Development, characterization, and transferability to other Solanaceae of microsatellite markers in...

Post on 18-Aug-2015

246 views 6 download

Tags:

description

A novel set of informative microsatellite markers for pepper (Capsicum annuum L.) is provided. Screening ofapproximately 168 000 genomic clones and 23 174 public database entries resulted in a total of 411 microsatellite-containingsequences that could be used for primer design and functional testing. A set of 154 microsatellite markers originatedfrom short-insert genomic libraries and 257 markers originated from database sequences. Of those markers, 147 (61from genomic libraries and 86 from database sequences) showed specific and scoreable amplification products and detectedpolymorphisms between at least 2 of the 33 lines of a test panel consisting of cultivated and wild Capsicumgenotypes. These informative markers were subsequently surveyed for allelic variation and information content.

Transcript of Development, characterization, and transferability to other Solanaceae of microsatellite markers in...

Development, characterization, and transferabilityto other Solanaceae of microsatellite markers inpepper (Capsicum annuum L.)Istva n Nagy, Aniko Sta gel, Zsuzsanna Sasva ri, Marion Ro der, and Martin GanalAbstract: A novel set of informative microsatellitemarkers for pepper (Capsicum annuum L.) is provided. Screening ofapproximately 168 000 genomic clones and 23 174 public database entries resulted in a total of 411 microsatellite-containingsequencesthat couldbeusedfor primer designandfunctional testing. Aset of 154microsatellitemarkers originatedfromshort-insert genomiclibraries and257markers originatedfromdatabasesequences. Of thosemarkers, 147(61fromgenomiclibraries and86fromdatabasesequences) showedspecificandscoreableamplificationproductsandde-tectedpolymorphismsbetweenat least 2of the33linesof atest panel consistingof cultivatedandwildCapsicumgenotypes. Theseinformativemarkers weresubsequentlysurveyedfor allelicvariationandinformationcontent. Theusefulnessof thenewmarkers for diversityandtaxonomicstudieswasdemonstratedbytheconstructionof consistentphylogenetictreesbasedonthemicrosatellitepolymorphisms. Conservationof asubset of microsatelliteloci inpep-per, tomato, andpotatowasprovenbycross-speciesamplificationandsequencecomparisons. For several informativepepper microsatellitemarkers, homologousexpressedsequencetag(EST) counterparts couldbeidentifiedinthesere-latedspeciesthat alsocarrymicrosatellitemotifs. Suchorthologscanpotentiallybeusedasreferencemarkers andcommonanchoringpointsonthegeneticmapsof different solanaceous species.Key words: pepper, Capsicum spp., microsatellite(SSR) markers, diversity studies, polymorphism, cross-species transfer-ability.Resume: Unenouvellecollectiondemicrosatellitesinformatifschezlepoivron(CapsicumannuumL.)est decrite.Lecriblagedenviron168000clonesgenomiqueset 23174entreesdanslesbanquesdedonneespubliquesapermisdidentifier 411sequencescontenant desmicrosatellites, deconcevoir desamorceset detester leurfonctionnement.Unjeude154marqueursmicrosatellitesaete derive debanquesgenomiquesa` insertsdepetitetaillealorsque257ont ete obtenusdelabanquededonnees. Decenombre, 147marqueurs(61desbanquesgenomiqueset 86desban-quesdedonnees)ont produit desampliconsspecifiqueset lisibleset ont permisdedetecter dupolymorphismeentreaumoinsdeuxdunpanel de33ligneescomprenant desgenotypescultiveset sauvagesdugenreCapsicum. Lutilite decesnouveauxmarqueurspourdesetudesdediversite et detaxonomieaete demontreeenproduisant desarbresphylo-genetiquesconcordantsbasessurlepolymorphismedesmicrosatellites. Laconservationdunsous-ensembledeslocusmicrosatellitechezlepoivron, latomateet lapommedeterreaete montreeparamplificationinterspecifiqueet lacomparaisondessequences. Pourplusieursmicrosatellitesinformatifsdupoivron, desetiquettesdesequenceexprimee(EST)homologuescomprenant desmicrosatellitesont ete identifieeschezcesespe`cesapparentees. Detelsortholo-guespeuvent potentiellement servirdemarqueursdereferenceet depointsdancragesurlescartesgenetiquesdesdif-ferentesespe`cesdesolanacees.Mots-cles : poivron, Capsicum spp., marqueurs microsatellites( SSR ), etudes de la diversite, polymorphisme, transpor-tabiliteinterspecifique.