500 pg
FLAG- -catenin1000 pg
FLAG- -catenin
ANTI-FLAG
ANTI-Actin
A
Figure 5.3: sall4 is expressed in the neurectoderm. (A-D) Whole-mount in situ hybridizations of sall4 in Xenopus laevis embryos. (A) Whole mount stage 10 embryo stained for sall4, dorso-vegetal view with the dorsal lip of the blastopore oriented towards the top. (B-D) Neurula stage embryos are shown in dorsal view, with anterior toward the top. (E) Sagittal section of stage 10 embryo stained for sall4 expression, animal pole is to the top and dorsal is to the right. (F-G) Transverse sections of stage 12 embryos stained for sall4, (F) anterior and (G) posterior. (H-I) Transverse sections of stage 15 embryos stained for sall4, (H) anterior and (I) posterior. (J-K) Transverse sections of stage 18 embryos stained for sall4, (J) anterior and (K) posterior. (E-K) 50µM sections, (F-K) all embryos are oriented with dorsal towards the top. SNE: sensorial neurectoderm, No: notochord, S: somite, PM: paraxial mesoderm, PSM: presomitic mesoderm.
81
82
AB F G
CD
HJ K
1012
1518
I
No
SS
SNE
E
F G
H
I
J
K
E
No
SS
No
PSM
PSM
No
PM
PM
No
PSM
PSM
Figure 5.4: sall1 is directly activated by canonical Wnt signaling and expressed during early embryogenesis. (A) qPCR on 5 whole embryos or 15 to 25 animal caps treated according to the conditions indicated on the X-axis. The Y-axis shows expression relative to odc. (B-E) Whole-mount in situ hybridizations of sall1 in Xenopus laevis embryos. (B) Whole mount stage 10 embryo stained for sall1, dorso-vegetal view with the dorsal lip of the blastopore oriented towards the top. (B’) Sagittal section of stage 10.5 embryo stained for sall1 expression, animal pole is to the top and dorsal is to the right. (C-D) Dorsal views of indicated neurula stage embryos, anterior is oriented towards the top. (C’-C’’) Transverse sections of stage 12 embryos stained for sall1, (C’) anterior and (C’’) posterior. (D’-D’’) Transverse sections of stage 15 embryos stained for sall1, (D’) anterior and (D’’) posterior. (E’-E’’) Transverse sections of stage 18 embryos stained for sall1, (E’) anterior and (E’’) posterior. (B’, C’-E’’) 50 µM sections, (C’-E’’) dorsal oriented towards the top. No: notochord, S: somite, PSM: presomitic mesoderm.
83
84
AB
12 15 18
50
150
250
350
450 sall1
nogginTVGREtOHDEXCHX
- - + + + +- - - + + +- - - + - -- - - - + +- - - - - +
Animal CapsWE
B’
C
C’
C’’
C’
C’’
D
D’
D’’
D’
D’’
E
E’
E’’
E’’
E’
No
No
No
No
NoS S S S
PSM PSM PSM PSM
10 10.5
Figure 5.5: Loss of Sall4 results in a loss of posterior neural differentiation. (A-P) Whole-mount in situ hybridization late neurula stage embryos shown in dorsal view with the anterior toward the top. (A, C, E, G) uninjected control embryos and (B, D, F, H) embryos injected bilaterally with 40 ng Sall4 MO (20 ng/blastomere at the 2-cell stage) . (A-B) Expression of sox2 (C-D) Expression of n-tub. (E-F) Expression of snai2 and nkx6.1 (G-H) expression of myoD. (I, K, M, O) Uninjected control embryos and (J, L, N, P) embryos injected with 20 ηg Sall4 MO into the right animal-dorsal (A/D) blastomere. (I-J) Expression of otx2/krox20/hoxb9, arrows show the relative anterior-posterior position of krox20 and the anterior limit of hoxb9. (K-L) Posterior view of hoxb9 expression. (M-N) Posterior view of hoxc10 expression. (O-P) Posterior view of hoxd10 expression. (Q-T) Quantification of A-P patterning defects associated with Sall4 knockdown. (Q) Measurement of the length between the anterior-most expression of otx2 and the first krox20 stripe in arbitrary units (AU) between the left (open bars) and right (closed bars) side of uninjected control embryos and embryos injected with 20 ng Sall4 MO into the right A/D blastomere. (R) Measurement of the length of hoxb9 expression domain in arbitrary units (AU) between the left (open bars) and right (closed bars) side of uninjected control embryos and embryos injected with 20 ng Sall4 MO into the right A/D blastomere. (S) Measurement of the length of hoxc10 expression domain in arbitrary units (AU) between the left (open bars) and right (closed bars) side of uninjected control embryos and embryos injected with 20 ng Sall4 MO into the right A/D blastomere. (T) Measurement of the length of hoxd10 expression domain in arbitrary units (AU) between the left (open bars) and right (closed bars) side of uninjected control embryos and embryos injected with 20 ng Sall4 MO into the right A/D blastomere. Error bars represent one standard deviation from the mean. Means were compared between left and right sides by student’s T-test (*: p<0.05, **:p<0.01, ***:p<0.001).
85
86
0 2 4 6 8 10
12
UC
Sal
l4 M
OR
ight
A/D
Cel
l
0 5 10
15
20
25
30
35
UC
Sal
l4 M
OR
ight
A/D
Cel
l
0 2 4 6 8 10
12
14
16
18
UC
Sal
l4 M
OR
ight
A/D
Cel
l
0 5 10
15
20
25
30
UC
Sal
l4 M
OR
ight
A/D
Cel
l
otx2/krox20/hoxb9
hoxb9
hoxc10
hoxd10
IJ
QLe
ftR
ight
UC
Sall4
MO
righ
t A/D
cel
l
n-tub
sox2
snai2/nkx6.1
myoD
AB
KL
RC
D
MN
SE
F
OP
TG
H
UC
Sall4
MO
(bila
tera
l)
Length (AU) Length (AU) Length (AU)Length (AU)
* *** *
**
Figure 5.6: cdx2 is directly activated by canonical Wnt signaling and is not affected by Sall4 knockdown. (A) qPCR on 5 whole embryos or 15 to 25 animal caps treated according to the conditions indicated on the X-axis. The Y-axis shows expression relative to odc. (B-C) cdx2 expression at stage 18 shown in dorsal view with the anterior toward the top. (B) Uninjected control embryo. (C) Embryo injected with 20 g Sall4 MO in one animal-dorsal cell at the 4-cell stage.
87
88
50
150
250
350
450
nogginTVGREtOHDEXCHX
- - + + + +- - - + + +- - - + - -- - - - + +- - - - - +
Animal CapsWE
cdx2A
B CUC Sall4 MO right A/D cell
cdx2 5/68/8
Figure 5.7: Knockdown of Sall4 causes an increase in expression of the pouV/Oct4 homologs. (A-L) Whole-mount in situ hybridization of late neurula staged embryos shown in dorsal view with the anterior toward the top. (A, D, G, J) Uninjected control embryos. (B, E, H) Embryos injected with 20 ng Sall4 MO into the right A/D blastomere. (C, F, I) Embryos injected bilaterally with 40 ng Sall4 MO (20 ng/blastomere at the 2-cell stage). (K-L) Embryos injected with 150 ρg PouV RNA (50 pg pou25 RNA, 50 pg pou60 RNA, and 50 pg pou91 RNA) into the right A/D blastomere. Red staining indicates β-galactosidase which is used as a tracer for RNA injection. (M-N) Higher magnification view of indicated regions in K and L, respectively. (A-C) Expression of pou25 (D-F) expression of pou60 (G-I) expression of pou91. (J-L) Expression of otx2/krox20/hoxb9. (O) qPCR for pou25 in uninjected embryos, embryos injected with 40 ng Sall4 MO (20 ng MO/blastomere at the 2-cell stage), and embryos injected with 40 ng Sall4 MO+500 pg Xtsall4 RNA (20 ng MO/blastomere at the 2-cell stage+250 pg Xtsall4 RNA/dorsal blastomere at the 4-cell stage). (P) qPCR for pou60 in uninjected embryos, embryos injected with 40 ng Sall4 MO (20ng MO/blastomere at the 2-cell stage), and embryos injected with 40 ng sall4 MO+500 pg Xtsall4 RNA (20 ng MO/blastomere at the 2-cell stage+250 pg Xtsall4 RNA/dorsal blastomere at the 4-cell stage). (Q) qPCR for pou91 in uninjected embryos, embryos injected with 40 ng Sall4 MO (20 ng MO/blastomere at the 2-cell stage), and embryos injected with 40 ng sall4 MO+500 pg Xtsall4 RNA (20ng MO/blastomere at the 2-cell stage+250 pg Xtsall4 RNA/dorsal blastomere at the 4-cell stage). (O-Q) Expression is measured relative to odc. Error bars represent one standard deviation from the mean. Means compared to uninjected control by one-way ANOVA followed by Tukey post-hoc analyses (*: p<0.05).
89
90
0.5
1.5
2.5
3.5
0.5
1.5
2.5
3.5
4.5
UC Sall4 MO Sall4 MO+Xtsall4 RNA
1
3
5
7
UC Sall4 MO Sall4 MO+Xtsall4 RNA
UC Sall4 MO Sall4 MO+Xtsall4 RNA
A B O
D E P
G H Q
UC Sall4 MO right A/D cell
pou25
pou60
pou91
*
*
*
J K L
M Notx2/krox20/hoxb9
UC 150 pg pouV RNA right A/D cell
C
F
I
Sall4 MO (bilateral)
Fold
Cha
nge
Fold
Cha
nge
Fold
Cha
nge
pou25
pou60
pou91
Figure 5.8: A second non-overlaping Sall4 morpholino results in similar phenotypes. (A-F) Whole-mount in situ hybridization if late neurula stage embryos shown in dorsal view with the anterior toward the top. (A, C, E,) Uninjected control embryos and (B, D, F) embryos injected with 20 ng Sall4 MO2 into the right A/D blastomere. (A-B) Expression of otx2/krox20/hoxb9 (C-D) Posterior view of hoxd10 expression. (E-F) Expression of pou91.
91
92
otx2/krox20/hoxb9
hoxd10
pou91
UCA B
D
E
C
F
Sall4 MO2 right A/D cell
Figure 5.9: Loss of spinal cord gene expression in Sall4 morphants requires an increase in pouV/Oct4 expression. (A-M) Whole-mount in situ hybridization of late neuriula stage embryos shown in dorsal view with anterior toward the top. (A-D) Uninjected control embryos. (E-H) Embryos injected with 40 ng Sall4 MO (20 ng/blastomere at the 2-cell stage). (I-L) Embryos injected with 40 ng Sall4 MO, 20 ng pou25 MO, 10 ng pou60a MO, 10 ng pou60b MO, and 20 ng pou91 MO (50 ng total MO/blastomere at the 2-cell stage). (M) Embryos injected with 20 ng pou25 MO, 10 ng pou60a MO, 10 ng pou60b MO, and 20 ng pou91 MO (30 ng total MO/blastomere at the 2-cell stage). (A, E, I, M) Expression of otx2/krox20/hoxb9. (B, F, J) Expression of hoxc10. (C, G, K) Expression of hoxd10. (N) Quantification of posterior neural gene expression as measured by length of expression domain in arbitrary units (AU). Open bars: uninjected control embryos. Gray bars: embryos injected with 40 ng Sall4 MO (20 ng/blastomere at the 2-cell stage). Closed bars: embryos injected with 40 ng Sall4 MO, 20 ng Xlpou25 MO, 10 ng Xlpou60a MO, 10 ng Xlpou60b MO, and 20 ng Xlpou91 MO (50 ng/blastomere at the 2-cell stage). Error bars represent one standard deviation from the mean. Means compared to uninjected control by one-way ANOVA followed by Tukey post-hoc analyses (***: p<0.001).
