Post on 09-Apr-2017
PhD student in Chemical and Biological Engineering in Sheffield University
Beta herpesvirusesGenome Direct or inverted repeat sequences( unique regions of the genome Unique long ULUS caused
A) circularization B) recombination within the genome
1) slow ndash growing 2)emlargment of infected cells 3) become latent in secretary glands and kidney
CMV replicates in epithelial cells of respiratory tract salivary gland kidney and persist in lymphocytes
Left Cytomegalovirus History Right Figure of Herpesviruses CMV is reported in 1956 ( was
first isolated from salivary gland and kidney of two dying infants with cytomegalic inclusion bodies
Initially called salivary gland virus ldquo
In 1960 Weller et al purposed the term Cytomegalovirus
In 1965 Klemola and et al described CMV mononucleosis
In 1965 was first isolated in a renal transplant recipient
Cytomegalovirus Infection Congenital infection
Prenatal infection
Infection in children and adults
Transmission via transfusion and transplantation
Infection in the immunocompromised host
Congenital Infection the most prevalent viral cause of congenital
disease ( 05 - 25 )Approximately 40000 per year have clinical
evidence of ( such as small size thrombocytopenia microcephaly interacereberal calcification jaundice hepatosplenomegaly and rash ( cytomehalic inclusion disease)
Hearing loss
Mental retardationDetection of CMV by isolation of viruses from urine
( during the first week of life
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Beta herpesvirusesGenome Direct or inverted repeat sequences( unique regions of the genome Unique long ULUS caused
A) circularization B) recombination within the genome
1) slow ndash growing 2)emlargment of infected cells 3) become latent in secretary glands and kidney
CMV replicates in epithelial cells of respiratory tract salivary gland kidney and persist in lymphocytes
Left Cytomegalovirus History Right Figure of Herpesviruses CMV is reported in 1956 ( was
first isolated from salivary gland and kidney of two dying infants with cytomegalic inclusion bodies
Initially called salivary gland virus ldquo
In 1960 Weller et al purposed the term Cytomegalovirus
In 1965 Klemola and et al described CMV mononucleosis
In 1965 was first isolated in a renal transplant recipient
Cytomegalovirus Infection Congenital infection
Prenatal infection
Infection in children and adults
Transmission via transfusion and transplantation
Infection in the immunocompromised host
Congenital Infection the most prevalent viral cause of congenital
disease ( 05 - 25 )Approximately 40000 per year have clinical
evidence of ( such as small size thrombocytopenia microcephaly interacereberal calcification jaundice hepatosplenomegaly and rash ( cytomehalic inclusion disease)
Hearing loss
Mental retardationDetection of CMV by isolation of viruses from urine
( during the first week of life
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Left Cytomegalovirus History Right Figure of Herpesviruses CMV is reported in 1956 ( was
first isolated from salivary gland and kidney of two dying infants with cytomegalic inclusion bodies
Initially called salivary gland virus ldquo
In 1960 Weller et al purposed the term Cytomegalovirus
In 1965 Klemola and et al described CMV mononucleosis
In 1965 was first isolated in a renal transplant recipient
Cytomegalovirus Infection Congenital infection
Prenatal infection
Infection in children and adults
Transmission via transfusion and transplantation
Infection in the immunocompromised host
Congenital Infection the most prevalent viral cause of congenital
disease ( 05 - 25 )Approximately 40000 per year have clinical
evidence of ( such as small size thrombocytopenia microcephaly interacereberal calcification jaundice hepatosplenomegaly and rash ( cytomehalic inclusion disease)
Hearing loss
Mental retardationDetection of CMV by isolation of viruses from urine
( during the first week of life
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Cytomegalovirus Infection Congenital infection
Prenatal infection
Infection in children and adults
Transmission via transfusion and transplantation
Infection in the immunocompromised host
Congenital Infection the most prevalent viral cause of congenital
disease ( 05 - 25 )Approximately 40000 per year have clinical
evidence of ( such as small size thrombocytopenia microcephaly interacereberal calcification jaundice hepatosplenomegaly and rash ( cytomehalic inclusion disease)
Hearing loss
Mental retardationDetection of CMV by isolation of viruses from urine
( during the first week of life
