Competencias Program Ac i on Inter Colegiales

Post on 04-Jun-2018

224 views 0 download

Transcript of Competencias Program Ac i on Inter Colegiales

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 1/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 2/499

AGRADECIMIENTOS

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 3/499

INTRODUCCIÓN

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 4/499

TABLA DE CONTENIDOUniversidad de Puerto Rico en Bayamón

Input .................................................................................................................................................................................Output !"#$$n%..............................................................................................................................................................S&'p($'$nt$ )* * '+!t#*# $n p*nt*((* (+! #$!u(t*,+! $n"+nt#*,+! - )* * n+t& &"*# (* "*nt&,*, ,$ n/'$#+! $n"+nt#C+##&,* ,$ $0$'p(+ ........................................................................................................................................................Input !"#$$n%.................................................................................................................................................................Output !"#$$n &($ )*'p&#+.+ut%..............................................................................................................................C+##&,* ,$ $0$'p(+ ........................................................................................................................................................P*#* !&'p(& &"*# un p+"+ $( p#+5($'*6 !$ )* * &n,&"*# (* p+!&"&7n &n&"&*( $n ,+n,$ !$ )* * "+'$n8*# $(n/'$#+ &n&"&*( '*-+#% - $( t*'*9+ ,$( t*5($#+ )* * !$# &0+ : ; :%.......................................................................Input &($ !*5u$!+.&n%................................................................................................................................................Output &($ !*5u$!+.+ut%.............................................................................................................................................SOLON F&($ S-!t$' = A(( F&($ S&8$.........................................................................................................................

D$ &n&"&7n ,$( p#+5($'*.........................................................................................................................................FC.............................................................................................................................................................................................In>(&n?....................................................................................................................................................................................

E( p#+@#*'*................................................................................................................................................................IMPORTANTE ...............................................................................................................................................................2

Input ................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ 5+'5*!.&n%....................................................................................................................................S*'p($ Output F&($ 5+'5*!.+ut%..................................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ ?(&n@+n.&n%..............................................................................................................................S*'p($ Output ?(&n@+n.+ut%......................................................................................................................................SOLON F&($ S-!t$' D$ #*@'$nt*t+# 1.<.....................................................................................................................

D$ &n&"&7n ,$( p#+5($'*.........................................................................................................................................FC.............................................................................................................................................................................................In>(&n?....................................................................................................................................................................................

E( p#+@#*'*................................................................................................................................................................IMPORTANTE ...............................................................................................................................................................2

S*'p($ Input Output +# S*'p($ Input.....................................................................................................Input ................................................................................................................................................................................Output .............................................................................................................................................................................S*'p($ Input ....................................................................................................................................................................S*'p($ Output .................................................................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ '&n$! $$p$#.&n%..........................................................................................................................S*'p($ Output F&($ '&n$! $$p$#.+ut%.......................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input S"#$$n%....................................................................................................................................................S*'p($ Output S"#$$n%.................................................................................................................................................

Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Output...................................................................................................................................................................F&($ LC,&!p(*-.+ut%..................................................................................................................................................S*'p($ Input .....................................................................................................................................................................F&($ LC,&!p(*-.&n%...................................................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ p#&'*#-.&n%..................................................................................................................................S*'p($ Output F&($ p#&'*#-.+ut%..............................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 5/499

S*'p($ Input F&($ #$)$#!$.&n%..................................................................................................................................S*'p($ Output F&($ #$)$#!$.+ut%...............................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ *(,+# .&n%....................................................................................................................................S*'p($ Output F&($ *(,+# .+ut%.................................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ +u#p#&'$!.&n%............................................................................................................................S*'p($ Output F&($ +u#p#&'$!.+ut%.........................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ *nt.&n%..........................................................................................................................................S*'p($ Output F&($ *nt.+ut%.......................................................................................................................................S*'p($ Input F&($ 't.&n%............................................................................................................................................S*'p($ Output F&($ 't.+ut%.........................................................................................................................................

..................................................................................................................................................................................................Input..................................................................................................................................................................................Output...............................................................................................................................................................................S*'p($ &nput F&($ "*("u(*t+#.&n%...........................................................................................................................S*'p($ +utput F&($ "*("u(*t+#.+ut%...........................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ " $"?.&n%.......................................................................................................................................S*'p($ Output F&($ " $"?.+ut%....................................................................................................................................Input .................................................................................................................................................................................Output ..............................................................................................................................................................................S*'p($ Input F&($ ! (.&n%...........................................................................................................................................S*'p($ Output S"#$$n%................................................................................................................................................

I'p+#t*,+# ,$ ,*t+! ,$!,$ COBOL *(............................................................................................................................S+(+n D*t*5*!$ M*n*@$'$nt S-!t$' SDBMS%.......................................................................................................

S*'p($ Input F&($ SDBMS>IN.T;T%..........................................................................................................................S*'p($ Output F&($ SDBMS>OUT.T;T%..................................................................................................................

u&nt*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<4..............................................................................................................E p$#t+.................................................................................................................................................................................

ENCAHAR......................................................................................................................................................................M+#!$ M&!'*t" $!.......................................................................................................................................................L>FAT DEFRAG. E;E................................................................................................................................................D&)$#!&7n C+n G#* +!.............................................................................................................................................

u&nt*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<4..............................................................................................................Int$#'$,&+............................................................................................................................................................................

PARENT..........................................................................................................................................................................Sp#$*,! $$t C*("u(*t+#...............................................................................................................................................ESCALERA ARITM TICA........................................................................................................................................ NUMBER PROPERTIES...........................................................................................................................................

Cu*#t*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<3..............................................................................................................E p$#t+ ............................................................................................................................................................................

A R$*( Pu88($#...........................................................................................................................................................

G+.....................................................................................................................................................................................3D T&">T*">T+$.......................................................................................................................................................T#$*!u#$ I!(*n,...........................................................................................................................................................

Cu*#t*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<3..............................................................................................................Int$#'$,&+ .......................................................................................................................................................................

ESTRELLAS................................................................................................................................................................Sup$# F#$ ...................................................................................................................................................................P+!t2In..........................................................................................................................................................................B+t" *@*(++p.............................................................................................................................................................

Cu*#t*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<3..............................................................................................................P#&n"&p&*nt$...............................................................................................................................................................

CONHETURA DE ULLMAN...................................................................................................................................

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 6/499

JISTOGRAMA DE PALABRAS...............................................................................................................................C*5#*""&.....................................................................................................................................................................B*(*n"$, P*#$nt $!$!..................................................................................................................................................

T$#"$#*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<2...........................................................................................................P#&n"&p&*nt$ ..............................................................................................................................................................

C+''+n L$tt$#!.............................................................................................................................................................1St#&n@ C+'p#$!!&+n................................................................................................................................................DECIMAL COMPLEMENTS....................................................................................................................................BANNER NUMERICO..............................................................................................................................................

T$#"$#*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<2...........................................................................................................Int$#'$,&+..........................................................................................................................................................................1

KELL ORDERED NUMBERS..................................................................................................................................JORI ONTAL JISTOGRAM.....................................................................................................................................1SJUTTLE PU LE......................................................................................................................................................1 NUMBER FANTASIES..............................................................................................................................................

T$#"$#*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<2...........................................................................................................E p$#t+...............................................................................................................................................................................1

: : CJEC ER CJALLENGER.................................................................................................................................. 11 NÚMERO OCULTO...................................................................................................................................................MULTIPLICACIÓN POR EL M TODO DE LA REHILLA...................................................................................JTML CODE OPTIMI ER..........................................................................................................................................

P#&'$#*! C+'p$t$n"&*! ,$ P#+@#*'*"&7n 2<<<...........................................................................................................E p$#t+ ............................................................................................................................................................................

PIR MIDES NUM RICAS.........................................................................................................................................LA AMENA A.............................................................................................................................................................

DNS C*" $ ........................................................................................................................................................................A,,#$!! R$!+(ut&+n S&'u(*t&+n...............................................................................................................................P#+5($'* 3 E( $($ *nt$ Fu#&+!+..............................................................................................................................D*t*5*!$ L+@@&n@ T*5($!...................................................................................................................................Su5!$t!..........................................................................................................................................................................K+#, Pu88($ ............................................................................................................................................................. 1

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................E p$#t+...............................................................................................................................................................................1

T$##*n )!. $#@!.................................................................................................................................................................T$##*n M$!!*@$ D$"-p $#........................................................................................................................................SUPERPRIME RIB.....................................................................................................................................................

NUMBER TRIANGLES............................................................................................................................................ERO SUM...................................................................................................................................................................FRIDAY TJE 13TJ......................................................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................Int$#'$,&+..........................................................................................................................................................................1

PROGRAM LISTING.................................................................................................................................................T$($p +n$ D&#$"t+#- S$*#" ....................................................................................................................................Sup$# R+'*n Nu'$#*(! Q +(!t*,6 1 .......................................................................................................................14FACTORIALS.............................................................................................................................................................PRIME PALINDROMES............................................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................P#&n"&p&*nt$...............................................................................................................................................................

V*(&,*"&7n ,$ T*#0$t*! ,$ C# ,&t+.........................................................................................................................

C LCULO DE FECJAS..............................................................................................................................................CONVERSION DE NUMEROS JE;ADECIMALES..............................................................................................Y2 S+ t *#$ S+(ut&+n.......................................................................................................................................................

D*t$ K&n,+ &n@.......................................................................................................................................................PROGRAM LISTING.................................................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................E p$#t+...............................................................................................................................................................................1

C+,$ G$n$#*t&+n.......................................................................................................................................................CONVERSION..............................................................................................................................................................1P*!"*( t+ A!!$'5($# C+n)$#t$#...................................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................E p$#t+ ............................................................................................................................................................................