[Traduit par la Redaction]IntroductionMicrosatellites or simple sequence repeats (SSRs) areDNAsequences consistingof tandemlyrepeatedarrays ofshort (16nucleotides) motifsthat frequentlyexhibit poly-morphismbetweencloselyrelatedgenotypes. This polymor-phismis probably due to slipped-strand mispairing, andsimpletandemrepeatsmaybepredisposedtofurtherlengthchangesbyunequalcrossingoverand(or)subsequentrepli-cation, repair, or recombinationerrors (LevinsonandGut-Received 4 December 2006. Accepted 12 June 2007. Published on the NRC Research Press Web site at genome.nrc.ca on 3 August2007.Corresponding Editor: P. Gustafson.I. Nagy,1A. Stagel, and Z. Sasvari. Agricultural Biotechnology Center, Szent-Gyorgyi Albert u. 4, H-2100 Godollo, Hungary.M. Roder and M. Ganal.2Institut fur Pflanzengenetikund Kulturpflanzenforschung, Corrensstrae 3, D-06466 Gatersleben, Germany.1Corresponding author (e-mail:inagy1@gmx.net).2Present address: TraitGeneticsGmbH, Am Schwabeplan 1b, D-06466 Gatersleben, Germany.668Genome 50: 668688 (2007) doi:10.1139/G07-047 # 2007 NRC Canadaman1987). Asaresult, microsatelliteloci oftenmutatebyinsertionsordeletionsofoneormorerepeat elements, andthemutationratesgenerallyincreasewith anincreaseinthelength of the repeats (Wierdl et al. 1997; Xu et al. 2000). Aslocus-specificcodominant markersthat canbeanalyzedbyhigh-throughput PCR-based techniques, microsatellites areidealtools for differenttypes of fingerprintingand genotypeidentificationtasks as wellasfor constructionof frameworkmaps and for marker-assisted breeding (Rafalski et al.1996). The benefits of using informative microsatellitemarkers for saturation and integration of existing geneticmapshavebeendemonstratedinanumberofplant speciessuchaswheat(Roderetal. 1995, 1998;Guptaetal. 2002),rice (Temnykh et al. 2000), barley (Pillen et al. 2000; Ramsayet al. 2000; Li et al. 2003), maize(Sharopovaet al. 2002),Cucumis spp. (Gonzalo et al. 2005), and tomato (BrounandTanksley1996; AreshchenkovaandGanal 1999, 2002;Fraryet al. 2005).Pepper (CapsicumannuumL.) isanimportant vegetablecrop worldwide. Besides having relatively large genomes(3753to4763Mbindifferent Capsicumspecies, Bennettand Leitch2005), cultivatedpepper genotypes also exhibit alow level of molecular polymorphism; the lack of hypervari-ablemolecular markersinpepper hamperstheconstructionof saturated genetic maps. Although activities directed towardmicrosatellite marker development andmicrosatellite map-pinginpepper werereportedrecently(Huanget al. 2000;Lee et al. 2004; Ogundiwin et al. 2005), and proprietarymicrosatellitemarkershavebeenmadeavailablefor diver-sity studies and genetic mapping (Tamet al. 2005; BenChaim2005), thenumberofpresentlyavailablepepper mi-crosatellite markers is far fromthe number that wouldbenecessaryfor high-densitymappingandefficient genetar-geting.In this paper we report the development and primary char-acterizationofanovel set ofpepper microsatellitemarkersobtainedfrom genomiclibrariesand publicly availabledata-basesequencesaswell asdataconcerningthetransferabil-ityofthesemarkerstoothersolanaceousspecies.Materials and methodsLibrary screeningsGenomicDNAfromthepeppercultivarsC.annuumFe-herozon andC. annuum Blondywas digestedwith there-strictionenzyme MboI or Sau3AI. Size-selectedfragmentsbetween400and1000bpwereligatedintotheBamHIsiteof the ZAPExpress1vector (Stratagene). Packaging intophages, plating, hybridization, and in vivo excision wereperformed according to Roder et al. (1995, 1998).The construction and management of plasmid librariesenriched in single-copy sequences and the preparation ofhigh-densityhybridizationfiltersusingtheBioPick/BioGridroboticsystem(BioRoboticsLtd., UK) werecarriedout asdescribed by Pestsova et al. (2000). Filters were subse-quently hybridized with32P-labeled synthetic oligonucleo-tide probes representing the following motifs: poly(GA)and poly(GT) for dinucleotide motifs; (ACA)8, (AGA)8,(GAC)6, (ACT)7, (CAC)6, (GAG)6, (CGC)6, and (TAT)10 fortrinucleotide motifs; and (AACT)4, (ACAT)4, (GATA)4,(GACA)3, (GGCC)3, and (GGTT)4 for tetranucleotide motifs.Plasmid clones were sequenced on an ABI PRISM1377 or3100 automatic sequencer (Applied Biosystems) usingstandard sequencing procedures.Database searchesNucleotide sequences belonging tothe genus Capsicumwere retrievedfrom the EMBL databaseusing the SequenceRetrieval System (SRS) to build a stand-alone nucleotide da-tabase that could be searched using the utilities of theBLAST2 package (Altschul et al. 1997). All further databasemanagementand DNA sequencemanipulationswere carriedout onlocal PCs under the LinuxoperatingsystemusingstandardUNIX tools and public-domainbioinformaticssoft-ware. Searches toidentifyentries containingshort tandemrepeatswereperformedbythefuzznucnucleicacidpatternsearchprogramoftheEMBOSSsoftwarepackage(Riceetal. 