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Congenital Infection the most prevalent viral cause of congenital
disease ( 05 - 25 )Approximately 40000 per year have clinical
evidence of ( such as small size thrombocytopenia microcephaly interacereberal calcification jaundice hepatosplenomegaly and rash ( cytomehalic inclusion disease)
Hearing loss
Mental retardationDetection of CMV by isolation of viruses from urine
( during the first week of life
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Infection In ImmonocompromisedPneumonia and pneumonitis Retinitis Interstitial pneumoniaColitis and esophagitis Failure of many kidney transplant
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Infection inhellip HCMV infection is associated with
significant disease and may be life-threatening in immunocompromised individuals Patients at greatest risk from HCMV infection include
1) human immunodeficiency virus (HIV)- infected individuals 2) renal transplant 3) patients who receive stem cell harvests and bone marrow transplant (BMT) recipients
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Figure Left Cytopatic Affect of CMV Figure Right Cells from a lung biopsy demonstratingthe classic ldquoowlrsquos eyerdquo inclusion bodies
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Left Inclusions in the lining cells of the renal tubules of transplanted patient Right Retinal pathology caused bycytomegalovirus in a patient with acquired
immunodeficiency syndrome showing retinalnecrosis with hemorrhage
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Left Clinical Manifestations Right atypical lymphocyte CMV disease is usually
defined as CMV infection accompanied by clinical manifestations The most common of these is a viral syndrome with malaise fever leucopenia atypical lymphocytosis and thrombocytopenia mild to Moderate elevations of serum aminotranferases
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
The virus importance in kidney transplantationHCMV infection is a frequent complication of
kidney transplantation especially in the period 1 to 4 months after transplantation Overall incidences of HCMV infection and disease during the first 100 days post-transplantation 60 and 25 respectively when no HCMV prophylaxis or pre-emptive therapy is given HCMV infection is an independent risk-factor for kidney graft rejection and associated with high morbidity and mortality rates
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Diagnosis Methods 1-Histopathology ( Tissue ) Detects inclusion bodies very insensitive
requires biopsy2- Serology ( Serum) Several techniques available for detection of
IgG and IgM ELISA is most common but others include
complement fixation latex agglutination Useful to detect past
exposure (IgG) serology results are difficult to interpret especially in Immonocompromised patients
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Diagnosis Methods3- Conventional culture ( Any) Long development time (21 days) is a
relatively insensitive method Positive test indicates active CMV Sensitivity decreased with a delay of processing exceeding 6 h
4- Shell vial assay (Any) Rapid development time (1 to 2 d) Semi quantifiable Less labor
intensive than Antigenemia assay Positive test indicates active CMV Sensitivity decreased drastically with a delay of processing exceeding 6 h
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Diagnosis Methods5- Antigenemia assay
( Blood) Or PP65 Antigenemia
erythrocyte Lysis leukocyte fixation and Permeablization process Rapid (same day) Semi quantifiable Labor intensive requires
specially trained technician Sensitivity decreased with a delay of
processing exceeding 6 h
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Diagnosis Methods6 - PCR (Any) Fairly rapid (same day) Most sensitive of all tests
Positive test indicates active CMV but not necessarily latent CMV rarely detectable quantification PCR of DNA is not affected by delays in transportation
7- Hybrid capture assay ( Any)Rapid Detects viral DNA less sensitive than PCR
Quantifiable8- Branched DNA ( Any) Less sensitive9- NASBA (nucleic acid sequence-based amplification)
(Any) Detects viral RNA highly sensitive10 - In situ DNA hybridization (Tissue) Requires special techniques may localize CMV DNA
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
SummaryRapid diagnostic such as PP65
Antigenemia PCR NASBA for detection of viral genome or mRNA are more sensitive than traditional methods To detect virus from latency to replication before onset disease