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 7/499

BINARY CALCULATOR..........................................................................................................................................D&#$"t+#- L&!t&n@ C+''*n, S&'u(*t+#..................................................................................................................P#+5($' 3 GOLDBACJ CONHECTURE.................................................................................................................LONG6 LONG DIVISION.........................................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................Int$#'$,&+..........................................................................................................................................................................1

DEALING A DEC OF CARDS................................................................................................................................FRACTIONS TO DECIMALS..................................................................................................................................EIGJT UEEN KITJ A TKIST................................................................................................................................ 1PU LE ........................................................................................................................................................................1

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 .................................................................................................................................P#&n"&p&*nt$!..................................................................................................................................................................

E;PONENTIATION.....................................................................................................................................................1DEALING A DEC OF CARDS................................................................................................................................SUBTRACTING BIG NUMBERS............................................................................................................................FACE OF TJE CLOC ................................................................................................................................................1PROBLEMAS PARA ELIMINATORIAS................................................................................................................

C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 :................................................................................................................................E p$#t+...............................................................................................................................................................................1 .........................................................................................................................................................................................CUTB P#+@#*''&n@ C+nt$!t.......................................................................................................................................

CABRA COMPILER..................................................................................................................................................C+'p$t$n"&*! ,$ P#+@#*'*"&7n 1 :................................................................................................................................

P#&n"&p&*nt$! ............................................................................................................................................................MORSE CODE............................................................................................................................................................MASTERMIND.............................................................................................................................................................1TE;T COUNT...............................................................................................................................................................MEASUREMENT AND UNIT CONVERSION......................................................................................................

ICOM C *(($n@$ 2<<<.....................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

V*#&*5($ R*,& Ju '*n En"+,&n@..........................................................................................................................M$t*>L++p($!! S+#t!.................................................................................................................................................u*,t#$$!.......................................................................................................................................................................

ICOM C *(($n@$ 2<<<.....................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................

P*"?$t!..........................................................................................................................................................................

T$($p +n$ T*n@($!....................................................................................................................................................V*#&*5($ R*,& Ju '*n En"+,&n@..........................................................................................................................ICOM C *(($n@$ 2<<<.....................................................................................................................................................

B$@&nn$# D&)&!&+n.................................................................................................................................................M*!t$#>M&n, J&nt!...................................................................................................................................................R$"+@n&8&n@ G++, ISBN!...................................................................................................................................P*"?$t!..........................................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

A $!+'$ D$"&'*(!....................................................................................................................................................... 2T+ C*" $ +# n+t t+ C*" $ . . .......................................................................................................................................O5!t*"($!........................................................................................................................................................................2A S&'p($ Int$#p#$t$#.................................................................................................................................................

St#+n@(- C+nn$"t$, C+'p+n$nt!...............................................................................................................................ICOM C *(($n@$ ........................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................

D*t*5*!$ L+@@&n@ T*5($!...................................................................................................................................Su5!$t!..........................................................................................................................................................................

K+#, Pu88($ .....................................................................................................................................................................Pu88($ D$!"#&pt&+n.................................................................................................................................................T$($p +n$ D&#$"t+#- S$*#" ....................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................B$@&nn$# D&)&!&+n.................................................................................................................................................

P*#&t- C $"?&n@.......................................................................................................................................................;M+#!$..........................................................................................................................................................................

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 8/499

Y2 P#+5($'.................................................................................................................................................................2T $ B*#t C *(($n@$....................................................................................................................................................K+#, Pu88($.................................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

C+,$ G$n$#*t+#..........................................................................................................................................................n&@ t T+u#................................................................................................................................................................DNA T#*n!(*t&+n......................................................................................................................................................T $ Et#u!"*n C*("u(*t+#.............................................................................................................................................

S+u#"$ F&($ )&!&+n.Q"p ..............................................................................................................................................C-5$#)&!&+n...................................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................

E@-pt&*n Mu(t&p(&"*t&+n....................................................................................................................................u$$n T+u#...................................................................................................................................................................On t $ S&,$ *(?............................................................................................................................................................

S*'p($ Input.........................................................................................................................................................................S*'p($ Output.......................................................................................................................................................................

H+ n C+n *- ! G*'$ + L& $........................................................................................................................................G$n$#*t&+n <....................................................................................................................................................................

G*(*"t&" I'p+#t...........................................................................................................................................................ICOM C *(($n@$ ............................................................................................................................................................

B$@&nn$# D&)&!&+n.................................................................................................................................................C+'5&n*t&+n!.............................................................................................................................................................M*-* C*($n,*#............................................................................................................................................................

N+t&"$ t *t $*" ,*- *! *n *'5& ,$!"#&pt&+n. F+# $ *'p($6 *t t $ 5$@&nn&n@ ...................................................J**5 O. p+p <.............................................................................................................................................................

P*(&n,#+'$ D$t$"t&+n U!&n@ R$"u#!&+n............................................................................................................ICOM C *(($n@$ ............................................................................................................................................................

B$@&nn$# D&)&!&+n.................................................................................................................................................C+'p#$!!&+n................................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

P#+5($' JTML T*5($!.................................................................................................................................................P#+5($' N*)&@*t&+n + * S&'p($ M*8$................................................................................................................TJE AMA ING MA E PROGRAM...........................................................................................................................2

ICOM C *(($n@$ ............................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................P#+5($' K+#, M+#p &n@..........................................................................................................................................P#+5($' C#-pt*#&t '$t&"............................................................................................................................................P#+5($' N*)&@*t&+n + * S&'p($ M*8$................................................................................................................TJE AMA ING MA E PROGRAM...........................................................................................................................3P#+5($' D*t$t&'$........................................................................................................................................................P#+5($' M*@&" Nu'5$#...........................................................................................................................................P#+5($' A T*(? P*"?$t Sn& $#...............................................................................................................................P#+5($' D&"t&+n*#-.................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

P#+5($'1. D*t$t&'$......................................................................................................................................................

Input.......................................................................................................................................................................................3 P#+5($' 2. C #&!t'*! T#$$........................................................................................................................................P*!"*( t+ C M&n&>K &($> C+n)$#t$#....................................................................................................................

Input F&($ N*'$ AD3.P*!............................................................................................................................................R$!t*u#*nt D*t*5*!$..................................................................................................................................................

ICOM C *(($n@$ ............................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................

P#+5($' 1. G#$*t$!t C+''+n D&)&!+#......................................................................................................................S+u#"$ F&($ n*'$ ID1. ...................................................................................................................................................

P#+5($' 2. M$*!u#$'$nt *n, Un&t C+n)$#!&+n......................................................................................................S+u#"$ F&($ N*'$ ID2. ..................................................................................................................................................

P#+5($' 3. St*"? M*n&pu(*t&+n.............................................................................................................................

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 9/499

S+u#"$ &($ n*'$ ID3. .....................................................................................................................................................P#+5($' 4. B&n*#- t+ ,$"&'*(6 +"t*( *n, $ "+n)$#!&+n .....................................................................................P#+5($' 1 P#$)&+u! D*t$..........................................................................................................................................P#+5($' 2. D&!t*n"$6 M&,p+&nt *n, S(+p$............................................................................................................P#+5($' 3. C *n@$..................................................................................................................................................... P#+5($' 4. T$ t E,&t&n@......................................................................................................................................

ICOM C *(($n@$ 4...........................................................................................................................................................E p$#t D&)&!&+n...........................................................................................................................................................

P#+5($' I. M$'+#- M*n*@$'$nt..................................................................................................................................Tu#t($ T$ t G#*p &"!..................................................................................................................................................P#+5($' 4. Ju '*n C+,&n@.........................................................................................................................................

S+u#"$ F&($ N*'$ A D 4. ; ; ;..........................................................................................................................................3P#+5($' . L*#@$ Nu'5$#!..........................................................................................................................................

ICOM C *(($n@$ 4...........................................................................................................................................................Int$#'$,&*t$ D&)&!&+n................................................................................................................................................

P#+5($'1. STAC MANIPULATION........................................................................................................................P#+5($' 2. EASY CALENDAR .................................................................................................................................EIGJT UEENS KITJ A TKIST.............................................................................................................................. 34

COMPETENCIAS DE PROGRAMACIÓN 1 1.............................................................................................................S+u#"$ F&($ N*'$ PRIN1. ............................................................................................................................................

PROBLEMA 1...............................................................................................................................................................ARCJIVO DE CODIGO PRIN1. .........................................................................................................................3ARCJIVO DE CODIGO PRIN2. .........................................................................................................................3

NW X 1 2 3 N.......................................................................................................................................................3S+u#"$ F&($ N*'$ PRIN3. .............................................................................................................................................

Fun"&7n ,$ A"?$#'*n..................................................................................................................................................................................................................................................................................................................................................34............................................................................................................................................................................................34............................................................................................................................................................................................34

ARCJIVO DE CODIGO PRIN4. ..........................................................................................................................3ARCJIVO DE CODIGO PRIN . 6 ....................................................................................................................... 3

COMPETENCIAS DE PROGRAMACIÓN 1 1.............................................................................................................E p$#t+...............................................................................................................................................................................3

LONG6 LONG DIVISION.........................................................................................................................................P#+5($' 1.....................................................................................................................................................................

ENTER FIRST NUMBERZ .........................................................................................................................................

D&)&,$n, &! .................................................................................................................................................................TJE DATABASE PROBLEM............................................................................................................................................P#+5($' 3 GOLDBACJ CONHECTURE.................................................................................................................CALCULATOR.............................................................................................................................................................3P#+5($' 1 = P*t F&n,$#..............................................................................................................................................

Input F&($ N*'$ ED1.DAT................................................................................................................................................Output F&($ N*'$ ED1.Out ..............................................................................................................................................

P#+5($' 2 = T $ Yu"* C+'p(&$#................................................................................................................................. Input F&($ N*'$ ED2.DAT........................................................................................................................................... Output F&($ N*'$ ED2.Out.........................................................................................................................................

P#+5($' 3 = M+)&$ L&!t&n@! D*t*5*!$................................................................................................................P#+5($' 4 = D&#$"t+#- S$*#" ...................................................................................................................................P#+5($' > Pu88($........................................................................................................................................................

P#+5($' :> T $ [P-#*'&,\ S+#t.....................................................................................................................................COMPETENCIAS DE PROGRAMACIÓN 2<<4...........................................................................................................E p$#t+!............................................................................................................................................................................