2000).Data processingMicrosatellite-containingcloneswereinspectedindividu-ally with respect to sequencequality and suitabilityfor PCRamplification. Redundant clones werefilteredout bylocalBLAST analyses using the individual clones as queriesagainst the whole set of repeat-containing sequences. Primerpairsflankingthemicrosatellitemotifsweredesignedusingthe Primer3 program (release 0.9, Rozen and Skaletsky 2000).Plant materialTomeasure the level of microsatellite polymorphism, aset of 33 pepper genotypes was used, consisting of cultivatedvarieties, inbredlines, andwildCapsicumspecies.For testing the cross-species transferability of the markers,all developedmicrosatellitemarkers were tested for amplifi-cation in the followingspecies of the family Solanaceae:Solanumpimpinellifolium(formerlyLycopersiconpimpinel-lifolium), inbred line WaWa700; Solanum lycopersicum (for-merly Lycopersicon esculentum), inbred line 4889; andSolanum tuberosum Desiree (Table1).Analysis of microsatellite polymorphismsDNA was isolated from leaves of greenhouse plants usingstandard procedures (Dellaporta et al. 1983). PCR amplifica-tionswerecarriedout in25mLvolumeswith1050ngofgenomic DNAas template. Reaction mixtures contained10mmol/LTrisHCl(pH8.3), 50mmol/LKCl, 2.5mmol/L MgCl2, 0.5 U Taq polymerase, 200 nmol/L of the unlabeledreverse primers, 160 nmol/L of the fluorescently labeledforwardprimers, and0.2mmol/Lofeachdeoxynucleotide.Aninitial denaturationstepat 948Cfor 3minwas typi-callyfollowedby35cyclesof 928Cfor 1 min,60 8C for1min, and728Cfor1min.Thereactions wereterminatedbyafinal extensionstepat 728Cfor7min.For the first functional tests, unlabeledforwardprimerswere synthesized, andDNAof the parental andF1geno-typesofaninterspecific(C.frutescensTabasco C.ann-uumP4)andintraspecific(C. annuuumCM334 GF109)hybrid combination was used as template. Amplificationproducts were run on agarose gels and (or) on ALFex-pressTMII sequencers (GEHealthcare Life Sciences) withthe incorporation of Cy5-labeled dCTP (GE HealthcareLifeSciences). Incasesinwhichanewmarker provedtoNagy et al. 669# 2007 NRC Canadabe functional onthis primary test panel (i.e., it producedwell-defined fragments and showed at least 1 polymor-phismbetweenthe4parental genotypes), fluorescentlyla-beled forward primers were synthesized to enable furtheranalyses on automatic sequencers. Fragment analysis ofPCRproducts labeledbythe cyanine dye Cy5usingAL-FexpressTMIIsequencerswascarriedoutasdescribedelse-where(Li et al. 2003).To facilitate multiplexed semi-automated analysis oflargernumbersofsamplesonanAppliedBiosystems3100capillary sequencer, forward primers labeled with FAM(5-carboxyfluorescein) or JOE (6-carboxy-4,5-dichloro-2,7-dimethoxyfluorescein) were synthesized for selectedpolymorphic markers. Amplification products were ana-lysedafter simultaneouslyrunningFAM- andJOE-labeledPCRproducts and ROX(5-carboxy-X-rhodamine) labeledinternal size standards on 36 cmcapillaries with POP4polymer at 1500Vusinga15s injectiontime. Fragmentanalysis data fromcapillary runs were collected by thebuilt-in data collection software andpre-processed bytheGeneScan software (version 3.7, Applied Biosystems).GeneScandatawereimported, convertedtopseudogel im-ages, and further analyzed by the Genographer program(Benham2001).Polymorphisminformation content(PIC) valueswere cal-culatedaccordingto the following equation(Anderson et al.1992; Hedrick 1985):PIC 1 Xki1Pi2wherePiisthefrequencyoftheithalleleandkisthetotalnumber of different alleles at the locus. For each pepperSSRmarker, 2different PICindices werecalculated: oneTable 1. Genotypes used for polymorphism investigations.Species No. GenotypeInbred linesCapsicum annuum 1 MK1 (sweet conicalwax)2 MK2 (yellow blocky)3 MK3 (tomato shape)4 MK4 (white apple)5 MK5 (Lamuyo type)6 MK6 (red paprika)7 MK7 (dark greenblocky)8 MK8 (long pale green)9 Yolo Wonder (green tored blocky)10 Perennial (chile)11 P4 (red paprika)12 GF109 (red paprika)13 