Molecular assays are now considered asrdquo Gold Standardrdquo for assessment of disease and the presses of prescription antiviral drugs have essential role
Result make the use of pre-emptive therapy possible
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Pre-emptive Treatment Refer to Gold Standard Methods was first described in the early 1990 by
Rubin
as a means of reducing the incidence of HCMV disease By antiviral drugs
Antiviral treatment is initiated when HCMV positivist is detected in the blood or BAL fluid using sensitive methods such as PCR NASBA and PP65 Antigenemia
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Treatment
(FDA) Ganciclovir cidofovir and Foscarnet
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Why PCR Method Was Selected1)PCR is most sensitive of others assays2) Many samples and earlier time HCMV
infection were identified by PCR assay3) PCR also stayed positive for the longest
time after transplantation4)In the study of Werner et al(2004USA)
Piiparinen et al(2001Finland) Gregory et al (1994USA)etc has been showmen that PCR was the more sensitive of other assays
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
HerpesvirusesThe name is derived from a Greek word
meaning to creep Cold sores were described in antiquity and viral etiology was established in 1919
A large group of envelop viruses contains of DNA ( ds DNA linear approximately 150 nm in diameter ) is surrounded by an icosadeltahedral Capsid containing 162 capsomers
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Materials and MethodsThe first time PCR
method was performed in 1991 to identify HCMV infection on serum samples at Maryland University by Frickhofen amp Neal S Young
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
تعالي بسمه
بيماران پاراکلينيکي و باليني اطالعات فرم پرونده شماه
بيمار سن مونت جنس مذکر پيوند انجام زمان سال ماه روزپيوند انجام کليه محل نارسائي علتايمنوساپرسيو داروهاي مصرف سابفه خير بلي
دريافتي امنوساپرسيو داروهاي نوععفوني هاي بيماري سابقه ندارد بستري دارد علت
بيمار باليني عالئماي زمينه بيماريهاي سابقه ندارد دارد
1( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVدهنده بلي سرولوژي2( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVدهنده منفي بلي سرولوژي3( عفونتسايتومگالوويروس وجود نظر از پيوند مثبتاست( CMVگيرنده بلي سرولوژي4( عفونتسايتومگالوويروس وجود نظر از پيوند است( CMVگيرنده منفي سرولوژي
بلي
پاراکلينيکي هاي بررسي
1 ندارد دارد راديوگرافي سابقهبرداري 2 تصوير هاي يافته
WBChelliphelliphelliphelliphellipDiff LyhellipNhellipMOhellipEOhelliphellip EtchelliphellipHBhellipHcthelliphellip CThelliphellipBThelliphelliphellipESRhelliphellipCRPhelliphelliphellipFBShelliphellipBUNhelliphellip
CRhellip ALThelliphellipASThelliphellipALPhelliphelliphellipUAhelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipUChelliphelliphelliphelliphelliphelliphelliphelliphelliphellip
BChelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphelliphellipIgM)CMV(helliphelliphelliphellipIgG)CMV(helliphelliphelliphelliphelliphellip helliphelliphelliphelliphellip
توضيحات
توجه شد خواهد تنظيم جداگانه بطور بيمار هر براي برگه اين
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Positive Control Samples Method of preparing control positive 1- Plasmid sample in which CMV virus gB
gene was cloned and was prepared by Tehran Medical Sciences university children institute used as positive control sample
2- Some samples extracted DNA from Gholhak Lab
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Sample gathering
Preparation serum sample The serum sample was taken from 59 kidney transplant
recipients in Baqiyatallah (as) Hospital These patients were in two groups first week post transplantation and second at least fours years after transplantation Serums were kept and freeze in ndash 20 ˚C and then were stored in - 70 ˚C
Preparing plasma samples 68 plasma samples of kidney transplantation recipients from
Gholhak lab were prepared At least 15 months after transplantation
Preparing leukocyte samples From 10 patients 4 weeks after transplantation plasma and
leukocyte were separated and used to identify CMV
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Designation and selecting primersIn this study we designed primers for to set up of experiment
So designing primers was performed according to studying many sources Finally the segment CMV virus GB gene sequence accruing to L Barber et al in 1999 was selected (Note just gene had been brought and these primers havenrsquot been used)
In this study a piece of glycoprotein B of Human Cytomegalovirus (a protected section) was selected and several primers by Gunrunner software were designed Finally among them these primers were selected (next slides)