D$"&'*(>B&n*#-............................................................................................................................................................T&'$ C*#,.....................................................................................................................................................................Mu(t&p(&"*"&7n Ru!*..............................................................................................................................................V$#t&"*( J&!t+@#*'..................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<4...........................................................................................................P#&n"&p&*nt$! ............................................................................................................................................................Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+...........................................................................................................

C*! R$@&!t$# App(&"*t&+n% .............................................................................................................................P#$!$nt V*(u$ C*("u(*t+# App(&"*t&+n% ..........................................................................................................

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 10/499

A##*-%............................................................................................................................................................................C#$*t$ *n, M*&nt*&n T$($p +n$ D&#$"t+#&$!%...............................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<3...........................................................................................................E p$#t+! ...........................................................................................................................................................................Int$#B*-..............................................................................................................................................................................4

K$&@ t$, B&n*#- T#$$!...........................................................................................................................................T#&*n@($.......................................................................................................................................................................An+t $# B*(*n"&n@ A"t............................................................................................................................................ACSL8&p....................................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<3...........................................................................................................P#&n"&p&*nt$!..................................................................................................................................................................

COUNTCJARS...........................................................................................................................................................D$"+,&n@ *n En"+,$, T$ t &($.................................................................................................................................V&#u! D$t$"t&+n....................................................................................................................................................... Nu'5$# P#+p$#t&$!.....................................................................................................................................................T&'$ C*#,.....................................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<2...........................................................................................................E p$#t+!............................................................................................................................................................................

Mu(t&p(&"*"&7n Ru!*..............................................................................................................................................V$#t&"*( J&!t+@#*'..................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<2...........................................................................................................Int$#'$,&+! ......................................................................................................................................................................

T $ In 5$t $$n Su'...................................................................................................................................................... 4P#&nt * St#&n@ B*"? *#,% ....................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<2...........................................................................................................P#&n"&p&*nt$! ............................................................................................................................................................

R+t*t&n@ K+#,!.........................................................................................................................................................COMPETENCIAS DE PROGRAMACIÓN 2<<1...........................................................................................................

E p$#t+! ...........................................................................................................................................................................PROBLEMA 1............................................................................................................................................................PROBLEMA 3............................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<1...........................................................................................................Int$#'$,&+! ......................................................................................................................................................................

P#+@#*'* P(*n&((* +#'* "+#t*. ..............................................................................................................................PROBLEMA 2............................................................................................................................................................PROBLEMA 3............................................................................................................................................................

P#+@#*'* P#+'$,&+!. ...............................................................................................................................................COMPETENCIAS DE PROGRAMACIÓN 2<<1...........................................................................................................P#&n"&p&*nt$! ............................................................................................................................................................

P#+@#*'* ,$ n/'$#+!....................................................................................................................................................P#+@#*'* p*#* !+#t$*# p+# $,*,..............................................................................................................................P#+@#*'* p*#* "*("u(*# "u$nt*! * "+5#*#..............................................................................................................P#+@#*'* p*#* #$"&5+ ,$ )$nt*...............................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<1...........................................................................................................P#$'&*"&+n$! ...............................................................................................................................................................

CATEGORY ADVANCED......................................................................................................................................CATEGORY INTERMEDIATE...............................................................................................................................CATEGORY BEGINNERS.......................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<<..........................................................................................................

E p$#t+! ...........................................................................................................................................................................COMPETENCIAS DE PROGRAMACIÓN 2<<<..........................................................................................................Int$#'$,&+! ......................................................................................................................................................................

PROBLEMA 1............................................................................................................................................................PROBLEMA 2............................................................................................................................................................PROBLEMA 3............................................................................................................................................................

COMPETENCIAS DE PROGRAMACIÓN 2<<<..........................................................................................................P#&n"&p&*nt$! ............................................................................................................................................................Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+...........................................................................................................

PROBLEMA 1............................................................................................................................................................PROBLEMA 2............................................................................................................................................................PROBLEMA 3............................................................................................................................................................

1<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 11/499

PROBLEMA 4............................................................................................................................................................COBOL DESCRIPTION GENERATOR..................................................................................................................

DESCRIPCION DEL REPORTE......................................................................................................................................COBOL DESCRIPTION OPTIMI ER.......................................................................................................................

DESCRIPCION OPTIMI ADA.........................................................................................................................................TCAL . <1 C+'p&($#TCAL N$!t$, L++p t+ < : A!!$'5(- L*n@u*@$.................................................................

S*(&,* TCAL.OUT%........................................................................................................................................................PROBLEM 1. CAPS.................................................................................................................................................PROBLEM 2. CJARACTER TO ASCCII TO CJARACTER AGAIN...............................................................PROBLEM 3. PJONE CODE..................................................................................................................................PROBLEM 4. DAY OF TJE KEE ........................................................................................................................4PROBLEM . TE;T INVERTER.............................................................................................................................4PROBLEMA 1............................................................................................................................................................PROBLEMA 2............................................................................................................................................................PROBLEMA 3...........................................................................................................................................................PROBLEMA 4............................................................................................................................................................FOGUEO DE PROGRAMACIÓN............................................................................................................................DIRECTORY LISTING COMMAND SIMULATOR..............................................................................................FOGUEO DE PROGRAMACIÓN............................................................................................................................TECO EDITOR .........................................................................................................................................................P#+5($' 1 ] J+t$( R$!$#)*t&+n...................................................................................................................................P#+5($' 2 P(+t Fun"t&+n!..........................................................................................................................................P#+5($' 3 ] F*"t+#&*(!...............................................................................................................................................P#+5($' 4 E u*( t+ $#+..............................................................................................................................................P#+5($' 1 D&!t*n"$6 M&,p+&nt *n, S(+p$............................................................................................................P#+5($' 2 D#* S *p$!................................................................................................................................................4P#+5($' 3 F&($ M*n*@$'$nt....................................................................................................................................P#+5($' 4 A#,$! L*5$(!..............................................................................................................................................PROGRAMA DECODIFICACIÓN DOBLE...........................................................................................................J&@ S" ++( C *(($n@$ 1 .......................................................................................................................................

E(&'&n*t+#&* CUTB 4...................................................................................................................................................P#+5($'* 1 R$!t* ,$ N/'$#+! G#*n,$!..................................................................................................................... 4

E(&'&n*t+#&* CUTB 4...................................................................................................................................................P#+5($'* 2 C*'&n+ ,$( C*5*((+...............................................................................................................................

E(&'&n*t+#&* CUTB 4................................................................................................................................................... p#+@#*'* p#+@3. ..........................................................................................................................................................

P#+5($'* 3 E( $($ *nt$ Fu#&+!+..............................................................................................................................E!"#&5* un p#+@#*'* u$ p&,* ,$( u!u*#&+ un n+'5#$ ,$ un $'p($*,+6 - un t+t*( ,$ +#*! t#*5*0*,*! - ,*,* $!t*&n +#'*"&7n *@* (+! "*("u(+! "+##$!p+n,&$nt$! $ &'p#&'* (* !&@u&$nt$ &n +#'*"&7n ............................... N+t* P*@* p+# +#*6 *!t* 4< +#*! ^:.<<..............................................................................................................E!"#&5* un p#+@#*'* u$ !u'$ ,+! n/'$#+! 5&n*#&+!6 "+n un '_ &'+ ,$ +" + % ,`@&t+! p+# n/'$#+!. R$"u$#$n 5&n*#&+! 1 1X< - !$ [(($)* 1\a 1 <X1a - 1 1 1X1 - !$ [(($)* 1\............................................................................ N+t* (* p$(+t&t* n+ pu$,$ !*(&# ,$( '*#@$n ,$ (* p*nt*((*6 - (* '&!'* ,$5$ (($@*# (+ '_! "$#"*n+ *( 5+#,$ p+

11

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 12/499

UNIVERSIDAD DE PUERTO RICO

EN BAYAMÓN

12

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 13/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría P#&n"&p&*nt$! Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 1

!A PA!ABRA CRU"A#A

D$!*##+(($ un p#+@#*'* u$ p&,* p+# p*nt*((* un* p*(*5#* ,$ t#$! 3% *13 "*#*"t$#$!. C+n $!* p*(*5#* ! $ )* * +#'*# un* ; $n ,+n,$ $("*#*"t$# ,$( '$,&+ !$ #$p&t$ un* !+(* )$8. E( p#+@#*'* ,$5$ )*(&,*#u$ (* "*nt&,*, ,$ "*#*"t$#$! $nt#*,+! !$* &'p*# - u$ n+ !$* '$n+# ,$3 "*#*"t$#$! n& '*-+# ,$ 13. S& )* * $!"#&5&# $( p#+@#*'* $n un($n@u*0$ ,$ +#&$nt*"&7n @#_ &"* "+'+ V&!u*( B*!&"6 *!$@/#$!$ ,$ p+n$#$( t&p+ ,$ ($t#* $n (* !*(&,* "+'+Courier New .