CM334 (chile)14 MN1 (purple leaf orna-mental)Wild Capsicum genotypesC. frutescens withC. chinense introgression15 TabascoC. chinense 16 chi117 chi718 chi2119 chi25C. eximium 20 exi1-104321 exi1-1052C. pubescens 22 pub223 pub324 pub5C. baccatum var. pendulum 25 pen126 pen6C. praetermissum 27 pra1C. chacoense 28 cha629 cha9C. baccatum var. baccatum 30 bac1031 bac20C. frutescens 32 fru3933 fru48Solanum genotypesSolanum pimpinellifolium 34 WaWa700Solanum lycopersicum 35 4889Solanum tuberosum 36 DesireeTable 2. Frequencies of microsatellitemotifs inpepper (Capsicum spp.) sequences in the EMBLdatabase and in genomic libraries.Frequency*RepeatDatabase(23 174 entries)Genomic libraries(55 296 clones)A 181 n.a.C 8 n.a.AC 17 12AG 104 11AT 29 10{AAC 21 0.5AAG 60 0.5AAT 20 7ACC 37 2ACG 2 0ACT 7 0.5AGC 24 0.3AGG 12 0.3ATC 27 0.3CCG 15 n.d.AAAC 0 0.3AAAG 2 n.d.AAAT 3 n.d.AACT 0.4 0.6AAGG 0.4 n.d.ACAT 0 0.3ACAG 0 0.3ATAG 0 0.3AATT 0.4 n.d.AGGG 0.4 n.d.AAAAG 0.4 n.d.ACTAT 0.4 n.d.Total 571.4 46.2Note: n.a., not applicable; n.d., not determined.*Occurrence per 10 000 clones or entries.{Not screened but found randomly.670 Genome Vol. 50, 2007# 2007 NRC Canada(PICa)fortheinformationcontent inC. annuum(14geno-types)andone(PICc)forall Capsicumgenotypesfromthesecondarytest panel (33genotypesbelongingto8species,including the 14 lines of C. annuum).Cluster analysisThepresenceor absenceof eachSSR allelewas coded as1 or 0, respectively. The resulting binary matrix was directlyused to construct unrooted phylogenetic trees with the DOL-LOPprogram. Pheneticanalysiswasperformedaftercalcu-latingpairwisegeneticsimilarityindices(Nei andLi 1979)fromthebinarymatrix, usingtheUPGMAmethodoptionof the NEIGHBORprogram. Consensus trees wererecon-structed bythe CONSENSEprogram; graphical renderingof the dendrograms was processed by the DRAWTREE pro-gram (PHYLIP package,version 3.6, Felsenstein 2005).Results and discussionGenomic librariesApproximately60 000phageclonesand108 000plasmidclones were used for the screening of microsatellite-containingsequences. Basedonanaverageinsert sizeof550bp, 80%of plasmids containing inserts, and 10%redundancy, thetotal length of the screened genomic sequences was estimatedto be 66 000 kb. The screenings revealed 512 positiveclones,whichcorrespondedtoonepositivecloneforevery129kb.However, formost ofthescreeningsonly(GA)nand(GT)ndinucleotide repeat probes were used for the plaque andcolonyhybridizations, andanumber of thepositiveclonesprovedtobefalsepositivesaftersequencing. Todeterminemore representative frequency estimates, 3 high-density filterscontaining 55 296 colonies were sequentially probed withdi-, tri-, and tetra-nucleotide repeats. All positive cloneswere isolated and sequenced and microsatellite-containingclones fromthe test filters were consideredfor frequencycalculations.Microsatellitemotif frequenciesAt thetimeofthesurvey, theEMBLsequencedatabase(release76)contained23 174entriesbelongingtothegenusCapsicum.Themajorityoftheseentries(about98%)repre-sentedshort partial cDNAsequences(conventionallycalledexpressedsequence tags or ESTs). The total lengthof allCapsicum sequences reached 10 828 kb. Search criteriawere set to identify microsatellite motifs of at least 16mononucleotide, 8dinucleotide, 5trinucleotide, 5tetranu-cleotide, or 5pentanucleotiderepeats, allowingfor onlyasingle mismatch. The searches resultedina total of 1322microsatellites, of which 438 represented mononucleotide,348dinucleotide, 519trinucleotide, 15tetranucleotide, and2pentanucleotide repeats. Thirty-nine sequences containedmorethanonemicrosatelliteand37SSRs occurredincom-pound form (excludingmononucleotidestretches).A/Tmononucleotiderepeats werethemost frequent mi-crosatellitemotifsinthedatabasesequences. Toavoidtar-getingpoly(A)tailsofcDNAsequences, searchcriteriaforA/T mononucleotiderepeats were set so that only sequencesthat contained A/T repeats at least 20 nucleotides away fromeitherthe5 orthe3 endwereselected. Withsuchcriteria,in almost 2% of the database sequences, A or T repeats longerthan 16 bp were found. The frequency of C/Gmononu-cleotide repeats was much lower (less than 0.01%). Screeningof genomic libraries for mononucleotide repeats was notundertaken. Thesamewastrueforthe(AT)nhybridizationprobe owing to its self-complementarity. However, (AT)nrepeat motifscanbefoundrelativelyfrequentlyat randominthesequencedgenomicclones, inthemajorityof casesas part of compoundrepeats. Thefrequencyof compoundSSRs is strikingly high in pepper genomic clones and,most typically, (AC)n or (AG)n microsatellites are associatedwith(AT)nrepeats.Trinucleotide repeats are the most abundant class of repeatmotifsinall cDNA-dominatedsequencedatabases(Chenetal. 