These primers both have 22 nucleotides reproduce the piece 257 bp of GB gene virus The sequence related to Lab strain AD169 To comparison with this sequence to other strain of this virus no different in sequence between them were observed
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Blast results and Homology Rate Considerations confirmed that above primer pair
which its aimed gene is HCMV virus gB has the ability of identifying and amplification a piece of genome in length of 257 bp Analyzing of primers by computer (BLAST Software) showed that both primers have 100 homology with Human Cytomegalovirus genome and can identify different strains
Also to assess the primers specifications for loop formation Oligo and Gene Runner were used The results of primers analysis and unspecialized disjoining evolution (loop amp primerdimer) are in a desirable status Selected primers to be made were ordered to South Korea Co Bioneer
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Primers Characterizations CMV F np 82494-82515 5prime- CGGTGGAGATACTGCTGAGGTC3primeTm 573 CMolecular Weight 68313 gmoleGC content 591To add 1249 microl DDW was reached to 100 pmol microl concentration
as stock solution to use time was stored in ndash 20 ˚C
CMVR np 82729-82750 5 prime- CAAGGTGCTGCGTGATATGAAC3primeTm 570 CMolecular Weight 68393 gmoleGC content 500 To add 1191 microl DDW was reached to 100 pmol microl concentration as
stock solution to use time was stored in ndash 20 ˚C Nucleotide Position
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
AccessionDescriptionMax score
Total scoreQuery cover
ageE value
Max indent
BK0003942TPA TPA_inf Human herpesvirus 5 strain AD169 complete genome4414411000005100
EF9999211Human herpesvirus 5 strain TB40E clone TB40-BAC4 complete sequence4414411000005100
AY4468942Human herpesvirus 5 strain Merlin complete genome4414411000005100
AC1469991Human Herpesvirus 5 AD169-BAC isolate complete sequence4414411000005100
AC1469071Human Herpesvirus 5 FIX-BAC isolate complete sequence4414411000005100
AC1469061Human Herpesvirus 5 TR-BAC isolate complete sequence4414411000005100
AC1469051Human Herpesvirus 5 Toledo-BAC isolate complete sequence4414411000005100
AC1469041Human Herpesvirus 5 PH-BAC isolate complete sequence4414411000005100
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DNA Extraction1)250 microl of serum or plasma plus 250 microl Lysis Buffer were added and
tube placed in 56 ˚C water bath for four hours (or for overnight in 37 ˚C)
2) The same volume to sample Phenol solution was added and then 60s vertexes Then for 35 minutes centrifuged in 8000 rpm
3) The supernatant was transferred slowly to a 15 Ml tube4) The same volume Chloroform solution was added and 30S vertexed
and for 35 M centrifuged in 8000 rpm5) The supernatant was transferred slowly to a 15 Ml tube
6) one tenth of taken solution from Sodium Acetate was added and then two times of the taken volume Cold Ethanol 96 solution was added and centrifuged in 13000 Rpm for 15 Min
7) All of the solution was evacuated on clean paper8) 100 microl Ethanol 75 solution was added and after 10s Vertexed then
centrifuged for 3 Min in 13000 rpm 9) total solution was evacuated on a clean paper allowed the tube be
dried then 30 microl sterile distillated water added 10) DNA extracted to time use was kept and freeze in - 20 ˚C
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DNA Extraction from Leukocyte by R Cunningham et al Method in 19951) Glycigel preserved whole blood was melted a 37 ˚C
water bath2) 1CC from above solution centrifuged at 14000 rpm for
one Min3) The top 05 ml was discarded 05ml Lysis Buffer added4) This was centrifuged 14000 rpm for 20 S 5) Pellet cellular washed twice with 1 ml Lysis Buffer 6) The pellet was resuspended in 100 microl Extraction Buffer
and 06 microl Proteinase K was added7) This solution was heated in a 60 ˚C water bath for two
hours 8) The Proteinase K denatured by heating to 95 ˚C for 10
Min9) The extract was stored at -20 ˚C until processed
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Purity VerificationTo determine DNA purity OD values in
wavelength 260 to 280 Nm are measured if this ratio 18 ndash 2 DNA have enough purity if is less than this
1) Contamination with protein 2) Contamination with Aromatic material like
Phenol3) And if is more than 2 contamination with
RNA Since 260280 ratio is between 18 to 2 then
our DNA has desirable purity
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Preparing Gel Agarose