93
94
UC
Sall4
MO
Sall4
MO
+pouV/
Oct
4 M
OpouV
/Oct
4 M
O
otx2/krox20/hoxb9 hoxc10 hoxd10 sox2
0
5
10
15
20
25
30
35
hoxb9 hoxc10 hoxd10
UCSall4 MOSall4 MO+pouV/Oct4 MO
A B C D
E F G H
I J K L
M N
Leng
th (A
U)
***
***
***
***
Figure 5.10: FGF and retinoic acid signaling fail to posteriorize Sall4 morphants. (A-L) Whole-mount in situ hybridization of late neurula stage embryos shown in dorsal view with anterior toward the top. (A, E) Uninjected control embryos. (B, F) Embryos injected with 40 ng sall4 MO (20 ng/blastomere at the 2-cell stage). (C, G) Embryos injected with 50 pg fgf8a RNA into the right animal dorsal (A/D) blastomere. (D, H) Embryos injected with 40 ng sall4 MO (20 ng/blastomere at the 2-cell stage) and 50 pg fgf8a RNA into the right A/D blastomere. (I, K) Embryos treated with 1 µM all-trans retinoic acid (ATRA). (J-L) Embryos injected with 40 ng sall4 MO (20 ng/blastomere at the 2-cell stage) and treated with 1 µM all-trans retinoic acid. (A-D, I, J) Expression of otx2/krox20/hoxb9 (E-H, K, L) expression of sox2. (M) A model to explain the role of Sall4 in Wnt-mediated neural posteriorization. Wnt activates sall4 then represses pouV/Oct4 to allow for posteriorization via Wnt/Fgf/RA. Solid and dashed arrows indicate direct and direct or indirect regulation, respectively.
95
96
UC Sall4 MO50 pg fgf8a RNA1 A/D Cell
Sall4 MO +50 pg fgf8a RNA1 A/D Cell
1 M ATRASall4 MO +1 M ATRA
otx2/krox20/hoxb9
sox2
E
B C D
I J
G
F G H
K L
M
A
Sall4
Wnt/ -catenin
Sall4
pouV/Oct4
Posterior neural differentiation
(Hoxb9/Hoxc10/Hoxd10)
Fgf/RA
Normal
Wnt/ -catenin
pouV/Oct4
Posterior neural differentiation
(Hoxb9/Hoxc10/Hoxd10)
Fgf/RA
X
X X X
Sall4morphants
otx2/krox20/hoxb9
sox2
References
Agius, E., Oelgeschläger, M., Wessely, O., Kemp, C. and De Robertis, E. M. (2000). Endodermal Nodal-related signals and mesoderm induction in Xenopus. Development 127, 1173–1183.
Alexander, C., Zuniga, E., Blitz, I. L., Wada, N., Le Pabic, P., Javidan, Y., Zhang, T., Cho, K. W., Crump, J. G. and Schilling, T. F. (2011). Combinatorial roles for BMPs and Endothelin 1 in patterning the dorsal-ventral axis of the craniofacial skeleton. Development.
Archer, T. C., Jin, J. and Casey, E. S. (2011). Interaction of Sox1, Sox2, Sox3 and Oct4 during primary neurogenesis. Dev Biol 350, 429–440.
Bachiller, D., Klingensmith, J., Kemp, C., Belo, J. A., Anderson, R. M., May, S. R., McMahon, J. A., McMahon, A. P., Harland, R. M., Rossant, J., et al. (2000). The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature 403, 658–661.
Beddington, R. S. (1994). Induction of a second neural axis by the mouse node. Development 120, 613–620.
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and Ingham, P. W. (2001). The zebrafish neckless mutation reveals a requirement for raldh2 in mesodermal signals that pattern the hindbrain. Development 128, 3081–3094.
Behrens, J., Kries, von, J. P., Kühl, M., Bruhn, L., Wedlich, D., Grosschedl, R. and Birchmeier, W. (1996). Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382, 638–642.
Beliakoff, J., Lee, J., Ueno, H., Aiyer, A., Weissman, I. L., Barsh, G. S., Cardiff, R. D. and Sun, Z. (2008). The PIAS-like protein Zimp10 is essential for embryonic viability and proper vascular development. Mol Cell Biol 28, 282–292.
Bertocchini, F. and Stern, C. D. (2002). The hypoblast of the chick embryo positions the primitive streak by antagonizing nodal signaling. Dev Cell 3, 735–744.
Bibikova, M., Carroll, D., Segal, D. J., Trautman, J. K., Smith, J., Kim, Y. G. and Chandrasegaran, S. (2001). Stimulation of homologous recombination through targeted cleavage by chimeric nucleases. Mol Cell Biol 21, 289–297.
Bibikova, M., Golic, M., Golic, K. G. and Carroll, D. (2002). Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics 161, 1169–1175.
97
Blackburn, P. R., Campbell, J. M., Clark, K. J. and Ekker, S. C. (2013). The CRISPR System-Keeping Zebrafish Gene Targeting Fresh. Zebrafish.
Blitz, I. L. and Cho, K. W. (1995). Anterior neurectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development 121, 993–1004.
Blumberg, B., Bolado, J., Moreno, T. A., Kintner, C., Evans, R. M. and Papalopulu, N. (1997). An essential role for retinoid signaling in anteroposterior neural patterning. Development 124, 373–379.
Blythe, S. A., Cha, S.-W., Tadjuidje, E., Heasman, J. and Klein, P. S. (2010). beta-Catenin primes organizer gene expression by recruiting a histone H3 arginine 8 methyltransferase, Prmt2. Dev Cell 19, 220–231.
Blythe, S. A., Reid, C. D., Kessler, D. S. and Klein, P. S. (2009). Chromatin immunoprecipitation in early Xenopus laevis embryos. Dev Dyn 238, 1422–1432.
Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A. and Bonas, U. (2009). Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509–1512.
Böhm, J., Buck, A., Borozdin, W., Mannan, A. U., Matysiak-Scholze, U., Adham, I., Schulz-Schaeffer, W., Floss, T., Wurst, W., Kohlhase, J., et al. (2008). Sall1, sall2, and sall4 are required for neural tube closure in mice. Am J Pathol 173, 1455–1463.
Böhm, J., Sustmann, C., Wilhelm, C. and Kohlhase, J. (2006). SALL4 is directly activated by TCF/LEF in the canonical Wnt signaling pathway. Biochem Biophys Res Commun 348, 898–907.
Bradley, L. C., Snape, A., Bhatt, S. and Wilkinson, D. G. (1993). The structure and expression of the Xenopus Krox-20 gene: conserved and divergent patterns of expression in rhombomeres and neural crest. Mech Dev 40, 73–84.
Brunet, L. J., McMahon, J. A., McMahon, A. P. and Harland, R. M. (1998). Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280, 1455–1457.
Carroll, D. (2008). Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Ther 15, 1463–1468.
Cermak, T., Doyle, E. L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J. A., Somia, N. V., Bogdanove, A. J. and Voytas, D. F. (2011). Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res 39, e82.
98
Chang, C. and Harland, R. M. (2007). Neural induction requires continued suppression of both Smad1 and Smad2 signals during gastrulation. Development 134, 3861–3872.
Cho, K. W., Blumberg, B., Steinbeisser, H. and De Robertis, E. M. (1991). Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid. Cell 67, 1111–1120.
Christen, B. and Slack, J. M. (1997). FGF-8 is associated with anteroposterior patterning and limb regeneration in Xenopus. Dev Biol 192, 455–466.
Christian, M., Cermak, T., Doyle, E. L., Schmidt, C., Zhang, F., Hummel, A., Bogdanove, A. J. and Voytas, D. F. (2010). Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757–761.
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Herrmann, B. and Robertson, E. J. (1994). A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120, 1919–1928.
Conlon, R. A. and Rossant, J. (1992). Exogenous retinoic acid rapidly induces anterior ectopic expression of murine Hox-2 genes in vivo. Development 116, 357–368.
Cox, W. G. and Hemmati-Brivanlou, A. (1995). Caudalization of neural fate by tissue recombination and bFGF. Development 121, 4349–4358.
Crew, F. (1939). JSTOR: The British Medical Journal, Vol. 1, No. 4084 (Apr. 15, 1939), pp. 766-770. The British Medical Journal.
Cui, Y., Brown, J. D., Moon, R. T. and Christian, J. L. (1995). Xwnt-8b: a maternally expressed Xenopus Wnt gene with a potential role in establishing the dorsoventral axis. Development 121, 2177–2186.
Dale, L. and Slack, J. M. (1987). Regional specification within the mesoderm of early embryos of Xenopus laevis. Development 100, 279–295.
Darken, R. S. and Wilson, P. A. (2001). Axis induction by wnt signaling: Target promoter responsiveness regulates competence. Dev Biol 234, 42–54.
de Celis, J. F. and Barrio, R. (2009). Regulation and function of Spalt proteins during animal development. Int J Dev Biol 53, 1385–1398.
de Celis, J. F., Barrio, R. and Kafatos, F. C. (1996). A gene complex acting downstream of dpp in Drosophila wing morphogenesis. Nature 381, 421–424.
De Robertis, E. M. and Kuroda, H. (2004). Dorsal-ventral patterning and neural induction in Xenopus embryos. Annu. Rev. Cell Dev. Biol. 20, 285–308.
99
Delaune, E., Lemaire, P. and Kodjabachian, L. (2005). Neural induction in Xenopus requires early FGF signalling in addition to BMP inhibition. Development 132, 299–310.
Dichmann, D. S. and Harland, R. M. (2012). fus/TLS orchestrates splicing of developmental regulators during gastrulation. Genes Dev 26, 1351–1363.
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S., Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect mechanism requiring FGF signalling. Dev Biol 239, 148–160.
Doyon, Y., McCammon, J. M., Miller, J. C., Faraji, F., Ngo, C., Katibah, G. E., Amora, R., Hocking, T. D., Zhang, L., Rebar, E. J., et al. (2008). Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat Biotechnol 26, 702–708.
Durston, A. J., Timmermans, J. P., Hage, W. J., Hendriks, H. F., de Vries, N. J., Heideveld, M. and Nieuwkoop, P. D. (1989). Retinoic acid causes an anteroposterior transformation in the developing central nervous system. Nature 340, 140–144.
Eimon, P. M. and Harland, R. M. (1999). In Xenopus embryos, BMP heterodimers are not required for mesoderm induction, but BMP activity is necessary for dorsal/ventral patterning. Dev Biol 216, 29–40.
Eisen, J. S. and Smith, J. C. (2008). Controlling morpholino experiments: don't stop making antisense. Development 135, 1735–1743.
Elkouby, Y. M., Elias, S., Casey, E. S., Blythe, S. A., Tsabar, N., Klein, P. S., Root, H., Liu, K. J. and Frank, D. (2010). Mesodermal Wnt signaling organizes the neural plate via Meis3. Development 137, 1531–1541.
Elkouby, Y. M., Polevoy, H., Gutkovich, Y. E., Michaelov, A. and Frank, D. (2012). A hindbrain-repressive Wnt3a/Meis3/Tsh1 circuit promotes neuronal differentiation and coordinates tissue maturation. Development.
Elstob, P. R., Brodu, V. and Gould, A. P. (2001). spalt-dependent switching between two cell fates that are induced by the Drosophila EGF receptor. Development 128, 723–732.
Elul, T., Koehl, M. A. and Keller, R. (1997). Cellular mechanism underlying neural convergent extension in Xenopus laevis embryos. Dev Biol 191, 243–258.