2006; Choet al. 2000; Thiel et al. 2003). Inour study,the frequency of all specific trinucleotide repeats was39.2%, whilethefrequencyofmononucleotiderepeatswas33.1%and that of dinucleotide repeats was 26.3%, fromthetotal of1322identifiedmicrosatellites.All 10possible types of trinucleotide repeat motifs oc-curredindatabasesequencesof pepper. Themost frequentrepeat types inpepper wereAAG, ACC, andATC, whileACG and ACT repeats were relatively rare. Similar frequencypatternswerefoundintheglobal plant sequencedatabases(Katti et al. 2001; Toth et al. 2000), while CCGrepeatsseemed to dominate monocot ESTsequences (Cho et al.2000; Thiel et al. 2003). The occurrence of trinucleotiderepeatswasgenerallylowingenomiclibraries. Microsatel-lites with5or morerepeat unitsof tetra- andpenta-mericrepeatswerefoundat verylowfrequencyinbothtypesofsequence pools. The frequencies of different repeat typesfoundingenomic libraries andindatabase sequences aregiveninTable2.Toget someinformationonpossiblefrequencyoveresti-mations, aredundancyanalysisfordatabasesequenceswasperformedforthemost prominent dinucleotiderepeat type,(AG)n. Among240identified sequences containing(AG)nrepeats, 27 (11%) were found to be present redundantly,withanaverageoccurrenceof 3.4times.Theoverallredun-Table 3. Functionality of the newly developed microsatellite markers on a test panel consistingof 33Capsicumgenotypes.Genomic libraries Database sequencesNo. % No. %Primer pairs tested 154 257No amplification 29 18.8 42 16.3Weak or unspecific products, not scoreable 40 26.0 109 42.4Monomorphic 24 15.6 20 7.8Functional markers 61 39.6 86 33.5Nagy et al. 671# 2007 NRC CanadaTable 4. Allelic variation and information content of the informative GPMS markers.Capsicum annuum (14 genotypes) Capsicum spp. (33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICa No. of alleles PICc1 GPMS1 (AC)18 CCCTAATGCTTGACGTGG/ 121163 4 0.49 11 0.83GGTTAAGGGGGTTGGGG2 GPMS3 (CA)17(TA)21 ACTTGACAGTCGTGTATCTGCA/ 262282 1 0 6 0.73GGACTCCACCAGCTCAGTTC3 GPMS4 (GT)8GCG(TG)5(TA)7 TTGATTTTTAAAGCAAAGTCGG/ 196216 1 0 7 0.71ACAAGGAAATTCTTGCAGGG4 GPMS6 (AC)20imp(AT)5 CAGAGCACTTGACATGCCTT/ 122172 4 0.68 12 0.89GATCTTTATAGTAGCTCATCAATA5 GPMS8 (AT)9(GT)22TGATGATAAGGCCATGATAAAATG/ 159229 6 0.77 14 0.87CCAGATTCTTTAGCAAGGTTTACC6 GPMS29 (GT)15GGT7(GTT)2CAGGCAATACGGAGCATC/ 238255 4 0.60 7 0.83TGTGTTGCTTCTTGGACGAC7 GPMS37 (TC)18(TA)12ATTTGTATATTATTTCTTGGCCTTG/ 176182 3 0.60 4 0.67TGAACTACCCAATTCCAGCC8 GPMS93 (TA)14imp(GA)27impATCCTTGGCGTATTTTGCAC/ 202268 3 0.44 12 0.86TTCACTTTGCACACAGGCTT9 GPMS100 T5(GT)12TCCATACGGTTGGAGGAGAG/ 141169 4 0.57 7 0.83ACTATGCTCTGCTGTGCCCT10 GPMS101 (TC)16impCCTATCACCCTCTTTGAGCC/ 176211 2 0.46 6 0.67TAAAGACCAGCCCTGGATGA11 GPMS103 (CT)11TGGCAGTTGCAATATCAATCTC/ 134149 1 0 6 0.70AAACCTTGTCACGCATCCAT12 GPMS104 (AT)6(GT)11GGGTCATGGGATTTCTTTTC/ 96123 2 0.13 6 0.72ATTCAAACCATCCTTCAAGTTC13 GPMS107 (AT)7(GT)12AACTAATTCTTGTCTGAGCA/ 177182 2 0.13 4 0.62CATTTAACTTGATTTGATTG14 GPMS109 (AC)14(AT)7ATCTATGCATGCCATCACCG/ 165183 2 0.13 2 0.48TGGGCTAAAGGCCATGTTAC15 GPMS111 (AT)7(GT)12 TCAGAAGATGCCCATGTGTT/ 120132 1 0 2 0.17TACTGGCACACGAAGCAATC16 GPMS112 (AT)8(GT)19 TCCCTCAGCAGCAACAATTT/ 203280 5 0.76 10 0.86GTCGGGCTCTTTGATTGTGT17 GPMS113 (AT)20(AG)18 GCACAAGTCAATCCAAACGA/ 91172 9 0.86 15 0.90CAAAAAGATGATGATGGATGAGA18 GPMS117 (TA)25(GA)14 GATGTTAGGTCCGTGCTTCG/ 111177 5 0.76 11 0.86AAGCCCCATGGAAGTTATCC19 GPMS119 (GT)11G13 CTGGAATCTGTCAATTGGTTG/ 204224 3 0.54 6 0.81TCGTTTCATGATGGAATTGG20 GPMS140 (TA)7imp(CA)7(TA)4 AACACATCGGTGGGTAATCC/ 169199 1 0 6 0.63TGATTCCACCAGGCTTTAGG672GenomeVol.50,2007#2007NRCCanadaTable 4 (continued).Capsicum annuum (14 genotypes) Capsicum spp. (33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICaNo. of alleles PICc21 GPMS141 (AC)7(CA)2(TA)5CATACATACACACGCGCATG/ 100149 1 0 8 0.76TGAAATACGTTGTAATTATTATGGG22 GPMS142 (CA)6(TA)4TTCGACCTCTTGGTATTCCG/ 103125 1 0 5 0.56CACGACACATGGACTCCTTG23 GPMS147 (CT)19 AGGAGGATATTTTGGCAGCC/ 184240 1 0 7 0.69AAAAACACCCATGGGAAGTG24 GPMS150 (AT)4(AC)9. . .