For this purpose 015gr agarose powder special for PCR is weighted and mixed with 10CC TBE 1X buffer was heated until being cleared When the mixture temperature approximately reached 45 ˚C 2 microl of Etidium Bromide were added to it and solution was poured in a special container and proper comb was placed in it After getting cold and darkness of gel the comb was ousted
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Electrophorus of PCR ProductsTo this purpose 15 agarose gel sheet
containing Etidium Bromide was prepared Gel was placed in a thank containing 05 X TBE and 10 microl of PCR Product from each tube was mixed with 1 microl Loading Buffer for confirmation results 3 microl standard ladder of 100 bp also were utilized Thank electrophoresis were connected to feeding recourse and for 20-25 Min PCR products were electrophoreses under voltage 80 After this period PCR products were considered by Gel Document device
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Setting up of Experiment by Positive Control Sample To set up of experiment with new primers
there was no published working-model available on these primers Standard program in DrShah Hoseini book with minor modification was utilized Primary PCR according to methods and materials paragraphs 2-11-1 was performed and band 257 bp for plasmid which Cytomegalovirus gB gene was cloned in it comparison with ladder 100 bp observed But DNA extracted samples were taken in Gholhak lab was verified the results was in according to Fig 2-1
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Setting up of Experiment by Positive Control Sample
Volume MaterialVolume MaterialMaterialMaterial 14051405DWDW2525 Buffer( 10x)Buffer( 10x) 075075 MgCL2( 50 mM)MgCL2( 50 mM)
11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 11Primer F( 10pmolmicrol)Primer F( 10pmolmicrol) 0505dNTPs( 10 mM)dNTPs( 10 mM) 0202Taq DNA pol( 5U)Taq DNA pol( 5U) 55DNA TempletDNA Templet 2525Final VolumeFinal Volume
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51˚C 30s
Extention72˚C30s
Final extention
72˚C3min
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Setting up of Experiment by Positive Control Sample As it is observed the proposed
piece has been observed piece amplification (257bp) is a witness to the correct reaction But in PCR result few Extra bands in 400 bp zone and a weak band in 600 bp are observed( figure 2-1) ResultsJoining to nonspecific sequence in low annealing temperature or high concentration of MgCl2 happened
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Table 2-3 MgCl2 Concentration 3412
DWmicrol14314051381355Buffer10X25252525MgCL250mM050751 125Primer F
10pmolmicrol1111Primer R10pmolmicrol1111dNTPs10mM05050505Taq DNA pol
5U02020202DNA Templet
microl5555Totalmicrol2525252525
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
StageTempTime
Hot start94˚C3min
cycleDenaturation
94˚C30s30
Annealing51 52 53 54 55 56 ˚C
30s
Extention72˚C30s
Final extention
72˚C3min
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
MgCl2 ConcentrationFigures 2-2 2-3 To 6 pits show
2mMconcentration of MgCl2 respectively in six temperatures (51C to 56C) 7 to 12 pits show MgCl2 25mM concentration respectively at same temperatures
To 18 pits show 1mM concentration of MgCl2 respectively in six temperatures (51C to 56C)19 to 24 pits show MgCl2 15 mM concentration respectively at these temperatures
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
MgCl2 Concentration
Results indicate that MgCl2 concentration has importance in reaction procedure 1mM 15mM 2mM and 25mM in six cases temperature from
51 ˚C to 56 ˚C to determine the best MgCl2 concentration were used Since desirable MgCl2 concentration can be different temperatures it was necessary to considerate the concentrations of this material in different temperatures to prepare the possibility of comparison
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
MgCl2 concentrationBased on frequent results obtained from the test
15mM concentration was the best for PCR reaction In contrast 55 ˚C temperature also was desirable one which in it primers can easily join their aim and from other side in this stage the sensitive test The power of received bands were maintained With decreasing MgCl2 concentration received band became weaker On contrast adding temperature to 56 ˚C caused decreasing of the band rate Figures 2-2 2-3
Finally 15mM concentration was selected as the best MgCl2 concentration and best volume for PCR reaction selected 075 microl