Erter, C. E., Wilm, T. P., Basler, N., Wright, C. V. and Solnica-Krezel, L. (2001). Wnt8 is required in lateral mesendodermal precursors for neural posteriorization in vivo. Development 128, 3571–3583.
Faas, L. and Isaacs, H. V. (2009). Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis. Dev Dyn 238, 835–852.
100
Farrell, E. R. and Münsterberg, A. E. (2000). csal1 is controlled by a combination of FGF and Wnt signals in developing limb buds. Dev Biol 225, 447–458.
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395, 181–185.
Fletcher, R. B., Baker, J. C. and Harland, R. M. (2006). FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus. Development 133, 1703–1714.
Fletcher, R. B., Watson, A. L. and Harland, R. M. (2004). Expression of Xenopus tropicalis noggin1 and noggin2 in early development: two noggin genes in a tetrapod. Gene Expr Patterns 5, 225–230.
Frank, D. and Harland, R. M. (1992). Localized expression of a Xenopus POU gene depends on cell-autonomous transcriptional activation and induction-dependent inactivation. Development 115, 439–448.
Fuentealba, L. C., Eivers, E., Ikeda, A., Hurtado, C., Kuroda, H., Pera, E. M. and De Robertis, E. M. (2007). Integrating patterning signals: Wnt/GSK3 regulates the duration of the BMP/Smad1 signal. Cell 131, 980–993.
Gale, E., Zile, M. and Maden, M. (1999). Hindbrain respecification in the retinoid-deficient quail. Mech Dev 89, 43–54.
Garnett, A. T., Square, T. A. and Medeiros, D. M. (2012). BMP, Wnt and FGF signals are integrated through evolutionarily conserved enhancers to achieve robust expression of Pax3 and Zic genes at the zebrafish neural plate border. Development.
Gaunt, S. J., Cockley, A. and Drage, D. (2004). Additional enhancer copies, with intact cdx binding sites, anteriorize Hoxa-7/lacZ expression in mouse embryos: evidence in keeping with an instructional cdx gradient. Int J Dev Biol 48, 613–622.
Gaunt, S. J., Drage, D. and Trubshaw, R. C. (2008). Increased Cdx protein dose effects upon axial patterning in transgenic lines of mice. Development 135, 2511–2520.
Germain, S., Howell, M., Esslemont, G. M. and Hill, C. S. (2000). Homeodomain and winged-helix transcription factors recruit activated Smads to distinct promoter elements via a common Smad interaction motif. Genes Dev 14, 435–451.
Geurts, A. M., Cost, G. J., Freyvert, Y., Zeitler, B., Miller, J. C., Choi, V. M., Jenkins, S. S., Wood, A., Cui, X., Meng, X., et al. (2009). Knockout rats via embryo microinjection of zinc-finger nucleases. Science 325, 433.
101
Gimlich, R. L. and Gerhart, J. C. (1984). Early cellular interactions promote embryonic axis formation in Xenopus laevis. Dev Biol 104, 117–130.
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C. and Niehrs, C. (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391, 357–362.
Godsave, S. F. and Slack, J. M. (1989). Clonal analysis of mesoderm induction in Xenopus laevis. Dev Biol 134, 486–490.
Grammer, T. C., Khokha, M. K., Lane, M. A., Lam, K. and Harland, R. M. (2005). Identification of mutants in inbred Xenopus tropicalis. Mech Dev 122, 263–272.
Greco, T. L., Takada, S., Newhouse, M. M., McMahon, J. A., McMahon, A. P. and Camper, S. A. (1996). Analysis of the vestigial tail mutation demonstrates that Wnt-3a gene dosage regulates mouse axial development. Genes Dev 10, 313–324.
Green, J. B. and Smith, J. C. (1990). Graded changes in dose of a Xenopus activin A homologue elicit stepwise transitions in embryonic cell fate. Nature 347, 391–394.
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S. and Schier, A. F. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97, 121–132.
Groppe, J., Greenwald, J., Wiater, E., Rodriguez-Leon, J., Economides, A. N., Kwiatkowski, W., Affolter, M., Vale, W. W., Belmonte, J. C. I. and Choe, S. (2002). Structural basis of BMP signalling inhibition by the cystine knot protein Noggin. Nature 420, 636–642.
Grunz, H. and Tacke, L. (1989). Neural differentiation of Xenopus laevis ectoderm takes place after disaggregation and delayed reaggregation without inducer. Cell Differ. Dev. 28, 211–217.
Gurdon, J. B. and Hopwood, N. (2000). The introduction of Xenopus laevis into developmental biology: of empire, pregnancy testing and ribosomal genes. Int J Dev Biol 44, 43–50.
Hamlet, M. R. J., Yergeau, D. A., Kuliyev, E., Takeda, M., Taira, M., Kawakami, K. and Mead, P. E. (2006). Tol2 transposon-mediated transgenesis in Xenopus tropicalis. Genesis 44, 438–445.
Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A. P. and Tabin, C. J. (2004). Evidence for an expansion-based temporal Shh gradient in specifying vertebrate digit identities. Cell 118, 517–528.
102
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13, 611–667.
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36, 685–695.
Heasman, J., Crawford, A., Goldstone, K., Garner-Hamrick, P., Gumbiner, B., McCrea, P., Kintner, C., Noro, C. Y. and Wylie, C. (1994). Overexpression of cadherins and underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell 79, 791–803.
Heasman, J., Kofron, M. and Wylie, C. (2000). Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev Biol 222, 124–134.
Hellsten, U., Harland, R. M., Gilchrist, M. J., Hendrix, D., Jurka, J., Kapitonov, V., Ovcharenko, I., Putnam, N. H., Shu, S., Taher, L., et al. (2010). The genome of the Western clawed frog Xenopus tropicalis. Science 328, 633–636.
Hemmati-Brivanlou, A. and Melton, D. (1997). Vertebrate embryonic cells will become nerve cells unless told otherwise. Cell 88, 13–17.
Hemmati-Brivanlou, A. and Melton, D. A. (1992). A truncated activin receptor inhibits mesoderm induction and formation of axial structures in Xenopus embryos. Nature 359, 609–614.
Hemmati-Brivanlou, A. and Melton, D. A. (1994). Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77, 273–281.
Hemmati-Brivanlou, A., Frank, D., Bolce, M. E., Brown, B. D., Sive, H. L. and Harland, R. M. (1990). Localization of specific mRNAs in Xenopus embryos by whole-mount in situ hybridization. Development 110, 325–330.
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77, 283–295.
Hemmati-Brivanlou, A., la Torre, de, J. R., Holt, C. and Harland, R. M. (1991). Cephalic expression and molecular characterization of Xenopus En-2. Development 111, 715–724.
Hernandez, R. E., Putzke, A. P., Myers, J. P., Margaretha, L. and Moens, C. B. (2007). Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development 134, 177–187.
Hollemann, T., Chen, Y., Grunz, H. and Pieler, T. (1998). Regionalized metabolic activity establishes boundaries of retinoic acid signalling. EMBO J 17, 7361–7372.
103
Hollemann, T., Schuh, R., Pieler, T. and Stick, R. (1996). Xenopus Xsal-1, a vertebrate homolog of the region specific homeotic gene spalt of Drosophila. Mech Dev 55, 19–32.
Hollnagel, A., Oehlmann, V., Heymer, J., Rüther, U. and Nordheim, A. (1999). Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. J Biol Chem 274, 19838–19845.
HOLTFRETER, J. (1947). Neural induction in explants which have passed through a sublethal cytolysis. J. Exp. Zool. 106, 197–222.
Houston, D. W., Kofron, M., Resnik, E., Langland, R., Destrée, O., Wylie, C. and Heasman, J. (2002). Repression of organizer genes in dorsal and ventral Xenopus cells mediated by maternal XTcf3. Development 129, 4015–4025.
Howard, M. J., Stanke, M., Schneider, C., Wu, X. and Rohrer, H. (2000). The transcription factor dHAND is a downstream effector of BMPs in sympathetic neuron specification. Development 127, 4073–4081.
Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., Peterson, R. T., Yeh, J.-R. J. and Joung, J. K. (2013). Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31, 227–229.
Isaacs, H. V., Pownall, M. E. and Slack, J. M. (1998). Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3. EMBO J 17, 3413–3427.
Itoh, K. and Sokol, S. Y. (1997). Graded amounts of Xenopus dishevelled specify discrete anteroposterior cell fates in prospective ectoderm. Mech Dev 61, 113–125.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. and Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821.
Joseph, E. M. and Melton, D. A. (1997). Xnr4: a Xenopus nodal-related gene expressed in the Spemann organizer. Dev Biol 184, 367–372.
Jürgens, G. (1988). Head and tail development of the Drosophila embryo involves spalt, a novel homeotic gene. EMBO J 7, 189–196.
Kao, K. R. and Elinson, R. P. (1985). Alteration of the anterior-posterior embryonic axis: the pattern of gastrulation in macrocephalic frog embryos. Dev Biol 107, 239–251.
Kengaku, M. and Okamoto, H. (1995). bFGF as a possible morphogen for the anteroposterior axis of the central nervous system in Xenopus. Development 121, 3121–3130.
104
Kessler, D. S. and Melton, D. A. (1995). Induction of dorsal mesoderm by soluble, mature Vg1 protein. Development 121, 2155–2164.
Khokha, M. K., Krylov, V., Reilly, M. J., Gall, J. G., Bhattacharya, D., Cheung, C. Y. J., Kaufman, S., Lam, D. K., Macha, J., Ngo, C., et al. (2009). Rapid gynogenetic mapping of Xenopus tropicalis mutations to chromosomes. Dev Dyn 238, 1398–1346.
Khokha, M. K., Yeh, J., Grammer, T. C. and Harland, R. M. (2005). Depletion of three BMP antagonists from Spemann's organizer leads to a catastrophic loss of dorsal structures. Dev Cell 8, 401–411.
Kiecker, C. and Niehrs, C. (2001). A morphogen gradient of Wnt/beta-catenin signalling regulates anteroposterior neural patterning in Xenopus. Development 128, 4189–4201.
Kiefer, S. M., McDill, B. W., Yang, J. and Rauchman, M. (2002). Murine Sall1 represses transcription by recruiting a histone deacetylase complex. J Biol Chem 277, 14869–14876.
Kim, C. H., Oda, T., Itoh, M., Jiang, D., Artinger, K. B., Chandrasekharappa, S. C., Driever, W. and Chitnis, A. B. (2000). Repressor activity of Headless/Tcf3 is essential for vertebrate head formation. Nature 407, 913–916.
Kimelman, D. and Kirschner, M. (1987). Synergistic induction of mesoderm by FGF and TGF-beta and the identification of an mRNA coding for FGF in the early Xenopus embryo. Cell 51, 869–877.
Kimura, N., Takizawa, M., Okita, K., Natori, O., Igarashi, K., Ueno, M., Nakashima, K.-I., Nobuhisa, I. and Taga, T. (2002). Identification of a novel transcription factor, ELYS, expressed predominantly in mouse foetal haematopoietic tissues. Genes Cells 7, 435–446.
King, R. W., Deshaies, R. J., Peters, J. M. and Kirschner, M. W. (1996). How proteolysis drives the cell cycle. Science 274, 1652–1659.
Kohlhase, J., Heinrich, M., Schubert, L., Liebers, M., Kispert, A., Laccone, F., Turnpenny, P., Winter, R. M. and Reardon, W. (2002). Okihiro syndrome is caused by SALL4 mutations. Human Molecular Genetics 11, 2979–2987.
Kohlhase, J., Wischermann, A., Reichenbach, H., Froster, U. and Engel, W. (1998). Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat Genet 18, 81–83.
Kolm, P. J., Apekin, V. and Sive, H. (1997). Xenopus hindbrain patterning requires retinoid signaling. Dev Biol 192, 1–16.