$%emplo &

Entre una palabra impar de 3 a 13 caracteres: elPalabra menor de 3 caracteres, trate de nuevo

Entre una palabra impar de 3 a 13 caracteres: amorPalabra par, trate de nuevo

Entre una palabra impar de 3 a 12 caracteres: parangutirimicuaroPalabra mayor de 13 caracteres, trate de nuevo

Entre una palabra impar de 3 a 13 caracteres: linux

l l i i n u ux x

$%emplo '(

Entre una palabra de 3 a 12 caracteres: Microsoft

M M

i i c c r r o s s o o f ft t

13

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 14/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría P#&n"&p&*nt$! Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 2

N)meros Pseudopar*sitos

L+! n/'$#+! p*#_!&t+! !$@/n $( D#. G++@+(% !+n * u$((+! n/'$#+! u$ *('u(t&p(&"*#!$ p+# un n/'$#+ ,$ un ,`@&t+6 "*'5&* $( ,`@&t+ ,$ (* /(t&'* p+!&"&7n *(* p#&'$#*. En +t#*! p*(*5#*! $( 'u(t&p(&"*n,+ $! !&'&(*# *( #$!u(t*,+ $ "$pt+ u$$( /(t&'+ ,`@&t+ $! $( p#&'$#+ ,$( #$!u(t*,+. E( !&@u&$nt$ $0$'p(+ !$ $ p(&"* p+# !&!+(+ 1<26 :+ ; + X +1<62 :. P*#* u$ !$* un )$#,*,$#+ n/'$#+ p*#_!&t+ $('u(t&p(&"*,+# ,$5$ !$# !&'&(*# *( n/'$#+ u$ "*'5&* ,$ p+!&"&7n $n $( #$!u(t*,+.L*'$nt*5($'$nt$ !+n 'u- $!"*!+! $!t+! n/'$#+!. Un* )*#&*"&7n !+n (+! p!$u,+p*#_!&t+! u$ *( 'u(t&p(&"*#!$ p+# 4 "*'5&*n $( /(t&'+ ,`@&t+ *( p#&n"&p&+6 p$#+ $!t$ n+ $! !&'&(*# *( 'u(t&p(&"*,+#. Un $0$'p(+ $! 1 36 4, ; 4 X , 1 63 4. Aun u$ $!t+! +t#+n/'$#+! !+n t*'5& n #*#+!6 +"u##$n "+n '_! #$"u$n"&* u$ (+! n/'$#+! p*#_!&t+! $!p$""u*n,+ $( 'u(t&p(&"*,+# $! 4. E!"#&5* un p#+@#*'* u$ 5u! u$ * u$((+! n/'$#+! p*#_!&t+! ,1<<6<<< = 6 % u$ *( 'u(t&p(&"*#!$ p+# 4 "*'5&$ $( /(t&'+ ,`@&t+ ,$ (u@*#.

Input

E( p#+@#*'* n+ )* * p$,&# *5!+(ut*'$nt$ n*,* *( u!u*#&+. .

Output (screen)

Simplemente va a mostrar en pantalla los resultados encontrados y va a notificar la cantidadde números encontrados.

Corrida de ejemplo

12 ,2!" # $ % "12, 2!

&

&'otal de n(meros pseudopar)sitos de * d+ itos-.$/: 99

14

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 15/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría P#&n"&p&*nt$! Universidad UPR = B*-*'7nAutor Ant+n&+ Ju$#t*! Tipo de competencia P#+@#*'*"&7nProblema ( 3

-. /$R0.1N #$ TA.!

E( !&!t$'* +p$#*t&)+ UNI; p#+)$$ un "+'*n,+ ((*'*,+tail u$ 'u$!t#* (*! /(t&'*! n (`n$*! ,$ un*#" &)+ ,$ t$ t+. E!"#&5* un p#+@#*'* u$ p#$@unt$ $( n+'5#$ ,$ un *#" &)+ ,$ t$ t+ - unu$ !$ "+'p+#t$ "+'+ tail. S& $( *#" &)+ t&$n$ '$n+! ,$n (`n$*!6 $( p#+@#*'* ,$5$ '+!t#*#todo $("+nt$n&,+ ,$( *#" &)+. A!u'* u$ "*,* (`n$* ,$( *#" &)+ *"*5* $n cnd. V*(&,$ u$ $( *#" &u$ $( )*(+# ,$n !$* < 7 '_!.

Archivo de Prueba 23ernel4t5t6(0ue es el ernel

El ernel o n(cleo del sistema operativo es el pro rama ue se comunicadirectamente con el 4ardware& Esta es la parte del sistema operativo uese car a en 56M cuando se enciende la computadora y permanece en 56M 4astaue la computadora se apa a& Est) escrito, en el caso de 7nix, mayormenteen C con un poco de len ua8e de ensambla8e& El ernel debe interactuar conlos usuarios, con los pro ramas y, obviamente, con el 4ardware&

$%emplo(9ndi ue el nombre del arc4ivo: abc.txtEl arc4ivo no existe, trate de nuevo&

9ndi ue el nombre del arc4ivo: kernel.txt

9ndi ue la cantidad de l+neas:-10

a cantidad de l+neas es menor de !, trate de nuevo&

9ndi ue la cantidad de l+neas: 4

as (ltimas $ l+neas de ernel&txt son:

se car a en 56M cuando se enciende la computadora y permanece en 56M 4astaue la computadora se apa a& Est) escrito, en el caso de 7nix, mayormenteen C con un poco de len ua8e de ensambla8e& El ernel debe interactuar conlos usuarios, con los pro ramas y, obviamente, con el 4ardware&

1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 16/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría P#&n"&p&*nt$! Universidad UPR = B*-*'7nAutor Ant+n&+ Ju$#t*! Tipo de competencia P#+@#*'*"&7nProblema ( 4

-. /$R0.1N #$ C-P

E( !&!t$'* +p$#*t&)+ UNI; p#+)$$ un "+'*n,+ ((*'*,+cmp u$ ,+! *#" &)+! - u$ ,$t$#'&n* !& !+&, nt&"+! + n+. S& (+! *#" &)+! !+n &, nt&"+!6 $( "+'*n,+ 'u$!t#* un '$n!*0$ u$ (+ &n,&"!+n6 "+'*n,+ 'u$!t#* $( n/'$#+ ,$ (`n$* - ,$ "*#*"t$# ,+n,$ *p*#$"$ (* p#&'$#* ,& $#$n"&*un p#+@#*'* u$ p#$@unt$ $( n+'5#$ ,$ ,+! *#" &)+! ,$ t$ t+ - u$ !$ "+'p+#t$ "+'+cmp. A!u'*u$ "*,* (`n$* ,$( *#" &)+ *"*5* $n cnd. V*(&,$ u$ (+! *#" &)+! $ &!t*n - u$ !$ "+'p**#" &)+! "+n n+'5#$! ,& $#$nt$!.

Archivo de Prueba & 27erreteria4t5t6(222 Martillo 2&"! 1!

$$$ ;erruc4o 1!&!! 3111 Clavos 1&!! 1"333 Pala $&!! "<<< 'ornillos 1&!! 2!""" =estornillador 3&!! $

Archivo de Prueba ' 27erreteria'4t5t6(222 Martillo 2&"! 1!$$$ >roc4a 1!&!! 3111 Pintura 1&!! 1"<<< 'ornillos 1&!! 2!

Cadena <&!! 1""" =estornillador 3&!! $

$%emplo(9ndi ue el nombre del arc4ivo ?1: abc.txtEl arc4ivo ?1 no existe, trate de nuevo&

9ndi ue el nombre del arc4ivo ?1: ferreteria.txt9ndi ue el nombre del arc4ivo ?2: abc.txtEl arc4ivo ?2 no existe, trate de nuevo&

9ndi ue el nombre del arc4ivo ?2: ferreteria.txtos nombres de los arc4ivos son i uales, trate de nuevo&

9ndi ue el nombre del arc4ivo ?2: ferreteria2.txt

os arc4ivos ferreter+a&txt y ferreteria2&txt no son i uales&a primera diferencia est) en la l+nea ?2, caracter ?"&

1:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 17/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría P#&n"&p&*nt$! Universidad UPR = B*-*'7nAutor Ant+n&+ Ju$#t*! Tipo de competencia P#+@#*'*"&7nProblema (

8U9AN#: C:N F$C;A0

E!"#&5* un p#+@#*'* u$ p#$@unt$ un* $" * - u$ 'u$!t#$ (* $" * ,$( p#7 &'+ ,`*. L* $" *!$# $nt#*,* $n +#'*t+mm<dd<aaaa6 ,+n,$mm $! $( '$!6dd $! $( ,`* -aaaa $! $( *9+. E( p#+@#*,$5$#_ )*(&,*# (* $" *

• E( *9+ ,$5$#_ $!t*# $nt#$ 1 - 21<<.• E( '$! ,$5$#_ $!t*# $nt#$ 1 - 12.• E( ,`* ,$5$#_ $!t*# $nt#$

o 1 - 3< p*#* (+! '$!$! 4 *5#&(%6 : 0un&+%6 !$pt&$'5#$% - 11 n+)&$'5#$%o 1 - 31 p*#* (+! '$!$! 1 $n$#+%6 3 '*#8+%6 '*-+%6 0u(&+%6 *@+!t+%6

- 12 ,&"&$'5#$%o 1 - 2 p*#* $( '$! 2 $5#$#+% !& $( *9+ n+ $! 5&!&$!t+a 1 - 2 p*#* $( '$! 2

$( *9+ $! 5&!&$!t+

$%emplo &(9ndi ue la fec4a: 11/31/2006a fec4a es incorrecta, trate de nuevo&

9ndi ue la fec4a: -11/30/2006a fec4a es incorrecta, trate de nuevo&

9ndi ue la fec4a: 11/30/2006a fec4a del pr@ximo d+a es 12A1A2!!*&

$%emplo '(9ndi ue la fec4a: 2/28/2006a fec4a del pr@ximo d+a es 3A1A2!!*&

$%emplo =(9ndi ue la fec4a: 2/28/2008a fec4a del pr@ximo d+a es 2A2BA2!! &

1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 18/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 1

N)meros /ampiros

L+! n/'$#+! )*'p&#+! !+n p#+,u"t+ ,$ ,+!n/'$#+! p#+@$n&t+#$! u$ "u*n,+ !$ 'u(t&p(&"*n6 !$'$8"(*n "+n $( #$!u(t*,+. P+# $0$'p(+ (* !&@u&$nt$'u(t&p(&"*"&7n p#+,u"$ un n/'$#+ )*'p&#+ 2 ;1 X 21 . E!t+ !$ ,$5$ * u$ (+! ,`@&t+! 26 6 - 1!$ $n"u$nt#*n t*nt+ $n $( #$!u(t*,+ "+'+ $n (+!n/'$#+! p#+@$n&t+#$!. Ot#+ $0$'p(+ pu$,$ !$#1643 $( "u*( $! $( #$!u(t*,+ ,$ 3 ; 41. Un

)$#,*,$#+ n/'$#+ )*'p&#+ "u'p($ (+! !&@u&$nt$!#$ u&!&t+!