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Material Extracted DNA Amount Table 2-5
34
12
DWmicrol1805170516051405
Buffer10X25252525
MgCL250mM075075075075
Primer F10pmolmicrol1111
Primer R10pmolmicrol1111
dNTPs10mM05050505
Taq DNA pol5U02020202
DNA Templetmicrol12 35
Totalmicrol25252525
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Extracted DNA Amount
Annealing temperature was 55˚C Result The best DNA amount for reaction in
terms of sharpness and best value of 5 microl of extracted DNA were selected which are pertaining to tube No4 of table 2-5 to materials and methods
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Primers ConcentrationAdjustment of primers with two different
concentrations of primers according to paragraph 2-12-13 of materials and methods was performed and after several repetition of PCR test 10 Pmol of each Forward and Reverse primers considered as desirable amount Of course with increasing primer amount to 20 Pmol a good band received but the extra amount of primers in received pictures was considerable and receive band had no significant difference with created band with 10 Pmolmicrol
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Rate of dNTPs and Polymerase Taq Enzyme
Concentration Rate of dNTPs
Determining dNTPs concentration rate in articles is not so common because minimum dNTPs amount was used( 05 microl) and sharp band also observed so there was no need to optimize dNTPs concentration
Polymerase Taq Enzyme concentration Due to utilization of Taq enzyme( 02 microl) and
seeing sharp band there was no need to optimize Taq
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Amplification Cycles
Based on paragraph 2-12-4 materials an methods section The PCR reaction were performed in 30 and 35 cycles) The best selected cycle number was 30 cycle
And increasing the cycles to 35 regarding the term of placing enzyme in high temperature accuses denaturizing it So amount of received band made in 35 cycle no difference with 30 cycles
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Annealing temperatureAccording to paragraph 2-12-5 materials and
methods annealing temperature were performed in 51 ˚C to 56 ˚C The best
temperature for annealing was determined 55 ˚C
Result In the case that that best temperature for primers not selected joining primers to unspecific genome sequences causes extra bands (Fig 2-1) So the different stages temperature in PCR reaction was altered to get the best temperature
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Results of Optimization1)Hot start 94˚C
3min 1Cycle2) Denaturation 94˚C
Annealing55 ˚C Extention72 ˚C All 30S in 30 Cycle 3) Final extention 72
˚C 3M in 1 Cycle
Final Final concentraticoncentration in 25microlon in 25microl
microlmicrol materialmaterialRowRow
14051405DWDW11
1X1X2525Buffer 10XBuffer 10X22
15mM15mM075075MgCl2)50mM)MgCl2)50mM)33
04pmol04pmol11Primer FPrimer F) 10pmolmicrol)) 10pmolmicrol)
44
04Pmol04Pmol11Primer RPrimer R) 10pmolmicrol)) 10pmolmicrol)
55
02mM02mM0505dNTPs) 10 dNTPs) 10 mM)mM)
66
004U004U0202Taq DNA pol) Taq DNA pol) 5U)5U)
77
55DNA TempletDNA Templet 88
2525Final VolumeFinal Volume 99
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
1)All 127 samples carried out according to optimized method
2) All Results carried out with Roch Co kit
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Comparing and Identifying Cytomegalovirus DNA in Leukocyte amp Plasma
Recognizing cytomegalovirus DNA in leukocyte relative to plasma is more sensitive and identified sooner so this is compatible with our results and we could identify virus DNA at four weeks after transplantation in leukocyte while these patients plasma in four weeks after transplantation still was negative
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
The process of product for sequencing 1) First 40 microl from PCR product was poured in 15CC tube and 3 equals
volume Banding Solution was added2) To over solution 5 microl of Silica gel Suspension solution was added
3( Over solution in placed in water bath 55 ˚C for 5 Min and permanently was moved For 15S in 8000 rpm was spine
4) The supernatant was evacuated and pellet was in the bottom of tube5) 500 microl Washing Buffer was added and pellet resuspended in it and was
spine( 10S in 8000 rpm) this step three times were repeated6) All of solution were evacuated and allowed the tube is dried
7) Then 35 microl distillated water was added and tube is placed in water bath 55 ˚C for 5 Min and permanently was moved
8) Then spin (10S in 8000rpm) and the top clear liquid was removed (DNA in liquid phase)