105
Komekado, H., Yamamoto, H., Chiba, T. and Kikuchi, A. (2007). Glycosylation and palmitoylation of Wnt-3a are coupled to produce an active form of Wnt-3a. Genes Cells 12, 521–534.
Kotake, Y., Sagane, K., Owa, T., Mimori-Kiyosue, Y., Shimizu, H., Uesugi, M., Ishihama, Y., Iwata, M. and Mizui, Y. (2007). Splicing factor SF3b as a target of the antitumor natural product pladienolide. Nat. Chem. Biol. 3, 570–575.
Ku, M. and Melton, D. A. (1993). Xwnt-11: a maternally expressed Xenopus wnt gene. Development 119, 1161–1173.
Kudoh, T., Wilson, S. W. and Dawid, I. B. (2002). Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm. Development 129, 4335–4346.
LaBonne, C. and Whitman, M. (1997). Localization of MAP kinase activity in early Xenopus embryos: implications for endogenous FGF signaling. Dev Biol 183, 9–20.
Lamb, T. M. and Harland, R. M. (1995). Fibroblast growth factor is a direct neural inducer, which combined with noggin generates anterior-posterior neural pattern. Development 121, 3627–3636.
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E., Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M. (1993). Neural induction by the secreted polypeptide noggin. Science 262, 713–718.
Langmead, B., Trapnell, C., Pop, M. and Salzberg, S. L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25.
Lauberth, S. M. and Rauchman, M. (2006). A conserved 12-amino acid motif in Sall1 recruits the nucleosome remodeling and deacetylase corepressor complex. J Biol Chem 281, 23922–23931.
Lauberth, S. M., Bilyeu, A. C., Firulli, B. A., Kroll, K. L. and Rauchman, M. (2007). A phosphomimetic mutation in the Sall1 repression motif disrupts recruitment of the nucleosome remodeling and deacetylase complex and repression of Gbx2. J Biol Chem 282, 34858–34868.
Launay, C., Fromentoux, V., Shi, D. L. and Boucaut, J. C. (1996). A truncated FGF receptor blocks neural induction by endogenous Xenopus inducers. Development 122, 869–880.
Laurent, M. N., Blitz, I. L., Hashimoto, C., Rothbächer, U. and Cho, K. W. (1997). The Xenopus homeobox gene twin mediates Wnt induction of goosecoid in establishment of Spemann's organizer. Development 124, 4905–4916.
106
Lee, M. A., Heasman, J. and Whitman, M. (2001). Timing of endogenous activin-like signals and regional specification of the Xenopus embryo. Development 128, 2939–2952.
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de Crombrugghe, B. (1997). SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol Cell Biol 17, 2336–2346.
Lei, Y., Guo, X., Liu, Y., Cao, Y., Deng, Y., Chen, X., Cheng, C. H. K., Dawid, I. B., Chen, Y. and Zhao, H. (2012). Efficient targeted gene disruption in Xenopus embryos using engineered transcription activator-like effector nucleases (TALENs). Proc Natl Acad Sci USA 109, 17484–17489.
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Dev Cell 1, 103–114.
Lemaire, P., Garrett, N. and Gurdon, J. B. (1995). Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81, 85–94.
Lewis, W. H. (1904). Experimental studies on the development of the eye in amphibia. I. On the origin of the lens.Rana palustris. Am. J. Anat. 3, 505–536.
Li, B., Kuriyama, S., Moreno, M. and Mayor, R. (2009). The posteriorizing gene Gbx2 is a direct target of Wnt signalling and the earliest factor in neural crest induction. Development 136, 3267–3278.
Lim, C. Y., Tam, W.-L., Zhang, J., Ang, H. S., Jia, H., Lipovich, L., Ng, H.-H., Wei, C.-L., Sung, W. K., Robson, P., et al. (2008). Sall4 regulates distinct transcription circuitries in different blastocyst-derived stem cell lineages. Cell Stem Cell 3, 543–554.
Linker, C., De Almeida, I., Papanayotou, C., Stower, M., Sabado, V., Ghorani, E., Streit, A., Mayor, R. and Stern, C. D. (2009). Cell communication with the neural plate is required for induction of neural markers by BMP inhibition: evidence for homeogenetic induction and implications for Xenopus animal cap and chick explant assays. Dev Biol 327, 478–486.
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20, 781–810.
Lu, F.-I., Thisse, C. and Thisse, B. (2011). Identification and mechanism of regulation of the zebrafish dorsal determinant. Proc Natl Acad Sci USA 108, 15876–15880.
107
Lu, J., Jeong, H.-W., Jeong, H., Kong, N., Yang, Y., Carroll, J., Luo, H. R., Silberstein, L. E., Yupoma and Chai, L. (2009). Stem cell factor SALL4 represses the transcriptions of PTEN and SALL1 through an epigenetic repressor complex. PLoS ONE 4, e5577.
Maden, M. (2002). Retinoid signalling in the development of the central nervous system. Nat Rev Neurosci 3, 843–853.
Maden, M. (2007). Retinoic acid in the development, regeneration and maintenance of the nervous system. Nat Rev Neurosci 8, 755–765.
Marcelino, J., Sciortino, C. M., Romero, M. F., Ulatowski, L. M., Ballock, R. T., Economides, A. N., Eimon, P. M., Harland, R. M. and Warman, M. L. (2001). Human disease-causing NOG missense mutations: effects on noggin secretion, dimer formation, and bone morphogenetic protein binding. Proc Natl Acad Sci USA 98, 11353–11358.
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden, A. and Krumlauf, R. (1992). Retinoic acid alters hindbrain Hox code and induces transformation of rhombomeres 2/3 into a 4/5 identity. Nature 360, 737–741.
Mashimo, T., Takizawa, A., Voigt, B., Yoshimi, K., Hiai, H., Kuramoto, T. and Serikawa, T. (2010). Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS ONE 5, e8870.
McCammon, J. M., Doyon, Y. and Amacher, S. L. (2011). Inducing High Rates of Targeted Mutagenesis in Zebrafish Using Zinc Finger Nucleases (ZFNs). Methods Mol Biol 770, 505–527.
McGrew, L. L., Lai, C. J. and Moon, R. T. (1995). Specification of the anteroposterior neural axis through synergistic interaction of the Wnt signaling cascade with noggin and follistatin. Dev Biol 172, 337–342.
McKendry, R., Hsu, S. C., Harland, R. M. and Grosschedl, R. (1997). LEF-1/TCF proteins mediate wnt-inducible transcription from the Xenopus nodal-related 3 promoter. Dev Biol 192, 420–431.
McMahon, J. A., Takada, S., Zimmerman, L. B., Fan, C. M., Harland, R. M. and McMahon, A. P. (1998). Noggin-mediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somite. Genes Dev 12, 1438–1452.
Meng, X., Noyes, M. B., Zhu, L. J., Lawson, N. D. and Wolfe, S. A. (2008). Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat Biotechnol 26, 695–701.
108
Menon, S., Tsuge, T., Dohmae, N., Takio, K. and Wei, N. (2008). Association of SAP130/SF3b-3 with Cullin-RING ubiquitin ligase complexes and its regulation by the COP9 signalosome. BMC Biochem. 9, 1.
Mic, F. A., Haselbeck, R. J., Cuenca, A. E. and Duester, G. (2002). Novel retinoic acid generating activities in the neural tube and heart identified by conditional rescue of Raldh2 null mutant mice. Development 129, 2271–2282.
Mii, Y. and Taira, M. (2009). Secreted Frizzled-related proteins enhance the diffusion of Wnt ligands and expand their signalling range. Development 136, 4083–4088.
Miller, C. T., Yelon, D., Stainier, D. Y. R. and Kimmel, C. B. (2003). Two endothelin 1 effectors, hand2 and bapx1, pattern ventral pharyngeal cartilage and the jaw joint. Development 130, 1353–1365.
Miller, J. C., Holmes, M. C., Wang, J., Guschin, D. Y., Lee, Y.-L., Rupniewski, I., Beausejour, C. M., Waite, A. J., Wang, N. S., Kim, K. A., et al. (2007). An improved zinc-finger nuclease architecture for highly specific genome editing. Nat Biotechnol 25, 778–785.
Miller, J., McLachlan, A. D. and Klug, A. (1985). Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J 4, 1609–1614.
Monsoro-Burq, A.-H., Wang, E. and Harland, R. (2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction. Dev Cell 8, 167–178.
Moon, R. T., Campbell, R. M., Christian, J. L., McGrew, L. L., Shih, J. and Fraser, S. (1993). Xwnt-5A: a maternal Wnt that affects morphogenetic movements after overexpression in embryos of Xenopus laevis. Development 119, 97–111.
Morrison, G. M. and Brickman, J. M. (2006). Conserved roles for Oct4 homologues in maintaining multipotency during early vertebrate development. Development 133, 2011–2022.
Moscou, M. J. and Bogdanove, A. J. (2009). A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501.
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L., Tsukui, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S. P., et al. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Dev Cell 1, 423–434.
Neff, A. W., King, M. W. and Mescher, A. L. (2011). Dedifferentiation and the role of sall4 in reprogramming and patterning during amphibian limb regeneration. Dev Dyn 240, 979–989.
109
Neff, A. W., King, M. W., Harty, M. W., Nguyen, T., Calley, J., Smith, R. C. and Mescher, A. L. (2005). Expression of Xenopus XlSALL4 during limb development and regeneration. Dev Dyn 233, 356–367.
Newman, C. S. and Krieg, P. A. (1999). Alternative splicing and embryonic expression of the Xenopus mad4 bHLH gene. Dev Dyn 215, 170–178.
Niederreither, K., Subbarayan, V., Dollé, P. and Chambon, P. (1999). Embryonic retinoic acid synthesis is essential for early mouse post-implantation development. Nat Genet 21, 444–448.
Niehrs, C. C. (2004). Regionally specific induction by the Spemann-Mangold organizer. Nat Rev Genet 5, 425–434.
Nieuwkoop, P. D. (1952). Activation and organization of the central nervous system in amphibians. Part III. Synthesis of a new working hypothesis. J. Exp. Zool. 120, 83–108.
Nieuwkoop, P. D. (1967). Normal Table of Xenopus Laevis (Daudin). Garland Pub.
Nieuwkoop, P. D.Others (1952a). Activation and organization of the central nervous system in amphibians. Part II. Differentiation and organization. J. Exp. Zool. 120, 33–81.
Nieuwkoop, P. D.Others (1952b). Activation and organization of the central nervous system in amphibians. Part I. Induction and activation. J. Exp. Zool. 120, 1–31.
Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., Shibuya, H. and Cho, K. W. (2000). Interaction between Wnt and TGF-beta signalling pathways during formation of Spemann's organizer. Nature 403, 781–785.
Obrig, T. G., Culp, W. J., McKeehan, W. L. and Hardesty, B. (1971). The mechanism by which cycloheximide and related glutarimide antibiotics inhibit peptide synthesis on reticulocyte ribosomes. J Biol Chem 246, 174–181.
Onai, T., Sasai, N., Matsui, M. and Sasai, Y. (2004). Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling. Dev Cell 7, 95–106.
Onuma, Y., Nishinakamura, R., Takahashi, S., Yokota, T. and Asashima, M. (1999). Molecular cloning of a novel Xenopus spalt gene (Xsal-3). Biochem Biophys Res Commun 264, 151–156.
Ooshio, T., Irie, K., Morimoto, K., Fukuhara, A., Imai, T. and Takai, Y. (2004). Involvement of LMO7 in the association of two cell-cell adhesion molecules, nectin and E-cadherin, through afadin and alpha-actinin in epithelial cells. J Biol Chem 279, 31365–31373.