1. T&$n$n un* "*nt&,*, p*# ,$ ,`@&t+!.

2. C*,* un+ ,$ (+! n/'$#+! p#+@$n&t+#$! t&$n$ (* '&t*, ,$ (+! n/'$#+! ,$( #$!u(t*,+.

3. Un )$#,*,$#+ n/'$#+ )*'p&#+ n+ !$ "#$* *( &n"(u`#!$($ "$#+! *( &n*(. P+# $0$'p(+ 2 <6<1<6<<< X 21 6 <<6<<<6<<< n+ $! un )$#,*,$#+ n/'$#+ )*'p&#+

J*@* un p#+@#*'* u$ "*("u($ (+! )$#,*,$#+! n/'$#+! )*'p&#+! ,$ 4 p#+@$n&t+#$! X 2 ,`@

p#+@$n&t+#$! X 3 ,`@&t+!% - p#+@$n&t+#$! X 4 ,`@&t+!% ,`@&t+!.

Input (screen)

E( p#+@#*'* )* * p$,&# p+# p*nt*((* (* "*nt&,*, ,$ ,`@&t+! u$ u&$#$ "+t$0*# - !7(+ + #$"*(t$#n*t&)*! 46 : - .

Output (screen & file:vampiro.out)

E( p#+@#*'* )* '+!t#*# $n p*nt*((* - $n *#" &)+ $( #$!u(t*,+ !$@/n (+ !+(&"&t7 $( 0u$8. N)* * '+!t#*# (* "*nt&,*, ,$ n/'$#+! )*'p&#+!6 !&n+ u$ t*'5& n )* * '+!t#*# $( t+t*( $n"+nt#*,+

1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 19/499

Corrida de ejemplo9ndi ue la cantidad de d+ itos-$,*, /: 2Cantidad indicada incorrecta, trate de nuevo

9ndi ue la cantidad de d+ itos-$,*, /: 4

1" x B3 % 13B"21 x *! % 12*!

21 x < % 1 2<2< x 1 % 21 <3! x "1 % 1"3!3" x $1 % 1$3"! x * % * !

'otal de n(meros vampiros de 4 d+ itos es: <

1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 20/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 2

$l 0abuesoUn !*5u$!+ * #$"+##&,+ "+'p($t*'$nt$ un t*5($#+ *)*n8*n,+ ,$ un*"*!&((* * +t#* )$"&n* $n +#&8+nt*( + )$#t&"*( nun"* $n ,&*@+n*(% !&n p*!*# ,+! )$"$! p+# (* '&!'* "*!&((* - !&n ,$0*# n&n@un* !&n )&!&t*#. E(#$"+##&,+ !$#_ ,$( n/'$#+ '*-+# *"&* $( n/'$#+ '$n+# n+n$"$!*#&*'$nt$ t&$n$ u$ t$#'&n*# $n 1% *!t* u$ !$ (($n$n t+,+! (+!$n"*!&((*,+!.

Un $0$'p(+ ,$ un t*5($#+ ,$ 4 ; 4 $!

Para simplificar un poco el problema, se va a indicar la posición inicial en donde se va acomenzar el recorrido, el número inicial (mayor) y el tamaño del tablero va a ser fijo (6 6).

Input (file:sabueso.in)

E( p#+@#*'* )* * ($$# un *#" &)+ $n ,+n,$ (* p#&'$#* (`n$* t&$n$ (* "*nt&,*, ,$ t*5($#+! L* p#7 &'* (`n$* t&$n$ (* p+!&"&7n &n&"&*( ,$nt#+ ,$( t*5($#+ $n ,+n,$ !$ )* * "+'$n85*!$ 1%. L* t$#"$#* (`n$* )* * t$n$# $( n/'$#+ "+n $( "u*( !$ )* * "+'$n8*# $( #$"+##&,+ -$( t*5($#+ ,$ : ; : $n ,+n,$ "*,* p+!&"&7n $!t*#_ #$p#$!$nt*,* p+# un punt+ '$n+! *$n"*!&((*,+! u$ t$n@*n -* $( n/'$#+ ,$ &n&,+. C*,* n/'$#+ + punt+ $!t*#_ !$p*#*,+ p+# u$n 5(*n"+. S& *- '_! ,$ un t*5($#+6 *5#_ un* (`n$* u$ !$p*#$ un t*5($#+ ,$ +t#+ !$@ p+!&"&7n &n&"&*( ,$( t*5($#+ - $n (* p#7 &'* (`n$* $( n/'$#+ &n&"&*(.

2<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 21/499

Output (file:sabueso.out)

E( p#+@#*'* @u*#,*#_ $n un *#" &)+ "*,* t*5($#+ "+n !u! "+##$!p+n,&$nt$! !+(u"&+n$&n,&"*# u$ p*#* *"&(&,*, ,$ ($"tu#* ,$ (+! #$!u(t*,+! p+# p*#t$ ,$ (+! 0u$"$!6 * u$((+! n/* ,$5$n t$n$# un $!p*"&+ *,&"&+n*( *( #$nt$ p*#* u$ u$,$ $( t*5($#+ "+'p($t*'$nt$ A u$((* p*#$0* u$ !+'$t* un #$!u(t*,+ u$ n+ &n"(u-* $!t$ +#'*t+6 !*"*#_ unincorrect output - (* p$n*(&,*, ,$ t&$'p+ u$ !$ &n,& u$ $n (*! #$@(*! ,$ (*! "+'p$t$n"&*!.

Test #ata .nput(13 33<& & & & & 22& & & 33 & && 3! & & & &$ & & & && 12 & & & && & & & & 1<

Test #ata :utput(2< 2* 2" 2$ 23 222 31 32 33 3$ 212B 3! 3< 3* 3" 2! $ " * < 1B 3 12 11 1! B 1 2 13 1$ 1" 1* 1<

21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 22/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 3

SOLON File S stem ! "ll File Si#eDefinición del problemaE( !&!t$'* +p$#*t&)+ VSD>U(t#& V&!t* ut&(&8* $( !&!t$'* ,$ *#" &)+! SOLON. E!t$ !&!t$'* ut&(&8* un* t,$ *#" &)+! F&($ A((+"*t&+n T*5($% ,$ 32 5&t! ((*'*,* $( SOLON>FAT. Un $0$'p(+ ,$( SOLON>FAT !&@u$"+nt&nu*"&7n

.# Filename FC .n>lin3 0tart>Addr $nd>Addr1 *+?&.@& 1 <1<< <12:2 $t $#$*(.t t 1 2<<3 2<1:3 &n&,$nt.,(( 1 <<33 << 34 *+?&.@& < < << 4 << <

*+?&.@& < 4 < << 1<24: &n&,$nt.,(( < < <2 1 <4:<

$t $#$*(.t t < < <<<1 <<32&n&,$nt.,(( < : <12 <2<<

E( SOLON>FAT !$ "+'p+n$ ,$ (+ !&@u&$nt$• C*,* $nt#*,* $n $( SOLON>FAT $!t_ &,$nt& &"*,* "+n un n/'$#+ n*tu#*( 16263 % - $!$ $! !u ID ,$nt#+

t*5(*. S&$'p#$ "+'&$n8* $n 1%.• J*- un "*'p+ binario (0,1) u$ &,$nt& &"* $( p#&n"&p&+ ,$( *#" &)+. E!t$ "*'p+ !$ ($ ((*'* $( First-Chain FC%.• J*- un "*'p+ ((*'*,+ in-link u$ &,$nt& &"* (* p+!&"&7n ,$nt#+ ,$( SOLON>FAT ,$( p#7 &'+ !$@'$nt+

#$ $#$nt$ *( *#" &)+ ,$ &n&,+ $n $( "*'p+ ,$ filename . S& $!t$ "*'p+ $!t_ $n < !&@n& &"* u$ !t$ $! $( /(t&'!$@'$nt+ ,$( *#" &)+.

• L+! "*'p+! ,$ Start-Addr *n, End-Addr &,$nt& &"*n ,+n,$ "+'&$n8* - t$#'&n* $!$ !$@'$nt+ ,$ ,*t+! #$ $#*#" &)+ ,$!"#&t+ $n filename .

P+# $0$'p(+ $( *#" &)+ao i& if t&$n$ 3 $nt#*,*! $n $( SOLON>FAT IDS 16 - 4%. E( *#" &)+ $!t* ,&)&,&,+ !$@'$nt+!. E( p#&'$# !$@'$nt+ "+'&$n8* $n (* p+!&"&+n 1<< - t$#'&n* $n (* 12:6 $( !$@un,+ !$@'$nt+ "+'&$<< - t$#'&n* $n (* p+!. 1<246 - $( u(t&'+ !$@'$nt+ "+'&$n8* $n (* p+!&"&+n 4 - t$#'&n* $n (* <.El programa

U!t$, ,$5$#_ "+n!t#u&# un p#+@#*'* u$ ,*,+ un *#" &)+ SFAT.T;T pu$,* "*("u(*# $( t*'*9+ ,$ t+,+! (+! *#" &)+"+nt$n&,+! $n $( SFAT.

E0$'p(+ D*,+ un SFAT.T;T "+'+ $( p#$!$nt*,+ *nt$#&+#'$nt$ !u !&!t$'* ,$!p($@*#_ $n p*nt*((*

ao i& if "< bytes 3 se mentoset4ereal&txt "< bytes 2 se mentoswinident&dll 3!* bytes 3 se mentos

IMPORTANTE:• E( p#&'$# !$@'$nt+ ,$ t+,+! (+! *#" &)+! "+nt$n&,+! $n $( SOLON>FAT $!t_n $n (*! p#&'$#*! p+!&"• Un *#" &)+ pu$,$ $!t*# @u*#,*,+ $n 1 + '_! !$@'$nt+!.• S& un !$@'$nt+ $'p&$8* $n (* p+!&"&7n 1 - t$#'&n* $n (* 3 $! ,$ t*'*9+ 3 -N: ,$ t*'*9+ 3>1%X2. E!t+ $!