9) For confirmation of process 5 microl of top clear liquid was removed and electrophoresis
10) The top clear liquid was kept and freezes in ndash 20 C until for sequencing was sent to France
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
gB Gene Sequence and Product According to Gene BankStart = 81494
Stop = 83515 SequenceACGCTGACGCCGGCCACCCGCGACCGCACCGCCGGTCACGCCGCCGCTCAGATACGGGTTGAAAAACATAGCGGACCGTGAGAGGCTGACAGCTTACGAAGCAA
AATCACAAAGAAAATACACATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCAATATTTTTTGTCTAGTTTTTTTTTCCTCCTGGTTCAGACGTTCTCTTCTTCGTCGGAGTCTTTCAAGTGTCTGTAGCCGTTTTTGCGATGTCGCAGCCGGTCTAGCAGGTTAGGCTTCTGTCCCTTGTCCTGCGTGCCAGTCTGTCCGTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGACCAGAATTATAAACACTTTCCTCGTAGGAAGGCGGAGCCTGTAACGACGTGTCTTTGGTGCTGCCCGACGTCACGGTGGTCCCGTCGGCGGACACCAGATAGGGAAAGAGGTTCTGCAGCGGCTGCGTGCACAGACGCCGCTGTCGAGTATAGATCAAATAAGTGATAATGACTACGGCTATGGCCACGAGGATGATGGTGAAGGCTCCGAAGGGGTTTTTGAGGAAGGTGGCAACGCCTTCGACCACGGAGGCCACCGCGCCACCCACGGCCCCAATGGCTACGCCAACGGCCTTTCCCGCGGCGCCCAGGCCGCTCATGAGGTCGTCCAGACCCTTGAGGTAGGGCGGTAGCGGGTCGACTACCTTGTCCTCCACGTACTTTACCCGCTGCTTGTACGAGTTGAATTCGCGCATGATCTCTTCGAGGTCAAAAACGTTGCTGGAACGCAGCTCTTTCTGCGAGTAAAGTTCCAGTACCCTGAAGTCGGTATTTTCCAGCGGGTCGATATCCAGGGCGATCATGCTGTCGACGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACGGGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTGACGCTGGTTTGGTTGATGGTCACGCAGCTGGCCAGGCCCAAGACATCACCCATGAAACGCGCGGCAATCGGTTTGTTGTAAATGGCCGAGAGAATGGCTGACGGGTTGATCTTGCTGAGTTCCTTGAAGACCTCTAGGGTGCGCCGTTGATCCACACACCAGGCTTCTGCGATTTGCGCCAGCGCCCGGTTGATGTAACCGCGCAACGTGTCATAGGTGAACTGCAGCTGGGCGTAGACCAGATTGTGCACCGATTCCATGCTGGACAAATGAGTTGTATTATTGTCACTCGTACTTCTTCTGGTCCTATGAGTGATATTCAGACTGGATCGATTGGCCAAACGTTCCAATTCCACCAAAGATTTTTGCTTGATGCCTTGCCAGAACACCACCAGACCGCCGCTGGTTTCGAAGACGGACACGTTTCCGTATTTTTCATATGTTTGATTGTATGAAGTATTGAAAATCTGCTGTAACTTATTTATAGCCTCATCACGTACGCAGTCCAGCGCGGAGTCGGACATGTTCACTTCTTGTTTCTTAGACAGAAAAGTTGCAGTCATTTTGGCAGAAGAAAAGTGGTACGAGTCTTCGGCTTCGGAACGGATAGTACGTTCCGAGGCTTCCCAGAAGGTGAGCTGGCAGGTGACATTCTTCTCGTCCTGTATATCCCAAGAGATCACCGAGTCGGCACGTTCGAGAAAAGCCACCAACCTATGGGTTTCTGGCGCAGCGTTGGGTCTTCCAAAGTCGGAAACGATGGTG
82494 CGGTGGAGATACTGCTGAGGTCAATCATGCGTTTGAAGAGGTAGTCCACGTACTCGTAGGCCGAGTTCCCGGCGATGAAGATCTTGAGGCTGGGAAGCTGACATTCCTCAGTGCGGTGGTTGCCCAACAGGATTTCGTTGTCCTCGCCCAGTTGACCGTACTGCACGTACGAGCTGTTGGCGAAATTAAAGATGACCACG
GGTCGTGAGTAGCAGCGTCCTGGCGATTCCTTCACGTTCATATCACGCAGCACCTTG 82750
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Sequencing Results
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Sequencing Results
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
CMV Primer Forward
CMV primer forward5- CGG TGG AGA TAC TGC TGA GGT C
3lsquoC
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
CMV Primer Reverse
CMV primer reverse 5 CAA GGT GCT GCG TGA TAT GAA C 3
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Discussion The delays in HCMV infection diagnosis at
first four months after kidney transplantation due to transplanted kidney reject
Antigen detection like PP65 Antigenemia can not use in medical labs a) more expensive than PCR assay B) with six hours delay the sensitive was reduced and caused false positive amp negative C) required experienced technician and florescent microscope D) required to monoclonal antibody
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionSome of the researchers announced the detection of
latent viruses in PBL by PCR assay that of course this subject wasnrsquot accepted in this study
1) During a latent infection of lymphocytes the only region of the genome to be transcripted that were named as Latency- Associated Transcriptrdquo (LATs) but these RNAs are not translated into protein
2) LATS and no other viral genome related to latent infection
3) Gene expression were limited to E genome4) The gene used in our method has belonged to late
genome
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionPre-emptive Treatment Refer to Gold
Standard Methods Scientists announced that hellipIt is generally agreed that it is better to
prevent HCMV disease with pre- emptive approaches than to treat an established disease since a virus infection may induce pathological phenomenon unresponsive to antiviral drugs an extensive tissue damage that may result in transplanted organ failure
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionFrom 33 patients with positive PCR test 20
people (666 ) had clinical symptoms include fever leucopenia thrombocytopenia interstitial pneumonia and junctures inflammation Also 13 ones (334 ) had no clinical symptoms of illness thus our PCR test can identify patients with clinical symptom of HCMV also patients without these Our result is in confirmatory with Vligeramp Van Drop results