(AT)33 TGAGCGCTAACATATGTCGG/ 291299 1 0 4 0.58GGCCCTTCCTCAGATTTCTC25 GPMS151 (TC)13 ATCCTCGAACTTTGGTGTGG/ 183191 1 1 5 0.58TGCATGCTCAGCAGGTAGAG26 GPMS153 (AC)10imp(AT)9 TGCTAGCTTCAACTGGTCCC/ 200225 1 0 3 0.26TCAAATGTATGCATGCTTTGC27 GPMS154 (CA)4A(CA)9 AATCTAATTTCTCGCCTGCG/ 165178 2 0.50 5 0.67ATCACATTTTGGTTTTGGGG28 GPMS155 (TG)12impCA(TG)4 GGGCGAATCGAGCTACATAG/ 171173 2 0.13 2 0.06GGGATAGCGACAAAAAGTGC29 GPMS156 (GA)6(CA)6GATATAGAACCACACAAGACTGGG/ 228232 2 0.13 3 0.64TATGGCTCTTGCGGGAATAC30 GPMS157 (TG)7AATGCGCTGAAACCCAATAC/ 278305 1 0 8 0.68TTTGAGGAAACACTAAAAAGTGTCC31 GPMS159 (TAA)20AAGAACATGAGGAACTTTAACCATG/ 281317 5 0.61 10 0.82TTCACCCTTCTCCGACTCC32 GPMS161 (AAT)25CGAAATCCAATAAACGAGTGAAG/ 184259 5 0.8 12 0.89CCTGTGTGAACAAGTTTTCAGG33 GPMS162 (TA)2(TATG)4(TG)5TAACACACGCATGGTGAACC/ 305325 2 0.13 6 0.64TCGGTTATCTTATACGGCCTG34 GPMS163 (AAC)5CCACCGCTATCACTACCACC/ 280291 1 0 4 0.57CCTCCGCAGTAGTGGTATGG35 GPMS164 (ACC)5AATGAAATCAATCGGGCTTG/ 230259 1 0 5 0.47ACCTCGCACCAATTCTTTTG36 GPMS165 (TAA)35imp. . .(TA)26TGAACAATAATAATTGACAGGACAG/ 242317 5 0.61 13 0.87AGCCTCGCAGTTTGTTCTTAC37 GPMS166 (ACC)7AAAACCGACACACCAAAAGC/ 193247 3 0.36 10 0.82CCCTAGTTTCCGTTGCAGAG38 GPMS169 (ATT)5T(TTA)7TCGAACAAATGGGTCATGTG/ 176220 3 0.52 8 0.78GATGAGGGTCCTGTGCTACC39 GPMS171 (TC)6. . .(TC)5. . .(TC)6TCCACCACAATATTTCGAAGG/ 288346 2 0.13 7 0.72TGGCTGTCCAACACTGTGAG40 GPMS176 (TAT)13 CCGCATTCTTGATTGAAACG/ 327345 2 0.13 7 0.70TGGGCAGTATATTGTGCGTG41 GPMS178 (ATT)19 GATTTTTGACATGTCACATTCATG/ 230261 5 0.78 14 0.89Nagyetal.673#2007NRCCanadaTable 4 (concluded).Capsicum annuum (14 genotypes) Capsicum spp. (33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICaNo. of alleles PICcAACGTTGAAAAATAAAGTAAGCAAG42 GPMS181 (ATT)5. . .(ATT)11GAAAGTGGAGAATTTAAAACCTTG/ 166214 2 0.13 8 0.64TTCATTATCTCACCGTTACTGAC43 GPMS183 (TC)9(TA)7GAGCTTCATAGATGATATGCAAGAG/ 195227 1 0 5 0.70TCCCAAGCTAACCCATTTACTG44 GPMS185 T12(GT)7 TCTCCCTGTAATTAGCAGAGCAG/ 238242 2 0.25 5 0.71AAAAATCCCTAAATGAGCAAACC45 GPMS186 (TTA)14 GCGGTAAGGTCTGCGTACAC/ 161180 2 0 5 0.52TTTGAAATAAGTTGGGCATAAATG46 GPMS187 (CA)6C4A36 TTTAGAATCCTCACCACGGG/ 219246 1 0 8 0.71TCAATGCACAAACTTTAATTTGC47 GPMS188 (GGT)5(TGG)2 TGCCGTGGTATTATTGGATG/ 121201 1 0 6 0.70ATACCGACACACCAACCACC48 GPMS189 (AT)7imp(AC)7(AT)5 GCTGCATCAAATCCCTAAGC/ 290321 1 0 9 0.68TGATTCCACCAGGCTTTAGG49 GPMS191 (GA)8 AGGTCAGCGACGGCAAC/ 261286 1 0 5 0.54ATTTTAGGAGCCGACCTTCC50 GPMS193 (CTT)8. . .(CTT)10CGTACAATATCCATCCTTGTGC/ 313335 1 0 5 0.65AAAAAGGAGAAAGATAAGGAAAAGG51 GPMS194 (TA)17(GA)12AGGTGGCAGTTGAGGCTAAG/ 216270 5 0.62 10 0.81GTTCTAGGTCTTTGCCCTGG52 GPMS195 C11(CA)6TGAAAACCAACCACTTGTGG/ 231321 1 0 10 0.77TTGGAACTTACCGGAGTTGG53 GPMS196 (TG)7(TA)6AAAGGATGCAACACGAGGAC/ 159208 2 0.13 8 0.72TTCGCCTCACTGTGTTCTTG54 GPMS197 (GA)3(TAT)16GCAGAGAAAATAAAATTCTCGG/ 272344 6 0.81 10 0.82CAATGGAAATTTCATCGACG55 GPMS198 T17(GT)9AGCTTTAGACAGTGTCTGCGTG/ 252279 2 0.13 8 0.77TGATGATAAATTGCCTTCCG56 GPMS199 (TA)16(GT)10(GA)16TTGAAGTTGTGATTTTGCATG/ 279371 1 0 12 0.74TTTCCGTAACAAATTTTCAAACC57 GPMS200 (TC)6. . .(CT)4. . .(TC)7CTGCGACTTAACGCTCACTG/ 233243 1 0 3 0.44AATTAAACCATCGGGAACCC58 GPMS201 (AC)4AT(AC)3ATCAACCCAGCAACACCAAC/ 247250 1 0 2 0.17CTCCAGCAACAACAACTTCG59 GPMS202 (AT)10. . .(AT)4(TG)9AAAGCTTTCAATAGTTTGGGGAC/ 252305 3 0.56 10 0.87AGGGATAACGTGCAGAGCAC60 GPMS203 (CAC)6CACCAACACATCTTTTTCAACC/ 195210 1 0 5 0.68ATAATAGTGGTTGCGGCGAC61 GPMS205 (AC)11(AT)5 TCTCACTCCAAATTGGGGAG/ 313404 2 0.13 10 0.78TGAACCAATATATTTTATACAAACCMean 2.41 0.27 7.28 0.68674GenomeVol.50,2007#2007NRCCanadaTable 5. Allelic variation and information content of the informative EPMS markers.Capsicum annuum(14 genotypes)Capsicum spp.(33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICaNo. of alleles PICc1 EPMS303 (TA)25AAAACTCCAAACTACCCCTGG/ 291330 8 0.85 9 0.84TTAAGCGTAGCGCTTGTGTG2 EPMS305 (CTT)3(CAT)9CGTCTTTCACTTGTCTTTTGTTC/ 94115 3 0.57 8 0.83AGTGGGTTCACTGACTTGGG3 EPMS309 (CTT)6TCATCTTTCTGCAATTCCCC/ 224250 2 0.07 7 0.70ACCAGGTTTAGCCCATGTTG4 EPMS310 (CAT)13TGGGAAGAGAAATTGTGAAAGC/ 140172 3 0.44 7 0.81AGGAAACATGGTTCAATGCC5 EPMS316 (AAT)8CACCTCTCTAACCGTCACCC/ 155204 2 0.13 4 0.31CAGAGAGCCAGGACAAGACC6 EPMS327 (CGT)7TTTGGAACATTTCTTTGGGG/ 98114 3 0.36 6 0.76ACGTAGCAGTAGGTTTGGCG7 EPMS330 (AT)10TGGGGACCAGATCCAGTTAC/ 257268 2 0.13 5 0.67TTTCCGCCTATCAACAATGG8 EPMS331 (CA)10AACCCAATCCCCTTATCCAC/ 92107 5 0.70 8 0.75GCATTAGCAGAAGCCATTTG9 EPMS335 (ACAT)3(AT)17 