"&$#t+ -* u$ $(byte 16 2 - 3 p$#t$n$"$n *( '&!'+ !$@'$nt+.P*#* $!t$ p#+5($'* $( n/'$#+ '*-+# ,$ $nt#*,*! $n $( SOLON>FATno e5ceder* nunca 2<.

22

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 23/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR = B*-*'7nAutor ACM Tipo de competencia P#+@#*'*"&7nProblema 4

B:-BA0E( 0u$@+ ines!eeper !$ 5*!* $n &# *,&)&n*n,+ $n ,+n,$ !$$n"u$nt#*n (*! 5+'5*! +"u(t*!. P*#* u$ $( 0u@*,+# pu$,*,$t$#'&n*# $n ,+n,$ !$ $n"u$nt#*n6 ut&(&8* ,$ #$ $#$n"&* (+!n/'$#+! u$ ($ )*n &n,&"*n,+ (* p#+ &'&,*, ,$ (*! 5+'5*!.D$ (* '&!'* +#'* )*'+! * *n*(&8*# (+! n/'$#+! ,$ un t*5($#+

p*#* ,$t$#'&n*# $n ,+n,$ !$ $n"u$nt#*n (*! ,& $#$nt$! 5+'5*!. C*,* n/'$#+ &n,&"*"u_nt*! 5+'5*! *- $n (*! "*!&((*! )$"&n*!6 $n +#&8+nt*(6 )$#t&"*( - ,&*@+n*(. N&n@un* "*!&((* (($)* '_! ,$ un* 5+'5* - ,+n,$ *- n/'$#+ n+ *- 5+'5*. J*@* un p#+@#*'*($* ,$ un *#" &)+ un* !$#&$ ,$ t*5($#+! - @u*#,$ (+! #$!u(t*,+! $n +t#+ *#" &)+.

InputE( *#" &)+ "+'$n8*#_ "+n un* p#&'$#* (`n$* u$ &n,&"*#_ $( nu'$#+ ,$ t*5($#+! u$ !$ )*nE( p#7 &'+ #$"+#, ,$5$ "+nt$n$# (* "*nt&,*, ,$ &(*! - "+(u'n*! u$ "+nt&$n$ $( t*5($#+Lu$@+ ,$5$ !$@u&# $( t*5($#+. En * u$((+! $n"*!&((*,+! u$ n+ (($)* n/'$#+6 !$ )* *p+n$#C*,* p+!&"&7n )* * $!t*# !$p*#*,* ,$ un $!p*"&+ $n 5(*n"+. C*,* t*5($#+ )* * t$n$# !u! ,&)* * $!t*# !$p*#*,+ ,$ (* +t#* t*5(* p+# un* (`n$* $n 5(*n"+.

OutputL* !*(&,* "+n!&!t$ $n '+!t#*# $( t*5($#+ "+n !u! "+##$!p+n,&$nt$! 5+'5*!. L*! 5+'5*! !$ )*n,&5u0*# ut&(&8*n,+ $( *!t$#&!"+ e%. En ,+n,$ n+ *- 5+'5*!6 !$ ,$0* $( punt+. E( p#+@#

)*(&,*# "u*( u&$# p+!&5($ $##+# u$ pu$,* !u#@&# ,$ ($$# (+! ,*t+!. A( &n*( !$ ,$5$ &n, 5+'5*! $n"+nt#*,*! $n $( t*5($#+.Sample Input (File: bombas.in)1$ $& & 2 &1 2 & && & & $& & & &Sample Output (File:bombas.out)& . 2 &

1 2 & .& & . $& & . .'otal de bombas: "

23

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 24/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría Int$#'$,&+! Universidad UPR = B*-*'7nAutor Ant+n&+ Ju$#t*! Tipo de competencia P#+@#*'*"&7nProblema (

F$C;A0 #$! FUTUR:

E!"#&5* un p#+@#*'* u$ p#$@unt$ un* $" * - un n/'$#+ p+!&t&)+n - u$ 'u$!t#$ (* $" * ,$ n ,`*!$n $( utu#+. L* $" * ,$5$#_ !$# $nt#*,* $n +#'*t+mm<dd<aaaa6 ,+n,$mm $! $( '$!6dd $! $( ,`* -aaaa $! $( *9+. E( p#+@#*'* ,$5$#_ )*(&,*# (* $" *

• E( *9+ ,$5$#_ $!t*# $nt#$ 1 - 21<<.• E( '$! ,$5$#_ $!t*# $nt#$ 1 - 12.• E( ,`* ,$5$#_ $!t*# $nt#$

o 1 - 3< p*#* (+! '$!$! 4 *5#&(%6 : 0un&+%6 !$pt&$'5#$% - 11 n+)&$'5#$%o 1 - 31 p*#* (+! '$!$! 1 $n$#+%6 3 '*#8+%6 '*-+%6 0u(&+%6 *@+!t+%6

- 12 ,&"&$'5#$%o 1 - 2 p*#* $( '$! 2 $5#$#+% !& $( *9+ n+ $! 5&!&$!t+a 1 - 2 p*#* $( '$! 2

$( *9+ $! 5&!&$!t+

$%emplo &(9ndi ue la fec4a: 11/31/2006El d+a es incorrecto para el mes indicado, trate de nuevo&

9ndi ue la fec4a: -11/25/2006El mes es incorrecto, trate de nuevo&

9ndi ue la fec4a: 11/25/2106El a o es incorrecto, trate de nuevo&

9ndi ue la fec4a: 11/25/20069ndi ue el n(mero: -8El n(mero es no es positivo, trate de nuevo&

9ndi ue la fec4a: 11/25/20069ndi ue el n(mero: 8a fec4a d+as en el futuro es 12A3A2!!*

$%emplo '(9ndi ue la fec4a: 2/28/20069ndi ue el n(mero: 4a fec4a $ d+as en el futuro es 3A$A2!!*&

$%emplo =(9ndi ue la fec4a: 2/28/20089ndi ue el n(mero: 4a fec4a $ d+as en el futuro es 3A3A2!! &

24

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 25/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR = B*-*'7nAutor N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 1

Klingon Paths

En (* !$#&$ ,$Star "rek (* #*8* ?&n@(+n&*n* klin#on % !$ "*#*"t$#&8* p+# !$# @#*n,$! @u$##$#+! - n+ t$n$# '&$,+ * (* 'u$#t$. Du#*nt$ un*,$ !u! '/(t&p($! @u$##*!6 !$ $n"+nt#*#+n "+n un $n$'&@+ u$ #$@&!t#*(* (+"*(&8*"&7n ,$ "*,* n*)$ !$@/n $nt#* $n "*,* "u*,#*nt$. S& (*n*)$ )u$()$ *( '&!'+ (u@*#6 !$ *"t&)* un* 5+'5* u$ ,$!t#u-$ $("u*,#*nt$ "+'p($t+. C+'+ (+! klin#ons n+ t&$n$n '&$,+ * (*'u$#t$6 $n)&*#+n * un $!p`* * $ p(+#*# un !$"t+# p+# ,+n,$ $((+!

p+,#`*n &n)*,&#. E( $!p`* ,$5$ $n"+nt#*# (* #ut* '_! (*#@* p+!&5($ p*#* p+,$# (($@*# *( p(*n$t* ,$ (+! $n$'&@+!. L* n*)$ !7(+ !$ pu$,$'+)$# +#&8+nt*( + )$#t&"*('$nt$ ,$ un "u*,#*nt$ * +t#+. C*,*"u*,#*nt$ t&$n$ un n/'$#+ - $!t$ n/'$#+ pu$,$ #$p$t&#!$ $n +t#+"u*,#*nt$. L* n*)$ ,$5$ p*!*# $nt#$ (+! "u*,#*nt$! ,$ '+,+ t*( u$n+ )&!&t$ un "u*,#*nt$ u$ t$n@* $( '&!'+ n/'$#+ n& )&!&t*# $('&!'+ "u*,#*nt$. J*@* un p#+@#*'* u$ ,$t$#'&n$ "u*( $! (* #ut*'_! (*#@* ,$nt#+ ,$ un !$"t+# ,$t$#'&n*,+.

Input

E( *#" &)+ "+'$n8*#_ "+n un* p#&'$#* (`n$* u$ &n,&"*#_ $( nu'$#+ ,$ !$"t+#$! u$ !$ )*nL* p#7 &'* (`n$* ,$5$ "+nt$n$# (* "*nt&,*, ,$ &(*! - "+(u'n*! u$ "+nt&$n$ $( !$"t+#. Lu!$@u&# (* t*5(* u$ t&$n$ $n "*,* &nt$#!$""&7n "u*,#*nt$% un n/'$#+ ,$( < *( !$p*$!p*"&+ $n 5(*n"+.

Output

L* !*(&,* "+n!&!t$ $n un p*# ,$ n/'$#+! $nt#$ p*# nt$!&! u$ &n,&"*n (* "++#,$n*,* &n&"&"u*,#*nt$ 5*!$ 1% $n ,+n,$ "+'&$n8* (* #ut*. En un* p#7 &'* (`n$* !$ 'u$!t#* (* (&!t* ,$ n/!$@u&# !$p*#*,+ p+# un $!p*"&+ $n 5(*n"+. Pu$,$ *5$# )*#&*! !+(u"&+n$! u$ ,$n $( '&! p*!+!. En $!t$ "*!+ !$ 'u$!t#*n t+,*! (*! !+(u"&+n$!.

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 26/499

Sample Input (File: $lin%on.in)

13 3 * 2! 3

3 1< B2! 1! *

Sample Output ($lin%on.out)-1,1/*D2!D3DBD1<D1!*D3D2!D1!D1<DB

-1,2/2!D3DBD*D1!D1<

-1,3/

3D2!D1<DBD*D1!3DBD*D1!D1<D2!