110
Oppenheimer, J. M. (1936). Transplantation experiments on developing teleosts (Fundulus and Perca). J. Exp. Zool. 72, 409–437.
Paek, H., Antoine, M. W., Diaz, F. and Hébert, J. M. (2012). Increased β-catenin activity in the anterior neural plate induces ectopic mid-hindbrain characteristics. Dev Dyn 241, 242–246.
Papalopulu, N. and Kintner, C. (1996). A posteriorising factor, retinoic acid, reveals that anteroposterior patterning controls the timing of neuronal differentiation in Xenopus neuroectoderm. Development 122, 3409–3418.
Pavletich, N. P. and Pabo, C. O. (1991). Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science 252, 809–817.
Pera, E. M. and De Robertis, E. M. (2000). A direct screen for secreted proteins in Xenopus embryos identifies distinct activities for the Wnt antagonists Crescent and Frzb-1. Mech Dev 96, 183–195.
Perea-Gomez, A., Vella, F. D. J., Shawlot, W., Oulad-Abdelghani, M., Chazaud, C., Meno, C., Pfister, V., Chen, L., Robertson, E., Hamada, H., et al. (2002). Nodal antagonists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Dev Cell 3, 745–756.
Perez, E. E., Wang, J., Miller, J. C., Jouvenot, Y., Kim, K. A., Liu, O., Wang, N., Lee, G., Bartsevich, V. V., Lee, Y.-L., et al. (2008). Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat Biotechnol 26, 808–816.
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T. and De Robertis, E. M. (1999). The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397, 707–710.
Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4. Cell 86, 589–598.
Pilon, N., Oh, K., Sylvestre, J.-R., Bouchard, N., Savory, J. and Lohnes, D. (2006). Cdx4 is a direct target of the canonical Wnt pathway. Dev Biol 289, 55–63.
Pilon, N., Oh, K., Sylvestre, J.-R., Savory, J. G. A. and Lohnes, D. (2007). Wnt signaling is a key mediator of Cdx1 expression in vivo. Development 134, 2315–2323.
Prinos, P., Joseph, S., Oh, K., Meyer, B. I., Gruss, P. and Lohnes, D. (2001). Multiple pathways governing Cdx1 expression during murine development. Dev Biol 239, 257–269.
111
Ribisi, S., Mariani, F. V., Aamar, E., Lamb, T. M., Frank, D. and Harland, R. M. (2000). Ras-mediated FGF signaling is required for the formation of posterior but not anterior neural tissue in Xenopus laevis. Dev Biol 227, 183–196.
Rousso, S. Z., Ben-Haroush Schyr, R., Gur, M., Zouela, N., Kot-Leibovich, H., Shabtai, Y., Koutsi-Urshanski, N., Baldessari, D., Pillemer, G., Niehrs, C., et al. (2011). Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation. Dev Dyn 240, 796–807.
Ruiz i Altaba, A. and Jessell, T. M. (1991). Retinoic acid modifies the pattern of cell differentiation in the central nervous system of neurula stage Xenopus embryos. Development 112, 945–958.
Sakaki-Yumoto, M., Kobayashi, C., Sato, A., Fujimura, S., Matsumoto, Y., Takasato, M., Kodama, T., Aburatani, H., Asashima, M., Yoshida, N., et al. (2006). The murine homolog of SALL4, a causative gene in Okihiro syndrome, is essential for embryonic stem cell proliferation, and cooperates with Sall1 in anorectal, heart, brain and kidney development. Development 133, 3005–3013.
Santiago, Y., Chan, E., Liu, P.-Q., Orlando, S., Zhang, L., Urnov, F. D., Holmes, M. C., Guschin, D., Waite, A., Miller, J. C., et al. (2008). Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases. Proc Natl Acad Sci USA 105, 5809–5814.
Sasai, Y., Lu, B., Piccolo, S. and De Robertis, E. M. (1996). Endoderm induction by the organizer-secreted factors chordin and noggin in Xenopus animal caps. EMBO J 15, 4547–4555.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79, 779–790.
Sato, S. M. and Sargent, T. D. (1989). Development of neural inducing capacity in dissociated Xenopus embryos. Dev Biol 134, 263–266.
Semënov, M. V., Tamai, K., Brott, B. K., Kühl, M., Sokol, S. and He, X. (2001). Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr Biol 11, 951–961.
Shapiro, M. D., Hanken, J. and Rosenthal, N. (2003). Developmental basis of evolutionary digit loss in the Australian lizard Hemiergis. J. Exp. Zool. B Mol. Dev. Evol. 297, 48–56.
Shiotsugu, J., Katsuyama, Y., Arima, K., Baxter, A., Koide, T., Song, J., Chandraratna, R. A. S. and Blumberg, B. (2004). Multiple points of interaction between retinoic acid and FGF signaling during embryonic axis formation. Development 131, 2653–2667.
112
Sive, H. L., Draper, B. W., Harland, R. M. and Weintraub, H. (1990). Identification of a retinoic acid-sensitive period during primary axis formation in Xenopus laevis. Genes Dev 4, 932–942.
Sive, H. L., Grainger, R. M. and Harland, R. M. (2010). Early Development of Xenopus Laevis.
Skromne, I. and Stern, C. D. (2001). Interactions between Wnt and Vg1 signalling pathways initiate primitive streak formation in the chick embryo. Development 128, 2915–2927.
Skromne, I. and Stern, C. D. (2002). A hierarchy of gene expression accompanying induction of the primitive streak by Vg1 in the chick embryo. Mech Dev 114, 115–118.
Slack, J. M., Darlington, B. G., Heath, J. K. and Godsave, S. F. (1987). Mesoderm induction in early Xenopus embryos by heparin-binding growth factors. Nature 326, 197–200.
Smith, J. C. (1987). A mesoderm-inducing factor is produced by Xenopus cell line. Development 99, 3–14.
Smith, J. C., Price, B. M., Van Nimmen, K. and Huylebroeck, D. (1990). Identification of a potent Xenopus mesoderm-inducing factor as a homologue of activin A. Nature 345, 729–731.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67, 753–765.
Smith, W. C. and Harland, R. M. (1992). Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70, 829–840.
Smith, W. C., Knecht, A. K., Wu, M. and Harland, R. M. (1993). Secreted noggin protein mimics the Spemann organizer in dorsalizing Xenopus mesoderm. Nature 361, 547–549.
Snir, M., Ofir, R., Elias, S. and Frank, D. (2006). Xenopus laevis POU91 protein, an Oct3/4 homologue, regulates competence transitions from mesoderm to neural cell fates. EMBO J 25, 3664–3674.
Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell 67, 741–752.
Spemann, H. (1901). Spemann: Entwicklungsmechanische Studien amTriton-Ei. I - Google Scholar. Arch Entw mechan.
Spemann, H. (1938). Embryonic Development and Induction, by Hans Spemann,...
Spemann, H. and Mangold, H. (1924). über Induktion von Embryonalanlagen durch Implantation artfremder Organisatoren - Springer. Dev Genes Evol.
113
Stern, C. D. (2004). Gastrulation. Cold Spring Harbor Laboratory Pr.
Sturtevant, M. A., Biehs, B., Marin, E. and Bier, E. (1997). The spalt gene links the A/P compartment boundary to a linear adult structure in the Drosophila wing. Development 124, 21–32.
Sweetman, D. and Münsterberg, A. (2006). The vertebrate spalt genes in development and disease. Dev Biol 293, 285–293.
Takada, R., Satomi, Y., Kurata, T., Ueno, N., Norioka, S., Kondoh, H., Takao, T. and Takada, S. (2006). Monounsaturated fatty acid modification of Wnt protein: its role in Wnt secretion. Dev Cell 11, 791–801.
Takemoto, T., Uchikawa, M., Kamachi, Y. and Kondoh, H. (2006). Convergence of Wnt and FGF signals in the genesis of posterior neural plate through activation of the Sox2 enhancer N-1. Development 133, 297–306.
Takeuchi, M., Nakabayashi, J., Sakaguchi, T., Yamamoto, T. S., Takahashi, H., Takeda, H. and Ueno, N. (2003). The prickle-related gene in vertebrates is essential for gastrulation cell movements. Curr Biol 13, 674–679.
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M., Wylie, C. C., Lin, X. and Heasman, J. (2005). Maternal wnt11 activates the canonical wnt signaling pathway required for axis formation in Xenopus embryos. Cell 120, 857–871.
Trapnell, C., Pachter, L. and Salzberg, S. L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111.
Trapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M. J., Salzberg, S. L., Wold, B. J. and Pachter, L. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28, 511–515.
Tríbulo, C., Aybar, M. J., Nguyen, V. H., Mullins, M. C. and Mayor, R. (2003). Regulation of Msx genes by a Bmp gradient is essential for neural crest specification. Development 130, 6441–6452.
Tsubooka, N., Ichisaka, T., Okita, K., Takahashi, K., Nakagawa, M. and Yamanaka, S. (2009). Roles of Sall4 in the generation of pluripotent stem cells from blastocysts and fibroblasts. Genes Cells 14, 683–694.
Turner, D. L. and Weintraub, H. (1994). Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev 8, 1434–1447.
114
Uchikawa, M., Ishida, Y., Takemoto, T., Kamachi, Y. and Kondoh, H. (2003). Functional analysis of chicken Sox2 enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Dev Cell 4, 509–519.
Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S. and Gregory, P. D. (2010). Genome editing with engineered zinc finger nucleases. Nat Rev Genet 11, 636–646.
van de Ven, C., Bialecka, M., Neijts, R., Young, T., Rowland, J. E., Stringer, E. J., van Rooijen, C., Meijlink, F., Nóvoa, A., Freund, J.-N., et al. (2011). Concerted involvement of Cdx/Hox genes and Wnt signaling in morphogenesis of the caudal neural tube and cloacal derivatives from the posterior growth zone. Development 138, 3451–3462.
van den Akker, E., Forlani, S., Chawengsaksophak, K., de Graaff, W., Beck, F., Meyer, B. I. and Deschamps, J. (2002). Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development 129, 2181–2193.
Waddington, C. H. (1932). JSTOR: Philosophical Transactions of the Royal Society of London. Series B, Containing Papers of a Biological Character, Vol. 221 (1932), pp. 179-230. Philosophical Transactions of the Royal Society of ….
Waddington, C. H. (1933). Induction by the Primitive Streak and its Derivatives in the Chick. Journal of Experimental Biology.
Wallingford, J. B., Goto, T., Keller, R. and Harland, R. M. (2002). Cloning and expression of Xenopus Prickle, an orthologue of a Drosophila planar cell polarity gene. Mech Dev 116, 183–186.
Wang, J. and Wynshaw-Boris, A. (2004). The canonical Wnt pathway in early mammalian embryogenesis and stem cell maintenance/differentiation. Curr Opin Genet Dev 14, 533–539.
Wang, S., Krinks, M., Lin, K., Luyten, F. P. and Moos, M. (1997). Frzb, a secreted protein expressed in the Spemann organizer, binds and inhibits Wnt-8. Cell 88, 757–766.
Wang, W. C. H. and Shashikant, C. S. (2007). Evidence for positive and negative regulation of the mouse Cdx2 gene. J. Exp. Zool. B Mol. Dev. Evol. 308, 308–321.
Warren, S. M., Brunet, L. J., Harland, R. M., Economides, A. N. and Longaker, M. T. (2003). The BMP antagonist noggin regulates cranial suture fusion. Nature 422, 625–629.
Watanabe, H., Shionyu, M., Kimura, T., Kimata, K. and Watanabe, H. (2007). Splicing factor 3b subunit 4 binds BMPR-IA and inhibits osteochondral cell differentiation. J Biol Chem 282, 20728–20738.