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionResearchers performed by Sabine Yearly et al
(2007 Switzerland) and Piiparinen et al( 2001Fanland )showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML Our results also were approved that can identify both infections
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionIn study of Warner and at al (USA) 104
kidney transplant recipients 27patents were recognized with PCR assay while with PP65 Antigenemia 11 Patients were recognized
All patients were in D+R+ serology group Prevalence infection+R+) in the world 21
in our study259 1- time 2- attend of problem patients
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionFrequency incidence of infection
dependent on previous serological condition of donors and recipients ( primary infection in serological group D+R- is 70 ndash 90 in expose of Kidney reject and the most of hospital avoid from transplantation
D - R+ is 20 (virus reactivation ) D+ R+ is 21 D -R- is rare ( the best choice )
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionIn Weinberg et al research (2002) also Woo et al (1997)
was showed cytomegalovirus DNA molecular recognition in leukocyte relative to plasma is more sensitive and can be sooner recognized which this is compatible to our results and we could recognized DNA virus 4 weeks after transplantation in leukocyte while these patients plasma still was negative and our findings are the same as Eckart at al (1997) and Tong et al (2000) results
CMV virus DNA may sooner and for longer time than DNA is appear in plasma Studies on PCR sensitivity prove that averagely they become positive 8 to 13 days before disease appearance (Tong et al 2000)
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
DiscussionIn study of DrMakvandi et al(2004Iran) could recognized DNA virus 4-7 weeks after transplantation in leukocyte With PP65 Antigenemia
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Conclusion
So the most important difficultly in recognizing Cytomegalovirus is delay in recognition which affect patients tracing and one of the most important causes in patients tracing is fast recognition of HCMV infection which is no feasible by serologic tests like ELISA and this situation PCR test can help recognizing virus on time and from third weeks after kidney transplantation this test can be applied
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Recommendations1) PCR test as the best method to recognize CMV
infection In the case of using other test to identify HCMV infection certainly PCR molecular methods as a complementary and reference method should be utilized
2) The best time for applying PCR test in kidney transplantation recipients is third weeks after transplantation and this time HCMV infection should be considered
3) The best sample to identify HCMV infection is PBL especially for the first consideration leukocyte sample is recommended
4) Best time to incept the treatment is when the asymptomatic infections can be identified by PCR molecular method
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Difficulties Available in This Survey 1) The single weakness of this method is
unidentifying the rate of virus load in sample2) Lack of Tracing in different time after
kidney transplantation
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Thanks for Your Pay attention
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
For My Opinion This Subject is still ChallengeIn Herman Einsele and et al research (1991) the
least DNA value that was identifiable (serial dilution) by PCR molecular method was 10 FL This rate sensitivity for virus dose not seems reasonable while in this research also real time method has not been utilized
Currently Research Researches performed by
Sabine Yearly et al (2007 Switzerland) and Piiparinen et al( 2001Fanland ) with Real Time showed that CMV symptomatic infections average peak load was 55100 copiesMl in whole blood while for asymptomatic infections this rate was averagely 1820 CopiesML
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong
Human Herpesviruses FeaturesPhylogeny Three subfamilies1048577 HSV-1 HSV-2 VZV (Neurotropic)1048577 HCMV HHV-6 HHV-7 (Lymphotropic)1048577 EBV HHV-8KSHV (Lymphotr tumor-
assocd)Biology Large ds DNA genome (125-236 kb
~70-200 genesabout half of which are non-essential in cell
culture)Common featuresUbiquitous except HSV-2 HHV-8KSHVLatency infection is lifelong