-2,1/3D1<DBD*D1!D2!3D2!D1!D*DBD1<

-2,2/1<D2!D3DBD*D1!1<DBD*D1!D2!D31<D1!D*DBD3D2!1<D3D2!D1!D*DB

-2,3/BD3D2!D1<D1!D*BD1<D3D2!D1!D*BD*D1!D2!D3D1<

-3,1/2!D3D1<DBD*D1!2!D1!D*DBD1<D3

-3,2/1!D2!D3D1<DBD*1!D1<D2!D3DBD*1!D*DBD3D2!D1<

-3,3/*DBD3D2!D1<D1!*D1!D1<D2!D3DB*D1!D2!D3D1<DB

* 2! 3

3 1< B

2! 1! *

2:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 27/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR = B*-*'7nAutor Hu*n S+(_ Tipo de competencia P#+@#*'*"&7nProblema 2

SOLON File S stem efra%mentator '.

Definición del problema

E( !&!t$'* +p$#*t&)+ VSD>U(t#& V&!t* ut&(&8* $( !&!t$'* ,$ *#" &)+! SOLON. E!t$ !&!t$'* ut&(&8* un* t,$ *#" &)+! F&($ A((+"*t&+n T*5($% ,$ 32 5&t! ((*'*,* $( SOLON>FAT. Un $0$'p(+ ,$( SOLON>FAT !&@u$"+nt&nu*"&7n

.# Filename FC .n>lin3 0tart>Addr $nd>Addr1 b,*t*b&'*@$!b*+?&.@& < < <1<< <12:2 b +'$b0u*nb$t $#$*(.t t 1 2<A3 21<C3 b#!-n"b5*"?upb &n&,$nt.,(( < < <<3B << C4 b$t"b"#+nt*5."+n 1 < << D << Cb,*t*b&'*@$!b*+?&.@& 1 1 < <F 1<2A: b"-@>,&!?b &n,+ !b#!-n".$ $ 1 < <2 1 <4:<

b +'$b0u*nb$t $#$*(.t t < < <<<1 <<3Ab#!-n"b5*"?upb &n&,$nt.,(( 1 3 <12 <1 F

E( SOLON>FAT !$ "+'p+n$ ,$ (+ !&@u&$nt$

• C*,* $nt#*,* $n $( SOLON>FAT $!t_ &,$nt& &"*,* "+n un n/'$#+ n*tu#*( 16263 % - $!$ $! !u ID ,$nt#+t*5(*. N+ n$"$!*#&*'$nt$ "+'&$n8*n $n 1 p$#+ !& !+n !$ u$n"&*($!%.

• J*- un "*'p+ binario ($oolean) u$ &,$nt& &"* $( p#&n"&p&+ ,$( *#" &)+. E!t$ "*'p+ !$ ($ ((*'* $( First-ChainFC%.

• J*- un "*'p+ ((*'*,+ in-link u$ &,$nt& &"* (* p+!&"&7n ,$nt#+ ,$( SOLON>FAT ,$( p#7 &'+ !$@'$nt+ #$ $#$nt$ *( *#" &)+ ,$ &n&,+ $n $( "*'p+ ,$ filename . S& $!t$ "*'p+ $!t_ $n < !&@n& &"* u$ $!t$ $! $( /(t&!$@'$nt+ ,$( *#" &)+.

• L+! "*'p+! ,$ St*#t>A,,# *n, En,>A,,# &,$nt& &"*n ,+n,$ "+'&$n8* - t$#'&n* $!$ !$@'$nt+ ,$ ,*t+! #$ $#*#" &)+ ,$!"#&t+ $n filename . NOTE u$ (*! p+!&"&+n$! !+n $ *,$"&'*($!%.

P+# $0$'p(+ $( *#" &)+AdataAima esAao i& if t&$n$ 2 $nt#*,*! $n $( SOLON>FAT IDS - 1%. E( *#" &)+ $,&)&,&,+ $n 2 !$@'$nt+!. E( p#&'$# !$@'$nt+ "+'&$n8* $n (* p+!&"&+n < <F - t$#'&n* $n (* 1<2A - $( !$@un"+'&$n8* $n (* p+!. <1<< - t$#'&n* $n (* p+!. <12:.

El programa

U!t$, ,$5$#_ "+n!t#u&# un p#+@#*'* u$ ut&(&"$ (+! *#" &)+! SFAT.IN - ISO.IN - @$n$#*# (+! *#" &)+! SFAISO.OUT. E( *#" &)+ SFAT.IN "+nt&$n$ $( SOLON>FAT - $( *#" &)+ ISO.IN "+nt&$n$ un* &'*@$n ,$( ,&!"+,$5$#_ ut&(&8*# $( SFAT.IN p*#* ,$ #*@'$nt*# $( ISO.IN. E0$'p(+

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 28/499

SFAT.IN

1 c,*t*c*.t t 1 3 <<1 <<2 c,*t*c5.t t 1 4 <<: <133 c,*t*c*.t t < < <14 <2<4 c,*t*c5.t t < < <21 <2A

ISO.IN

C*"tuT$##- Fun? )! H*"? )!. S*5uR&"? F(*&#

Lu$@+ ,$( D$ #*@ !u !&!t$'* ,$5$ @$n$#*#

SFAT.OUT

1 c,*t*c*.t t 1 < <<1 <142 c,*t*c5.t t 1 < <1 <2D

ISO.OUTC*"tu! H*"? )!. S*5uT$##- Fun? )!. R&"? F(*&#

IMPORTANTE: N+ *!u'* u$ $( ISO.IN $! un *#" &)+ ,$ t$ t+. A5!t#*&@* ,$ u$ $( '&!'+ $! un* "+n"*t$n*"& 5-t$! !&n !$nt&,+ - (+ u$ ($ ,* $( !$nt&,+ $! $( p#+@#*'* u$ (+! ($*. P+# $0$'p(+ ISO.IN puun* "+n"*,$n*"&7n ,$ &'_@$n$! *!` "+'+ $( ISO.IN ,$( $0$'p(+ $! un* "+n"*,$n*"&7n ,$ t$ t+

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 29/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR = B*-*'7nAutor ACM Tipo de competencia P#+@#*'*"&7nProblema 3

So Doku C ecker T $ 5$!t (+@&"*( pu88($! + t$n *#$ pu88($! t *t *#$ 5*!$, +n * !&'p($ &,$*. S+ D+?u &! +n pu88($. A(t +u@ S+ D+?u! *)$ 5$$n *#+un, +# !+'$ t $nt- -$*#!6 &n t $ (*!t $ -$*#!"+n u$#$, t $ +#(, $ p+n$nt&*((-. Jun,#$,! + n$ !p*p$#! *n, $5!&t$! *#$ n+ pu5(&! &n@ t* ,*&(- 5*!&!. F+# t +!$ + -+u un *'&(&*# &t t $!$ pu88($!6 ($t '$ @&)$ * 5#&$ &nt#+,u"

T $ p&"tu#$ *5+)$ "+nt*&n! *n $ *'p($ + * Su D+?u pu88($. A! -+u "*n !$$6 $ *)$ * ; @#&&(($, &t !&n@($ ,&@&t! #+' 1 t+ *n, $'pt- p(*"$!. T $ @#&, &! u#t $# ,&)&,$, &nt+ n&n@#&,!6 &n,&"*t$, 5- t $ t &"? (&n$!. T+ !+()$ t $ pu88($ -+u *)$ t+ &(( t $ $'pt- p(*"$! &t *""+#,&n@ t+ t $ +((+ &n@ #u($!

• E)$#- #+ ! +u(, "+nt*&n t $ ,&@&t! 1 t+ $ *"t(- +n"$a• E)$#- "+(u'n ! +u(, "+nt*&n t $ ,&@&t! 1 t+ $ *"t(- +n"$a• E)$#- 3;3 !u5>@#&, ! +u(, "+nt*&n t $ ,&@&t! 1 t+ $ *"t(- +n"$.

A $(( +#'$, Su D+?u "*n 5$ !+()$, &t p*p$# *n, p$n"&( u!&n@ (+@&"*( ,$,u"t&+n +n(-. T+#'$, &t ! +u(, 5$ ($@*( n+ #+ 6 "+(u'n +# !u5>@#&, "+nt*&n! * ,&@&t '+#$ t *n +n"$%6

$'pt- p(*"$! "*n *(( 5$ &(($, &($ #$!p$"t&n@ t $ #u($!% *n, un& u$ t $#$ &! +n(- +n$ !+(u&! *t -+u# p#+@#*' &! @+&n@ t+ " $"?.InputT $ &nput "+nt*&n! !$)$#*( p*#t&*((-% &(($, @#&,!6 $*" #$p#$!$nt&n@ * Su D+?u pu88($ t $#$ *#$ (&n$! &t ,&@&t! @&)&n@ t $ pu88($ &n #+ '*0+# +#,$#. E'pt- p(*"$*#$ #$p#$!$nt$, 5- t $ ,&@&t < 8$#+%. D&@&t! +n * (&n$ *#$ !$p*#*t$, 5- +n$ !p*!$p*#*t$, 5- +n$ $'pt- (&n$.T $ &#!t @#&, &n t $ !*'p($ &nput #$p#$!$nt! t $ pu88($ @&)$n &n t $ p&"tu#$.

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 30/499

:utputF+# $)$#- @#&, &n t $ &nput6 ,$t$#'&n$ +n$ + t $ +((+ &n@ +u# )$#,&"t!

• I(($@*( & t $ pu88($ )&+(*t$! +n$ + t $ t #$$ #u($!a• Un& u$ & +n(- +n$ !+(ut&+n $ &!t!a• A'5&@u+u! & '+#$ t *n +n$ !+(ut&+n $ &!t!a• I'p+!!&5($ & n+ !+(ut&+n $ &!t!a• I t $ p#+5($' &! un& u$6 ! + t $ !+(ut&+n

P#&nt +n$ (&n$ p$# @#&,6 &n t $ +#'*t C*!$ fNZ fVERDICTZ. 6 $#$ N &! t $ "*!$ nu'5$#6 !t*#t&n@VERDICT &! +n$ + t $ +u# +#,! &n t $ (&!t. S$$ t $ !*'p($ +utput +# t $ $ *"t +#'*t.