115
Willert, K., Brown, J. D., Danenberg, E., Duncan, A. W., Weissman, I. L., Reya, T., Yates, J. R. and Nusse, R. (2003). Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448–452.
Williams, B. O. and Insogna, K. L. (2009). Where Wnts went: the exploding field of Lrp5 and Lrp6 signaling in bone. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 24, 171–178.
Wills, A. E., Choi, V. M., Bennett, M. J., Khokha, M. K. and Harland, R. M. (2010). BMP antagonists and FGF signaling contribute to different domains of the neural plate in Xenopus. Dev Biol 337, 335–350.
Wilson, P. A. and Hemmati-Brivanlou, A. (1995). Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 376, 331–333.
Wright, C. V., Morita, E. A., Wilkin, D. J. and De Robertis, E. M. (1990). The Xenopus XIHbox 6 homeo protein, a marker of posterior neural induction, is expressed in proliferating neurons. Development 109, 225–234.
Wu, Q., Chen, X., Zhang, J., Loh, Y.-H., Low, T.-Y., Zhang, W., Zhang, W., Sze, S.-K., Lim, B. and Ng, H.-H. (2006). Sall4 interacts with Nanog and co-occupies Nanog genomic sites in embryonic stem cells. J Biol Chem 281, 24090–24094.
Wylie, C., Kofron, M., Payne, C., Anderson, R., Hosobuchi, M., Joseph, E. and Heasman, J. (1996). Maternal beta-catenin establishes a “dorsal signal” in early Xenopus embryos. Development 122, 2987–2996.
Xiong, W., He, F., Morikawa, Y., Yu, X., Zhang, Z., Lan, Y., Jiang, R., Cserjesi, P. and Chen, Y. (2009). Hand2 is required in the epithelium for palatogenesis in mice. Dev Biol 330, 131–141.
Xu, R. H., Kim, J., Taira, M., Sredni, D. and Kung, H. (1997). Studies on the role of fibroblast growth factor signaling in neurogenesis using conjugated/aged animal caps and dorsal ectoderm-grafted embryos. J Neurosci 17, 6892–6898.
Yamaguchi, T. P., Bradley, A., McMahon, A. P. and Jones, S. (1999). A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development 126, 1211–1223.
Yang, J., Chai, L., Liu, F., Fink, L. M., Lin, P., Silberstein, L. E., Amin, H. M., Ward, D. C. and Ma, Y. (2007). Bmi-1 is a target gene for SALL4 in hematopoietic and leukemic cells. Proc Natl Acad Sci USA 104, 10494–10499.
Yang, J., Corsello, T. R. and Ma, Y. (2012). Stem cell gene SALL4 suppresses transcription through recruitment of DNA methyltransferases. J Biol Chem 287, 1996–2005.
116
Yost, C., Torres, M., Miller, J. R., Huang, E., Kimelman, D. and Moon, R. T. (1996). The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 10, 1443–1454.
Yu, S. R., Burkhardt, M., Nowak, M., Ries, J., Petrásek, Z., Scholpp, S., Schwille, P. and Brand, M. (2009). Fgf8 morphogen gradient forms by a source-sink mechanism with freely diffusing molecules. Nature 461, 533–536.
Zhang, J., Tam, W.-L., Tong, G. Q., Wu, Q., Chan, H.-Y., Soh, B.-S., Lou, Y., Yang, J., Ma, Y., Chai, L., et al. (2006). Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat Cell Biol 8, 1114–1123.
Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L. and Kuehn, M. R. (1993). Nodal is a novel TGF-beta-like gene expressed in the mouse node during gastrulation. Nature 361, 543–547.
Zimmerman, L. B., De Jesús-Escobar, J. M. and Harland, R. M. (1996). The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell 86, 599–606.
Zuniga, E., Rippen, M., Alexander, C., Schilling, T. F. and Crump, J. G. (2011). Gremlin 2 regulates distinct roles of BMP and Endothelin 1 signaling in dorsoventral patterning of the facial skeleton. Development.
117
Appendix I
RNA-Seq results from Chapter 3: Genes with >2-fold expression (direct Wnt activation vs. anterior neural)
Gene/Protein Clone ID Fold Increase
hnRNP H3 gi|52138902|gb|BC082630.1 1.51E+11
H3 histone, family 3B gi|27503243|gb|BC042290.1 1.04E+11
glutamate ammonia ligase gi|49256010|gb|BC073448.1 39422399227
protein phosphatase type 1 alpha, catalytic subunit
gi|27695193|gb|BC041730.1 2824225487
ki-67 gi|115527315|gb|BC124560.1 1131777.541
copper chaperone for superoxide dismutase
gi|50418348|gb|BC077488.1 3919.698435
foxI4.2 gi|50418055|gb|BC078036.1 1329.542265
ephrin-A4 gi|183985625|gb|BC166129.1 1297.844383
smad4 gi|54037962|gb|BC084196.1 1053.601949
cdx-2 gi|84105446|gb|BC111473.1 600.0062069
eukaryotic translation initiation factor 3 subunit 10
gi|35505403|gb|BC057711.1 414.3164277
churchill gi|114107852|gb|BC123207.1 369.3076365
pip4k2a gi|120537387|gb|BC129059.1 328.1431677
hnRNPk gi|27882468|gb|BC044711.1 319.4817015
MGC83026 gi|49118646|gb|BC073670.1 226.469437
tpno2 gi|54673692|gb|BC084978.1 222.1449285
nol12 gi|114107789|gb|BC123345.1 151.6234281
epithelial V-like antigen 1 gi|50415563|gb|BC077583.1 147.2011472
sfrs6 gi|28422194|gb|BC044265.1 126.0892513
xirg protein-like gi|213623421|gb|BC169722.1 87.788455
prickle1 gi|68533725|gb|BC098954.1 83.19938866
znf384 gi|50415185|gb|BC077403.1 69.76482898
rac-beta serine/threonine-protein kinase B gi|47939912|gb|BC072041.1 62.12571541
118
Gene/Protein Clone ID Fold Increase
ccbl-2 gi|30046518|gb|BC051239.1 44.93558411
p80 katanin gi|66910749|gb|BC097654.1 40.55422632
zeb2 gi|54648610|gb|BC084972.1 33.47771521
Zmiz1 gi|51513014|gb|BC080428.1 30.23438945
angiopoietin 4/5 gi|189442243|gb|BC167504.1 27.19110778
hcf-1 gi|52138923|gb|BC082658.1 26.78440995
ccr4-not transcription complex, subunit 10
gi|50416369|gb|BC077237.1 21.48403283
fam107a/b MGC78851 gi|51261937|gb|BC079918.1 21.17179772
nucleoporin Seh1B: MGC82845 protein gi|49118558|gb|BC073561.1 19.13482551
pi3k related SMG1: hypothetical protein MGC98890
gi|68226704|gb|BC098320.1 17.94963894
epsin-2: hypothetical protein MGC81482 gi|46249599|gb|BC068837.1 16.4173713
srsf7 gi|50603926|gb|BC077393.1 16.33581603
sf3b4 gi|28374169|gb|BC045264.1 15.37049865
pptc7: MGC81279 protein gi|49257211|gb|BC071109.1 13.98198898
meis3 gi|54673770|gb|BC084920.1 13.07065969
origin recognition complex, subunit 6 homolog-like
gi|50603595|gb|BC077746.1 13.01809093
daxx: hypothetical protein LOC446279 gi|86577707|gb|BC112947.1 12.67764239
acsl4 hypothetical protein LOC100174803
gi|189442239|gb|BC167498.1 11.62060714
necap2 MGC83534 protein gi|50927256|gb|BC079728.1 10.9853218
timp3: tissue inhibitor of metalloproteinases-3
gi|38014484|gb|BC060423.1 10.67580536
frizzled homolog 7 gi|27503170|gb|BC042228.1 9.299494092
serine/threonine/tyrosine-interacting protein B
gi|54311224|gb|BC084791.1 9.188383287
ubadc1 hypothetical protein MGC115132 gi|62471528|gb|BC093557.1 8.970846126
cdca A7L transcription factor RAM2 gi|116487713|gb|BC126014.1 8.574819986
klf10: hypothetical protein MGC98877 gi|62089536|gb|BC092147.1 7.695378855
ivns1abp influenza virus NS1A binding protein
gi|49898869|gb|BC076641.1 7.664198955
119
Gene/Protein Clone ID Fold Increase
MGC80567 protein gi|50417996|gb|BC077854.1 7.544735234
lchn hypothetical protein MGC114999 gi|71050977|gb|BC098994.1 7.224153034
rabgap1l: hypothetical protein MGC52980
gi|27694685|gb|BC043775.1 7.11745345
ptn1 pleiotrophin: MGC84465 protein gi|49257697|gb|BC074426.1 6.911246415
arrb1 arrestin, beta 1 gi|49904092|gb|BC076815.1 6.832358987
txnrd3 Thioredoxin reductase 2 MGC81848 protein
gi|51704105|gb|BC081053.1 6.824096832
lims1-b LIM domain: hypothetical protein MGC81174
gi|47939771|gb|BC072204.1 6.795291868
lmo7: LIM domain containing: MGC180040
gi|197245592|gb|BC168520.1 6.755182581
arrdc3 arrestin containing hypothetical protein MGC131006
gi|80476391|gb|BC108545.1 6.57050044
cant1 Calcium activated nucleotidase similar to Ca2+-dependent endoplasmic
reticulum nucleoside diphosphatase
gi|27370857|gb|BC041215.1 6.486609662
d7 protein gi|58702035|gb|BC090198.1 6.413210477
dact1 dapper 1 Antagonist of beta-catenin FRODO
gi|50418314|gb|BC077380.1 6.403341734
rassf7 Ras assiciation domain containing MGC78972 protein
gi|84105479|gb|BC111512.1 6.017970041
sox11 XLS13B protein gi|47124741|gb|BC070707.1 5.989392572
myt1 cDNA clone MGC:196991 gi|213626262|gb|BC170264.1 5.974437792
zmiz2 MGC86475 protein gi|51513014|gb|BC080428.1 5.658053905
zc3h7b zinc-finger CCCH-containing 7B MGC80522 protein
gi|50418254|gb|BC077837.1 5.638059804
pcna similar to proliferating cell nuclear antigen
gi|27371152|gb|BC041549.1 5.340877685
stx19 syntaxin 19 hypothetical LOC494752
gi|52354747|gb|BC082852.1 5.239206209
hmg-box protein HMG2L1 gi|213625180|gb|BC169998.1 5.171640761
kif20a hypothetical LOC495414 gi|54648449|gb|BC084922.1 5.055010856
slc7a3 solute carrier family 7 (cationic amino acid transporter, y+ system),