ATGCAGAGATTGTCGAAGCC/ 286330 4 0.66 10 0.84GCAGAGAAGACTCACCAGTCC10 EPMS340 (AT)13 AAACCTAGTGACTGGCGAGC/ 261288 2 0.24 8 0.52AACGTTTTGCATAACGGAGG11 EPMS342 (CTT)7 CTGGTAGTTGCAAGAGTAGATCG/ 323343 4 0.50 7 0.78ATGATCTTTGACGACGAGGG12 EPMS343 (CAT)6 TCTGGGAATTTTGGAACTGC/ 129173 2 0.24 7 0.77TCCAGTTTTGATCATCTCCAAC13 EPMS345 (AAG)7 ATGGACGTTGATGAGCCTTC/ 154163 1 0 4 0.50CGGCCTCCTGTTCTAATTTC14 EPMS349 (GAT)6 TGTAACCAAACTCGTGCTGG/ 223235 2 0.07 5 0.62ATCAACCAATCAGCCTCGTC15 EPMS350 (CAT)2(CAA)7AGTGTGGCTACGACAGCATG/ 96106 3 0.3 8 0.75TTGTTTCCCTTACCTGCCAC16 EPMS353 (CTG)6GTATGCTGCAACCATCGTTG/ 299317 2 0.13 7 0.70ATTGGTTTGGGAGACACAGC17 EPMS366 (TA)8TTCGTTTTGTTCAGCTGAGAAG/ 171196 1 0 7 0.73AACGATGAATTTGACGTCCC18 EPMS369 (CAT)2. . .(CAT)6TAATCGAGCGGTAGATTCGG/ 347356 2 0.50 4 0.71TAAGTGGAGGTGCCCTTCTG19 EPMS372 (TA)8TCCACCCAGAAAAAGACTCG/ 321325 2 0.24 3 0.60TGGACGGAACAAGAAATTTTG20 EPMS373 (CAT)6TCTCCAATTTCCATTCGGAG/ 177190 1 0 4 0.60Nagyetal.675#2007NRCCanadaTable 5 (continued).Capsicum annuum(14 genotypes)Capsicum spp.(33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICa No. of alleles PICcTAATCGCATTTGCGAACTTG21 EPMS374 (CAA)6CAG(CAA)3 TTTTCCCCATGAATAAAGATGG/ 206215 1 0 5 0.69TTCAATTTCACCTTCTGGGG22 EPMS376 (CAA)6ACCCACCTTCATCAACAACC/ 235259 5 0.67 9 0.85ATTTGTGGCTTTTCGAAACG23 EPMS377 (AG)11GACAGTCTTTCAAGAACTAGAGAGAG/ 134161 2 0.50 8 0.72TGGAGCAAACACAGCAGAAC24 EPMS378 (CGG)7(AGG)2CGAAGATCACCACCACACTG/ 101110 1 0 4 0.58ACATTTTCACTGCCGGAGAC25 EPMS382 (ACA)9TTTCCCCCATCACATGAAAG/ 154166 1 0 5 0.70CCTAAAGCCATGCAAAAACC26 EPMS386 (CA)15ACGCCAAGAAAATCATCTCC/ 122170 5 0.62 11 0.86CCATTGCTGAAGAAAATGGG27 EPMS387 (AAT)2AGT(AAT)6AGGGTTTCCAACTCTTCTTCC/ 162199 2 0.5 10 0.80CTAACCCCACCAAGCAAAAC28 EPMS390 (ATT)8GCTCCTCATTAGTAGCCCCC/ 113131 2 0.41 6 0.69TCTTCATCACACCTCTGTGGAC29 EPMS391 (AT)9TTTCTTCTCTGGCCCTTTTG/ 177187 2 0.5 5 0.79ACGCCTATTGCGAATTTCAG30 EPMS395 (CCG)6TGTTGGAGCACCATACTCAAAC/ 116131 2 0.24 7 0.46CATCTCCCGACTGAAACTCC31 EPMS396 (CAT)6TCATCGTCTCTTCAACTCTTCTTG/ 223231 3 0.57 4 0.67CCCAATTCGACCTGTTATGG32 EPMS397 (CA)20GCACCCTCCCAATACAAATC/ 102117 3 0.54 8 0.76GATCACGGAGAAAGCAAAGG33 EPMS399 (AAT)8 GTTCTTCTCGCCGACAAGTC/ 144175 4 0.37 8 0.81TTCAAAAATCATGAGCAGCG34 EPMS402 (CCT)3(CTT)6(CCT) GCCTTCTTTTTCATCTTTCCC/ 197216 3 0.47 7 0.74CTGGCAACCCAAGTCTTAGC35 EPMS404 (CTT)12 TCTCTCTCTACATCTCTCCGTTG/ 215245 5 0.47 9 0.80TGTCGTTCGTCGACGTACTC36 EPMS409 (CAT)7 ATACTAAGGCGTTTGGTCGG/ 162180 3 0.26 8 0.72ACAATTGGGGATGCAGAAAG37 EPMS410 (CT)14(CA)16 imp GGAAACTAAACACACTTTCTCTCTC/ 149187 2 0.54 10 0.85ACTGGACGCCAGTTTGATTC38 EPMS411 (TA)9(GATA)3 AAAGGCAACGATGAGAATGG/ 333373 1 0 8 0.66AGGACACAAGCACACATCATATC39 EPMS412 (AT)9CGGACTTTTCAAAAACACACAC/ 205213 2 0.49 5 0.77ACCGACGGCAATGATCTTAC40 EPMS413 (CCA)9GCCTCATAAAGGTGGCC/ 252268 1 0 3 0.56676GenomeVol.50,2007#2007NRCCanadaTable 5 (continued).Capsicum annuum(14 genotypes)Capsicum spp.(33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICa No. of alleles PICcAGTTGGCGGTTTAACTGGTG41 EPMS414 (AT)10 TTGGGGACTTCACGTCTCTC/ 140186 2 0.07 9 0.77TTGATGATAAATCCTCCCCC42 EPMS415 (CCA)CA(CCA)7GTCGAACAAAATGGGGTTTG/ 212215 1 0 2 0.50GCTGGAGAGTGCTGGTGG43 EPMS416 (CTT)10T(CTT)2GCCAAATGGAGGGTCCTTAG/ 131154 3 0.36 8 0.79CAAAGAAAGATGAAGAAGCAACAG44 EPMS417 (TC)9CGCATATACATACATAAATTCTTTC/ 110126 5 0.72 6 0.78TCAACATCTCACCGAAGCTG45 EPMS418 (CA)10ATCTTCTTCTCATTTCTCCCTTC/ 178210 8 0.84 12 0.88TGCTCAGCATTAACGACGTC46 EPMS419 (AAT)6TTCAGGTGCAGGTATCATCG/ 224248 2 0.46 9 0.78GGGTACTTGTCCATTTATCCAG47 EPMS420 (CCG)9GCATAATCGGAAAATGACGTG/ 110116 2 0 4 0.55CAGCCAACTCCGAAAGCTAC48 EPMS421 (CCG)6ATCTATTTTCCTCCGGCGAC/ 236258 3 0.29 6 0.77CGGTAAGCTGCCTTGATCTC49 EPMS424 (CCT)6TCTTTTCTCTCCACCCCATG/ 148160 1 0 5 0.53TTGGGCATCTTTTTCAAAGG50 EPMS426 (AT)15GAGGAAACACTCTCTCTCTCTCTCTC/ 108118 4 0.60 5 0.62TCAAGAGACCCCAAATAGGG51 EPMS427 (AAT)6(AAG) GCTCCTCATTAGTAGCCCCC/ 113131 2 0.41 7 0.75TCTTCATCACACCTCTGTGGAC52 EPMS428 (GAT)6GGCAACCCCAATGTTGTAAC/ 318327 1 0 4 0.53CAACTCCAAACCCCTTAGGC53 EPMS429 (ATC)8 ATACTAAGGCGTTTGGTCGG/ 136180 3 0.26 7 0.66ACAATTGGGGATGCAGAAAG54 EPMS430 (GAA)5ACA(GAA) CCAACACCAAGAAATTGACG/ 255258 1 0 2 0.49CCACTTGTGACCCATTAGGG55 EPMS438 (ATT)4(TTA)2 GCTTTTTGGCAGTTTCGTTC/ 320332 1 0 5 0.46TTCCCCAGTTCACTCCTAGC56 EPMS439 (TC)6. . .