member 3
gi|27503399|gb|BC042222.1 4.989471538
120
Gene/Protein Clone ID Fold Increase
lmo7 cDNA clone MGC:180040 gi|197245592|gb|BC168520.1 4.861028301
mark2 MAP/microtubule affinity-regulating kinase 2
gi|27694574|gb|BC043730.1 4.821716572
anp32b MGC80871 protein gi|49118408|gb|BC073408.1 4.77985399
cyclin A2 gi|50417439|gb|BC077260.1 4.76329664
pppde2 peptidase domain containing MGC84710 protein
gi|49256350|gb|BC074444.1 4.724302826
ctdp1 serine phosphatase gi|62185666|gb|BC092306.1 4.712553945
ornithine decarboxylase-2 gi|28838468|gb|BC047954.1 4.690222394
ube2c hypothetical LOC496302 gi|57032917|gb|BC088818.1 4.676640452
Efr3a MGC83628 protein gi|51950039|gb|BC082437.1 4.653269077
dlg7 discs large hypothetical protein MGC116559
gi|68534624|gb|BC099363.1 4.501586994
stxbp3 hypothetical protein MGC115462 syntaxin binding protein 3 (stxbp3)
gi|72679360|gb|BC100235.1 4.472242676
acy-3: aspartoacylase-3 gi|116487526|gb|BC125990.1 4.452697089
ptdss2 cDNA clone MGC:179871 gi|197246680|gb|BC168517.1 4.234011971
tcf-7 transcription factor 7 (T-cell specific, HMG-box)
gi|51261404|gb|BC079972.1 4.200569032
lsp1 lymphocyte specific protein 1hypothetical protein LOC100158340
gi|115528236|gb|BC124864.1 4.124150256
nphp3 nephronophthisis 3 MGC80264 protein
gi|50603779|gb|BC077320.1 4.066245125
med 15 Mediator complex subunit 15 ARC105 protein
gi|47123916|gb|BC070536.1 4.029208683
cyclin E3 gi|58701930|gb|BC090214.1 3.970372822
fam60a hypothetical protein MGC115222 gi|66910763|gb|BC097689.1 3.940864045
ahctf1 AT hook containing transcription factor 1 MGC83673 protein
gi|49903664|gb|BC076775.1 3.892143367
rhebl1 Ras homolog enriched in brain like 1 hypothetical LOC495056
gi|54037975|gb|BC084211.1 3.882231045
rnf8a ring finger protein (C3HC4 type) 8 gi|28279439|gb|BC046256.1 3.801782364
ccnt2 cyclin T2 MGC81210 protein gi|51895950|gb|BC081000.1 3.755306852
121
Gene/Protein Clone ID Fold Increase
tmed2 transmembrane emp24 domain trafficking protein 2 coated vesicle
membrane protein
gi|28277265|gb|BC044095.1 3.747391508
mta1 metastatic associated 1 MGC83916 protein
gi|51950045|gb|BC082445.1 3.743645989
MAPK8/jnk1 mitogen-activated protein kinase 8
gi|28422153|gb|BC046834.1 3.733178442
psmd4 26S proteasome subunit gi|66910701|gb|BC097551.1 3.729782795
poldip3 polymerase delta interaction protein 3 hypothetical protein
MGC114944
gi|62471555|gb|BC093543.1 3.720246762
dnajcb5 cDNA clone MGC:83536 gi|51703523|gb|BC081115.1 3.720172358
ncbp2 Nuclear cap binding protein 2 gi|49117074|gb|BC072902.1 3.701358817
fxdy domain containing ion transport gi|125859119|gb|BC129686.1 3.694185141
ano5 Anoctamin 5 or Tmem16e gi|50418049|gb|BC077486.1 3.642280513
Not Annotated gi|62739385|gb|BC094151.1 3.628720112
ttc30a tetratricopeptide repeat domain 30a
gi|47938700|gb|BC072174.1 3.547737229
f2rl1 Coagulation factor 2 receptor like 1 gi|57033014|gb|BC088935.1 3.518659172
csda cols shock protein domain containing A
gi|161611734|gb|BC155913.1 3.51654861
fus Fused in Sarcoma gi|49522197|gb|BC074437.1 3.505453855
exo1 exonuclease 1 gi|54035217|gb|BC084102.1 3.494289274
cfp complement factor properdin gi|50415018|gb|BC077925.1 3.468804465
ferritin light chain gi|34785676|gb|BC057216.1 3.464575104
cdc25c gi|213626377|gb|BC169346.1 3.456754005
slc44a1 solute carrier family 44 member 1
gi|52354612|gb|BC082837.1 3.306234736
pcf11 cleavage and poly-adenylation factor
gi|50414592|gb|BC077233.1 3.277333059
slc9a1 or NHE3 solute carrier family 9 member 3
gi|157422994|gb|BC153791.1 3.274941479
anks1a Ankyrin repeat and sterile alpha motif domain containing 1a
gi|47682305|gb|BC070831.1 3.249886264
122
Gene/Protein Clone ID Fold Increase
ap2b1 adaptor-related protein complex 1 beta 1 subunit
gi|120538239|gb|BC129531.1 3.240669681
Not Annotated gi|76780224|gb|BC106027.1 3.21623043
ctnnd1 Catenin (Cadherin associated protein) delta-1
gi|213623207|gb|BC169434.1 3.210767484
gcat Glycine C-acetyltransferase gi|28704125|gb|BC047258.1 3.210735376
beta arrestin gi|49256118|gb|BC072973.1 3.173896459
slc9a3r2 gi|55778573|gb|BC086464.1 3.167840103
ctdp1 (carboxy-terminal domain, RNA polymerase II, polypeptide A)
phosphatase, subunit 1
gi|51950263|gb|BC082378.1 3.162965383
max bHLH gi|47123961|gb|BC070710.1 3.144295944
mpv17l gi|51261416|gb|BC079982.1 3.11285403
fibronectin 1 gi|49114986|gb|BC072841.1 3.110364743
sfrs5 gi|47717980|gb|BC070967.1 3.1059201
transmembrane protein 45B gi|120538262|gb|BC129609.1 3.030355684
lysine (K)-specific demethylase 6A gi|50603932|gb|BC077424.1 3.026903047
ralGDS/AF-6 gi|84105479|gb|BC111512.1 2.963378492
mek-2 gi|27694983|gb|BC043913.1 2.955122189
calpain 2, (m/II) large subunit gi|39645066|gb|BC063733.1 2.924548179
phd finger protein 12 gi|46249573|gb|BC068803.1 2.89562217
pax interacting (with transcription-activation domain) protein 1
gi|50417566|gb|BC077588.1 2.822971349
mediator complex subunit 16 gi|62471580|gb|BC093546.1 2.822152806
xrmd-2 microtubule-associated protein gi|58702063|gb|BC090235.1 2.803700074
tyrosine kinase 2 gi|49118136|gb|BC073112.1 2.790804764
methyltransferase like 3 gi|46249483|gb|BC068672.1 2.782222309
glycine amidinotransferase (L-arginine:glycine amidinotransferase)
gi|28838491|gb|BC047973.1 2.746369891
syntaxin 5 gi|76779222|gb|BC106704.1 2.704962367
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
gi|47939754|gb|BC072192.1 2.686442963
G-2 and S-phase expressed 1 gi|62471553|gb|BC093540.1 2.683239948
123
Gene/Protein Clone ID Fold Increase
rbl1 gi|47123210|gb|BC070856.1 2.680418663
nucleoporin 93kDa gi|27924241|gb|BC045089.1 2.672333338
embryonic ectoderm development gi|50603665|gb|BC077425.1 2.655016847
ring finger and CCCH-type domains 1 gi|46250191|gb|BC068669.1 2.646867856
integrin, beta 5 gi|49899756|gb|BC076844.1 2.636182901
ataxin 2 gi|66910767|gb|BC097692.1 2.634583223
chromosome 19 open reading frame 2 gi|50415135|gb|BC077366.1 2.630865817
prp4 pre-mRNA processing factor 4 homolog
gi|51703477|gb|BC081044.1 2.62131998
protein phosphatase methylesterase 1 gi|50418398|gb|BC077600.1 2.617432826
orthodenticle homeobox 2 gi|50417481|gb|BC077357.1 2.616883223
chromosome 13 open reading frame 34 gi|49523107|gb|BC075159.1 2.599294339
dazap1 gi|50604139|gb|BC077252.1 2.585999275
fshd region gene 1 gi|49256477|gb|BC074376.1 2.555875944
serine/threonine kinase 11 interacting protein
gi|47682952|gb|BC070809.1 2.553165597
carboxy-terminal kinesin 2 gi|54038135|gb|BC084431.1 2.538623487
survival of motor neuron 2, centromeric gi|46249513|gb|BC068721.1 2.535840144
sal-like 1 gi|37590272|gb|BC059284.1 2.505331347
nima (never in mitosis gene a)-related kinase 2
gi|27696903|gb|BC043822.1 2.503175185
zf-containing gi|213623475|gb|BC169799.1 2.493496644
drebrin-like gi|49257631|gb|BC074277.1 2.479066307
jumonji domain containing 6 gi|28277358|gb|BC045252.1 2.4687995
inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
gi|27696824|gb|BC044039.1 2.448101925
chaperonin containing TCP1, subunit 8 (theta)
gi|67678231|gb|BC097574.1 2.447348026
LIM domain containing preferred translocation partner in lipoma
gi|62740239|gb|BC094110.1 2.445439839
cytochrome c-1 gi|71052231|gb|BC099350.1 2.442233526
kiaa0182 gi|120537359|gb|BC129052.1 2.438699731
124
Gene/Protein Clone ID Fold Increase
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP
cyclohydrolase
gi|76779775|gb|BC106381.1 2.42732299
ribonucleoprotein A1a gi|47938743|gb|BC072090.1 2.419006697
caspase 3, apoptosis-related cysteine peptidase
gi|68533747|gb|BC098991.1 2.408087828
ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog)
gi|28839012|gb|BC047985.1 2.407955386
protein tyrosine kinase 7 gi|148922111|gb|BC146640.1 2.387741643
integrator complex subunit 2 gi|47125091|gb|BC070524.1 2.387717766
prpf4b gi|125858002|gb|BC129065.1 2.375801846
transmembrane protein 33 gi|49903380|gb|BC076764.1 2.371301594
non-SMC condensin II complex, subunit D3
gi|49116983|gb|BC073714.1 2.363179599
sin3 homolog B, transcription regulator gi|120538596|gb|BC129063.1 2.353559822
splicing factor, arginine/serine-rich 18 gi|47940261|gb|BC072160.1 2.350873591
mediator complex subunit 23 med23 gi|39645714|gb|BC063725.1 2.349851184
phospholipase A2-activating protein gi|115528262|gb|BC124847.1 2.344309729
minichromosome maintenance complex component 4
gi|49115033|gb|BC072870.1 2.342847336