(TC)7 ACTAAAGGATCCCCCGGG/ 246250 2 0.41 2 0.35CTCCCACCTGGACTCATCTG57 EPMS440 (CT)7 ACGAGGCGCCCTCTCTC/ 178192 1 0 2 0.49GAGTCCAAACTGAAGCTGCC58 EPMS441 (AG)11 GCACGAGGAAAGAGAGAGACATAG/ 116124 5 0.74 5 0.82TCAACGGATTCAGTCTTCCC59 EPMS443 (TG)13imp(TA)4GGTTTTCTCACAACTTCGGC/ 190196 2 0.34 6 0.58TTGCAAAATATATCAACGCG60 EPMS446 (CAA)AG(CAA)6GAGGCCTTCTGAACCAAACC/ 328338 2 0.50 3 0.56Nagyetal.677#2007NRCCanadaTable 5 (continued).Capsicum annuum(14 genotypes)Capsicum spp.(33 genotypes)No. Code Repeat Forward primer / reverse primer (5?3)Allele sizerange (bp) No. of alleles PICa No. of alleles PICcTTGTAAAGCCTTGGAGGTGG61 EPMS448 (TAA)7 GGGACGTATTTTCGAAGAGG/ 127161 1 0 8 0.76CTTCGCCTTGTTGACTAGGG62 EPMS449 (TTA)7impGCGGAGCTCACAATAAGGAG/ 134147 1 0 3 0.17TGACCCAATGCTCTTCTATGC63 EPMS451 (AT)9CGTAAGACTTTACAGTGAGAGAAATC/ 166184 3 0.36 7 0.80ATTCCAGTGTCGCCGACTAC64 EPMS472 T16ATTGTGATAGCAACCCCTGG/ 289320 3 0.61 6 0.80CACAGATGAGGGCACAAATG65 EPMS480 C12A7AGGAACGGCAGTCTTGCTAG/ 241255 4 0.69 6 0.69GATGCTAGGTCTGGATTCCTG66 EPMS490 T17TTGAGGAAACGTGTGCTGAG/ 216222 2 0.49 3 0.64CGGCATTATTTCATAAGGTGG67 EPMS492 A7CA16CTCTCCAATCCTTCCCTTCC/ 187202 1 0 3 0.46GAAGAAGAAGCTAGGTTTGTTTCG68 EPMS497 G14TACACACACCATCGGGAAAG/ 236248 2 0.50 7 0.78CAGTTTAGCCGAGTTTTCCG69 EPMS501 T20AATCCTCCAAATCCACCCTC/ 166180 4 0.69 10 0.88ATTCGATTGCTTGCTCCTTG70 EPMS507 A30CGGGCAGGTGCTATTATAAAAC/ 196254 3 0.07 3 0.56CGGCCGAGGTACAAGCC71 EPMS514 A18GCCCATTATGACTGCACATG/ 251267 2 0.13 4 0.73CACCAAATATTCCCTGAAAGG72 EPMS538 (CAT)4imp(CAC)2(CAT)3AAGTTGCTAACGGTGCTTGG/ 118119 2 0.13 2 0.50TGAAGTTTCAGGAGCTGCTTC73 EPMS539 (TC)11 AGTGGGTTTCCTATTTGGGC/ 241254 2 0.46 6 0.80CCATGAGCTGTGTTTGATGG74 EPMS540 (TGG)GG(TGG)5 TGCTATTCCAGGTAAAGCCG/ 188206 2 0.13 4 0.69TGTCGTGCGAGTCAGTCAG75 EPMS542 (TC)10 ATCCACTTCCCCATTATCCC/ 168228 4 0.68 10 0.89TGGATGATCGAGTTGACTGG76 EPMS543 (TC)4(CT)13 CTCTGCCCTCCTCAACCC/ 101111 1 0 6 0.72AAAATATGGTCGGAGATCCG77 EPMS546 (ACC)7imp AGATAATCATGGCGGCTCAG/ 219230 2 0.46 5 0.68ATCTGATGATGCCACAGCTG78 EPMS547 (AG)7 TCCTCCACTCAGCTTTCCTC/ 95108 1 0 3 0.55TTTCCTTTTGATGAATCAGGATC79 EPMS549 (ACC)4TC(ACC)4ACCAATGGATTGAATCCACG/ 150160 1 0 4 0.58AGGGCAGTTGTAGCCACTTG80 EPMS554 (TC)6T8CATCATTTCTCCCCAATTCC/ 209199 1 0 6 0.60678GenomeVol.50,2007#2007NRCCanadadancy within this repeat class was calculated to be 1.37.Thisleadstotheconclusionthat frequencyestimateswerenot substantiallybiasedbyredundancyforthisrepeat type.Whilethisestimationmight not bepreciselythesamewithotherrepeats,datafromotherplants(Thieletal.2003) sug-gest no significant differencesfor other repeattypes.Analysis of microsatellite polymorphismsAfter inspection of all positive microsatellite-containingsequences,411 couldbe chosenfor primerdesign and func-tional testing. One hundred and fifty-four markers originatedfromgenomiclibraries(GPMSmarkers)and257originatedfrom database sequences (EPMS markers). In all, 147markers (61fromgenomic libraries and86fromdatabasesequences) showed specific and scoreable PCRproductsanddetectedpolymorphismsbetweenatleast2membersofthe secondarytest panel consistingof 33Capsicumgeno-types. (SeeTable3for theresultsof thefunctional tests.)Inthemajorityofcases, thePCRproduct sizewasingoodconcordance with the predicted size. Five EPMSmarkers(EPMS342, EPMS349, EPMS353, EPMS369, and EPMS413)producedampliconsthat were70to100bplargerthanex-pected, probably because of the presence of introns.EPMS490 produced fragments that were 50 bp shorterthanpredicted. Therepeat types, allelesizeranges, andin-formation contents of the informative GPMS and EPMSmarkers are shownin Table 4 and Table 5, respectively.(Primer data for the non-informative EPMS and GPMSmarkers can be obtained fromthe authors upon request.)Although GPMS markers detected more alleles (7.28 2.68, on average) than EPMS markers (5.86 2.00, onaverage) in the full set of investigated Capsicumgeno-types, themeanPICcvalues(basedonallele-sizevariationsof 33Capsicumgenotypes) of the 2marker classes weresimilar(0.680.13and0.670.12, respectively). These-lectedinformativemarkersshowedalowlevel ofpolymor-phism within C. annuum: with low mean intraspecific(PICa)values(0.27forGPMSmarkersand0.30forEPMSmarkers), 41%of the GPMS markers and 28%of theEPMS markers detected only one allele within the 14C. annuumgenotypes of thetest panel (seeFig. 1Basanexample). On the other hand, some highly informativemarkers exhibited relatively high allelic variations withinC. annuum(Fig. 1A). Correlation coefficient calculationsbetween PICcvalues andcore repeat length resulted inrvaluesof 0.31(P