nop2/sun domain family, member 2 gi|66912075|gb|BC097814.1 2.339817652
general transcription factor IIE, polypeptide 2, beta 34kDa (gtf2e2)
gi|58403335|gb|BC089287.1 2.320004209
rho GTPase activating protein 19 gi|48734660|gb|BC072338.1 2.309370554
ccr4-not transcription complex, subunit 10
gi|46250097|gb|BC068748.1 2.298100702
lysine (K)-specific demethylase 3A gi|47506877|gb|BC070982.1 2.296984096
zinc finger and BTB domain containing 44
gi|47124748|gb|BC070714.1 2.293259115
phosphatidylinositol glycan anchor biosynthesis, class T
gi|52354598|gb|BC082818.1 2.284755462
heterogeneous nuclear ribonucleoprotein A3
gi|213625122|gb|BC169881.1 2.283526595
Putative ortholog of von Hippel-Lindau binding protein 1 (Prefoldin subunit 3)
gi|163916339|gb|BC157499.1 2.278221284
125
Gene/Protein Clone ID Fold Increase
nucleoporin 37kDa gi|51703531|gb|BC081128.1 2.271537693
activating transcription factor 1 gi|61403334|gb|BC092037.1 2.266325959
nedd4 family interacting protein 2 gi|50924805|gb|BC079714.1 2.262854343
gi|33416619|gb|BC055957.1 2.260893298
proteasome (prosome, macropain) 26S subunit, ATPase, 3
gi|28422358|gb|BC046948.1 2.253753391
family with sequence similarity 109, member B
gi|47122977|gb|BC070645.1 2.237428018
translation initiation factor 4E family member 3
gi|49257962|gb|BC071126.1 2.230893103
ets variant gene 4 gi|50417509|gb|BC077414.1 2.224884491
G kinase anchoring protein 1 gi|49118875|gb|BC073450.1 2.208726268
sall-like 4 gi|52138969|gb|BC082637.1 2.190818022
chromobox homolog 5 gi|32766466|gb|BC054962.1 2.18484743
ccr4-not transcription complex, subunit 6-like
gi|47506927|gb|BC071015.1 2.17052701
uridine-cytidine kinase 2 gi|52354745|gb|BC082833.1 2.153018907
yy1 transcription factor b gi|50925274|gb|BC079731.1 2.144522678
karyopherin alpha 4 (importin alpha 3) gi|47122818|gb|BC070533.1 2.143067042
syntaxin 5 gi|76779222|gb|BC106704.1 2.132374185
PRP4 pre-mRNA processing factor 4 homolog B
gi|54038077|gb|BC084355.1 2.120332678
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
gi|49118216|gb|BC073213.1 2.110063412
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
gi|27503409|gb|BC042250.1 2.104752746
AT hook containing transcription factor 1 gi|55250536|gb|BC086281.1 2.095665156
proline-rich nuclear receptor coactivator 2
gi|54038003|gb|BC084247.1 2.080782448
yy1 gi|50415555|gb|BC077581.1 2.079401267
ptk7 gi|38014809|gb|BC060500.1 2.074966481
H3 histone, family 3B (H3.3B) gi|47506868|gb|BC070966.1 2.05094159
bromodomain containing 1 gi|49118425|gb|BC073421.1 2.046475407
126
Gene/Protein Clone ID Fold Increase
mllt6 gi|52354628|gb|BC082872.1 2.041361526
RAS oncogene family gi|33416685|gb|BC056054.1 2.03028667
RAB6A, member RAS oncogene family gi|28302337|gb|BC046683.1 2.027277987
transcription factor 3 (E2A immunoglobulin enhancer binding factors
E12/E47)
gi|28422165|gb|BC046840.1 2.026584776
cell division cycle 20 homolog gi|50370183|gb|BC076805.1 2.012178568
sema domain, transmembrane domain (TM), and cytoplasmic domain,
(semaphorin) 6D
gi|213626595|gb|BC169687.1 2.010828849
lethal giant larvae homolog 1 gi|47123133|gb|BC070788.1 2.000831812
127
Appendix II
List of PCR primers used in this work
Primers used for Cel1 assays:
Gene Forward Reverse
xt noggin
eGFP 5’-CAGTGCTTCAGCCGCTACC-3’ 5’-CTGGTAGTGGTCGGCGAGC-3’
Primers used for RT-PCR and qPCR:
Gene Forward Reverse
cdx2 (qPCR)
5’-ACATACCGGGATCCAAGACA-3’ 5’-CAGCCTGAGTCTGCTGGATT-3’
eef1a1 (RT-PCR/
qPCR)
5’-CCCTGCTGGAAGCTCTTGAC-3’ 5’-GGACACCAGTCTCCACACGA-5’
en2 (RT-PCR)
5’-CAGCCTGGGTCTACTGCAC-3’ 5-CTTTGCCTCCTCTGCTCAGT-3’
epidermal keratin
(RT-PCR)
5’-GACCTGGAAGGGAAGATCC-3’ 5’-GAAGAGCCAGCTCATTCTCAA-3’
hoxb9 (qPCR)
5’-TACTTACGGGCTTGGCTGGA-3’ 5’-AGCGTGTAACCAGTTGGCTG-3’
hoxb9 (RT-PCR)
5’-CTCCAGCAGCCAAATTCTCT-3’ 5’-CAGTTGGCTGAGGGGTTG-3’
krox20 (RT-PCR)
5’-CCAGTGACTTTTGGTAGTTTTGTG-3’
5’-TGGACGAGTAGGAGAAATCCA-3’
meis3 (qPCR)
5’-CAGGATACAGGGCTCACGAT-3’ 5’-CTTGGGGCTGCTGTGTAATC-3’
meis3 (RT-PCR)
5’-ATGATCGTGATGGCTCTTCC-3’ 5’-CCCTGTGCGATTAGATTGGT-3’
128
Gene Forward Reverse
muscle actin (RT-
PCR)
5’-GACTCTGGGGATGGTGTGAC-3’ 5’-AGCAGTGGCCATTTCATTCT-3’
odc (RT-PCR/
qPCR)
5'-GGGCTGGATCGTATCGTAGA-3' 5'-TGCCAGTGTGGTCTTGACAT-3'
otx2 (RT-PCR)
5’-TATCTCAAGCAACCGCCATA-3’ 5’-AACCAAACCTGGACTCTGGA-3’
pou25 (qPCR)
5’-GGGCCACCACTATCCCTAAT-3’ 5’-GTGTGTAGCCCAGGGACACT-3’
pou60 (qPCR)
5’-AGTTTGCCAAGGAGCTGAAA-3’ 5’-GGACTCAAAGCGGCAGATAG-3’
pou91 (qPCR)
5’-ACTTATTTGCCCCGTCTCCT-3’ 5’-CCCCATTCAGATCACTTGCT-3’
sall1 (qPCR)
5’-GAGAGGGGTCAAATCCATCG-3’ 5’-GGAGGTGGTGGATTTTCATTC-3’
sall4 (qPCR)
5’-TGTCAAAGGATGAGCATTCG-3’ 5’-CATGCGGTCAGAGGGTACTT-3’
Primers used for ChIP:
Gene Forward Reverse
meis3 5’-CACTGTAAGTTATTGCCTCAAAGG-3’
5’-AGCTTGTAATACTTGTGGGCTTT-3’
sall4 intron 1
5’-GGGAGTTGGAAGGTACAAAGC-3’ 5’-AACCAAACAATAGACGAAAAATAAA-3’
xmlc2 5’-TGGGATATTTTACTGAACACAATG-3’
5’-CGTCCTGTGCCACCTAATG-3’
129
Primers used for probe synthesis:
Gene Forward Reverse
Xl sall1 5’-CTTTCAAAGCATGGTGAGCA-3’
5’-ATGGCACGATGGACACTGTA-3’
Xl sall4 5’-CTTGGTGCGCACTTATCTCA-3’
5’-GCCTCAGATTGTGTGGGACT-3’
Xl hnRNPH3 5’-GAAAATGCTCTGGGGAAACA-3’
5’-TCGTGTGTTGCAAATTCCAC-3’
Primers used for Sub-cloning (Underline: RE site and lowercase: FLAG-tag sequence):
Gene Forward Reverse
Xt noggin (Full length)
5’-GAATTCGGGCTCTGAACTTCCACTTG-3’
5’-GCGGCCGCTCAACATGAACATTTGCACTCA-3’
Xl FLAG-β-catenin
5’-GCATGAATTCCCACCATGGCAACTCAAGCAGATCT-3’
5’-GCTAGCGGCCGCTTActtatcgtcgtcatccttgtaatcCAAGTCAGTGTCAAACCAGG-3’
Xt sall4 (Full length)
5’-CGATGTCGACGGACCATGTCGAGGCGAAAGCAGCC-3’
5’-ATCGATCCTCGAGTTActtatcgtcgtcatccttgtaatcGTTCACCGCAATATTTT-3’
130
Appendix III
List of DNA plasmids used in this work
Plasmids used for in situ hybridization probe sythesis:
Plasmid # Gene Vector Cut with:
Transcribe with:
Note
96 hoxb9 pGEM EcoRI T7
97 myoD pBS KS+ HinDIII T7
167 krox20 pGEM4 BamHI Sp6
302 otx2 pBS SK- NotI T7
1104 sox2 pCS2 EcoRI T7
1346 hoxd10 pCS-107 SalI T7
1425 hoxc10 pCS-107 SalI T7
2048 Nkx6.1 pBS XhoI T7
2396 n-tubulin pBSK BamHI T7
2491 snai2 pBS SK- NotI T3
2603 sall4 TOPO pCRII KpnI T7 Not full length
2604 sall1 TOPO pCRII BamHI T7 Not full length
2605 pou60 CS2 HinDIII T7
2606 pou25 CS2 BamHI T7
2607 pou91 CS2 BamHI T7
2615 cdx2 pGEMT-EZ SacII Sp6
2616 hnRNP H3 TOPO pCRII NotI T7 Not full length
154 (trop) en2 TOPO pCRII SpeI T7
155 (trop) krox20 TOPO pCRII SpeI T7
187 (trop) hoxb9 pCMVSPORT6 EcoRI T7
203 (trop) msx2 pCS-107 EcoRI T7
131
Plasmid # Gene Vector Cut with:
Transcribe with:
Note
274 (trop) sox9 pCS-107 BsrgI T7
287 (trop) edn1 PCS-107 EcoRI T7
288 (trop) col2a pCMVSPORT6 AgeI T7
306 (trop) bmp7 pCMVSPORT6 KpnI T7
31 (trop) otx2 pCS-107 EcoRI T7
471 (trop) hand2 pCS-107 EcoRI T7
472 (trop) ahctf1 pCS-108 SalI T7 Image: 7552963
473 (trop) churchill pCMVSPORT6 EcoRI T7 Image: 6980207
474 (trop) foxi4.2 pCMVSPORT6 EcoRI T7 Image: 5336445
475 (trop) znf384 pExpress1 XbaI T7 Image: 7017260
476 (trop) zmiz1 pCMVSPORT6 EcoRI T7 Image: 7793374
477 (trop) max pCMVSPORT6 EcoRI T7 Image: 6988059
478 (trop) sall1 pCMVSPORT6 EcoRI T7 Image: 7677318
479 (trop) sall4 pCMVSPORT6 EcoRI T7 Image: 5307468
480 (trop) sox11 pCMVSPORT6 EcoRI T7 Image: 6979794
481 (trop) hnRNPk pCMVSPORT6 EcoRI T7 Image: 5379554
482 (trop) sf3b4 pCMVSPORT6 EcoRI T7 Image: 5383583
483 (trop) sap130 pCMVSPORT6 EcoRI T7 Image: 7689619
484 (trop) sfrs7 pCMVSPORT6 EcoRI T7 Image: 6976658
485 (trop) sfrs6 pCMVSPORT6 EcoRI T7 Image: 5307339
486 (trop) prickle1 pCS-107 EcoRI T7 TEgg011j18
487 (trop) lmo7 pCMVSPORT6 EcoRI T7 Image: 7677402
132
Plasmids used for synthetic RNA synthesis:
Plasmid # Gene Vector Cut with: Transcribe with:
Note
671 β-gal (Nuc.) CS2+ NotI Sp6
2304 Xt fgf8a pCS108 AscI Sp6
2444 TVGR CS2+ NotI Sp6
2550 25726EL pCS-108 AscI Sp6
2551 25728KK pCS-108 AscI Sp6
2552 eGFP-ZFN L pCS-108 AscI Sp6
2553 eGFP-ZFN R pCS-108 AscI Sp6
2554 25728EL pCS-108 AscI Sp6
2554 25758EL pCS-108 AscI Sp6
2555 25760EL pCS-108 AscI Sp6
2556 25763EL pCS-108 AscI Sp6
2557 25766KK pCS-108 AscI Sp6
2609 Xt sall4-FLAG pCS-108 AscI Sp6
2611 +4 bp noggin pCS-108 AscI Sp6
2612 –12 bp noggin pCS-108 AscI Sp6
2613 +3 bp noggin pCS-108 AscI Sp6
2617 25729EL pCS-108 AscI Sp6
2618 25730EL pCS-108 AscI Sp6
2619 25731KK pCS-108 AscI Sp6
2620 β-catenin-FLAG pCS-108 AscI Sp6
2621 25760 WT pCS-108 AscI Sp6 Cut with NotI for polyA-
2622 25766 WT pCS-108 AscI Sp6 Cut with NotI for polyA-
133
Plasmid # Gene Vector Cut with: Transcribe with:
Note
335 (trop) noggin pCS-107 AscI Sp6
134