Note *n I(($@*( pu88($ &! *(!+ I'p+!!&5($ 6 + "+u#!$6 5ut -+u# p#+@#*' ! +u(, p#&ntt *t "*!$. On(- p#&nt I'p+!!&5($ & t $ &nput ,+$!n t )&+(*t$ +n$ + t $ t #$$ #u($!6 5ut t $ p"*n t 5$ !+()$,.

0ample .nput :utput 7or 0ample .nput0 0 3 9 0 0 ! 6 00 4 0 0 0 6 0 0 96 0 ! 0 1 0 0 0 42 0 0 6 ! 0 0 9 00 0 4 3 0 5 6 0 00 1 0 0 4 9 0 0 !! 0 0 0 9 0 2 0 13 0 0 2 0 0 0 4 00 2 9 0 0 8 5 0 0

0 0 3 9 0 0 ! 6 00 4 0 0 0 6 0 0 96 0 0 0 1 0 0 0 40 0 0 6 ! 0 0 9 00 0 4 0 0 5 6 0 00 1 0 0 4 9 0 0 0! 0 0 0 9 0 2 0 13 0 0 2 0 0 0 4 0

0 2 0 0 0 8 5 0 0

0 0 3 9 0 0 ! 6 00 4 0 0 0 6 0 0 96 0 ! 0 1 0 0 0 42 0 0 6 ! 0 0 9 00 0 4 3 0 5 6 0 00 1 0 0 4 9 0 0 !! 2 0 0 9 0 2 0 13 0 0 2 0 0 0 4 00 2 9 0 0 8 5 0 0

0 0 3 9 0 0 ! 6 00 4 0 0 0 6 0 0 96 0 ! 0 1 0 0 0 42 0 0 6 ! 0 0 9 00 0 4 3 0 5 6 0 00 1 0 0 4 9 0 0 !! 5 0 0 9 0 2 0 13 0 0 2 0 0 0 4 00 2 9 0 0 8 5 0 0

"ase 1# $ni%ue.1 " 3 B $ < * 2 $ 2 < 3 * 1 " B* B < " 1 2 3 $2 3 * < 1 $ B "B < $ 3 2 " * 1 " 1 * $ B 3 2 << * " $ B 3 2 13 1 2 " < B $ *$ 2 B 1 * " < 3

"ase 2# &mbiguous."ase 3# 'llegal."ase 4# 'mpossible.

3<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 31/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR = B*-*'7nAutor ACM Tipo de competencia P#+@#*'*"&7nProblema 4

-apping the RouteF&n,&n@ * p*t t #+u@ * '*8$ &! * p+pu(*# p#+5($' +# "+'put$#!. In t &! p#+5($'6 * '*8$ &"+n!&!t + * #$"t*n@u(*# *##*- + ! u*#$ "$((!6 $*" + &" '*- *)$ *((! +n t $ n+#t 6 !+ut 6 *n,b+# $!t !&,$! + t $ "$((. On$ "$(( &(( 5$ &,$nt& &$, *! t $ !t*#t&n@ p+&nt6 *n, *n+t $#&,$nt& &$, *! t $ @+*(. Y+u# t*!? &! t+ &n, t $ un& u$ #+ut$ #+' t $ !t*#t&n@ p+&nt t+ t $$*" "$(( &n t $ p*t &t &t! !$ u$n"$ &n t $ p*t 6 &,$nt& - t $ "$((! t *t $#$ )&!&t$, 5ut t *t &n t $ p*t 6 *n, ,&!p(*- t $ '*8$.T $ *(@+#&t ' -+u u!$ t+ &n, * p*t t #+u@ t $ '*8$ 'u!t 5$ t $ +n$ ,$!"#&5$, 5$(+ . I'*@&n$#+5+t &! p+!&t&+n$, &n t $ !t*#t&n@ "$((. T $ #+5+t &#!t *tt$'pt! t+ @+ $!t #+' t *t "$((6 t $n $*!t6 t $n !+ut 6 &n !$ u$n"$. T $ #+5+t "*n '+)$ &n t $ !$($"t$, ,&#$"t&+n &

*% t $#$ &! n+ *(( p#$)$nt&n@ &t #+' '+)&n@ &n t *t ,&#$"t&+n6 *n,

5% &t *! n+t -$t 5$$n &n t $ n$ t "$(( &n t *t ,&#$"t&+n.K $n t $ #+5+t #$*" $! t $ @+*(6 &t! t#&p &! +)$#. I t $ #+5+t #$*" $! * "$(( *t &" n+ u#t&! p+!!&5($6 &t #$t#$*t! t+ t $ p#$)&+u! "$(( &t +""up&$, *n, *tt$'pt! t+ '+)$ &n t $ n$ t unt,&#$"t&+n.

C+n!&,$# t $ !&'p($ '*8$ ! + n +n t $ ($ t 5$(+ . It &! t + "$((! &@ *n, t #$$ "$((! &,$. T $!t*#t&n@ "$(( &! (*5$($, g; *n, t $ @+*( "$(( &! (*5$($, g. K $n t $ #+5+t !t*#t!6 &t +u(, &#!t t#- t+'+)$ $!t ($ t%6 5ut &n,! * *((. It t $n t#&$! t+ '+)$ n+#t up%6 *n, &! *@*&n 5(+"?$, 5- * *(( *(!+ p#$)$nt! &t #+' '+)&n@ $*!t #&@ t%6 !+ &t &n*((- t#&$! t+ '+)$ !+ut ,+ n%6 *nF#+' t $ n$ "$(( &t &(( $)$ntu*((- '+)$ $*!t. J$#$ &t #$p$*t! &t! '+)$'$nt *(@+#&t '. A(t +u@

*(( 5(+"?! &t! p+t$nt&*( $!t *#, '+)$'$nt6 &t *! *(#$*,- )&!&t$, t $ "$(( &n t *t ,&#$"t&+n6t#&$! t+ '+)$ n+#t 6 *n, &! !u""$!! u(. Un +#tun*t$(-6 * t$# '+)&n@ n+#t 6 &t &n,! n+ *- t+ p*t 6 *n, !+ &t #$t#$*t! t+ t $ p#$)&+u!(- +""up&$, "$((. N+ &t t#&$! t+ '+)$ $*!t6 *n, &! !uF#+' t *t "$(( &t &(( '+)$ n+#t 6 *n, t $#$ &t &n,! t $ @+*(. T $ '*8$ t *t +u(, 5$ ,&!p(*-$, +n+utput &! ! + n +n t $ #&@ t 5$(+ . N+t$ t *t t $ !t*#t&n@ "$(( &! (*5$($, g1 6 $*" "$(( &n t $ p*t t+ t $@+*( &n"(u,&n@ t $ +n$ "+nt*&n&n@ t $ @+*(% &! (*5$($, &t &t! !$ u$n"$ nu'5$#6 *n,*! )&!&t$, 5ut &! n+t &n t $ p*t &! (*5$($, &t u$!t&+n '*#?!.

FDDDFDDDFDDDF FDDDFDDDFDDDF G ; G G G G 1G G "G F F F F F F F F G G G 2 3 $G FDDDFDDDFDDDF FDDDFDDDFDDDF

.nputV&$ t $ '*8$ *! *n *##*- + "$((!6 &t t $ n+#t $#n'+!t #+ 5$&n@ #+ 16 *n, t $ $!t$#n'+!t"+(u'n 5$&n@ "+(u'n 1. In t $ '*8$ *5+)$6 t $ !t*#t&n@ "$(( &! #+ 16 "+(u'n 16 *n, t $ @+*( #+ 16 "+(u'n 3.

T $#$ &(( 5$ +n$ +# '+#$ '*8$! t+ p#+"$!! &n t $ &nput. F+# $*" '*8$ t $#$ &(( &#!t *pp$*&nt$@$#!. T $ &#!t t + @&)$ t $ $&@ t nu'5$# + #+ !% *n, &,t nu'$# + "+(u'n!% + t $ '*

31

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 32/499

"$((!%. T $ n$ t t + @&)$ t $ p+!&t&+n #+ *n, "+(u'n nu'5$#% + t $ !t*#t&n@ "$((6 *n, t $ @&)$ t $ p+!&t&+n + t $ @+*(. N+ '*8$ &(( *)$ '+#$ t *n 12 #+ ! +# 12 "+(u'n!6 *n, t $#$ &*( *-! 5$ * p*t #+' t $ !t*#t&n@ p+&nt t+ t $ @+*(.

F+((+ &n@ t $ &#!t !& &nt$@$#! t $#$ &(( *pp$*# +n$ &nt$@$# +# $*" "$((6 &n #+ '*0)*(u$ + $*" &nt$@$# &n,&"*t$! $t $# * "$(( *! * *(( +n &t! $*!t$#n !&,$ 1% *n, $t $# &*(( +n &t! !+ut $#n !&,$ 2%. F+# $ *'p($6 * "$(( &t n+ $*!t$#n +# !+ut $#n *(( *! * )*(u$ +"$(( &t +n(- * !+ut $#n *(( *! * )*(u$ + 2. A "$(( &t 5+t *n $*!t$#n *n, * !+ut $#n *(( *! )*(u$ + 3. T $ "$((! +n t $ p$#&p $#- + t $ '*8$ *( *-! *)$ *pp#+p#&*t$ *((! t+ p#$)$nt t $ ##+' ($*)&n@ t $ '*8$a t $!$ *#$ n+t !p$"& &$, &n t $ &nput ,*t*.

T $ (*!t '*8$ &n t $ &nput ,*t* &(( 5$ +((+ $, 5- !& 8$#+$!.:utputF+# $*" '*8$6 ,&!p(*- t $ '*8$ *! ! + n &n t $ $ *'p($ *5+)$ *n, t $ $ p$"t$, +utput 5$(+ 6*pp#+p#&*t$(- (*5$($, *n, p#$ & $, 5- t $ '*8$ nu'5$#. T $ '*8$! *#$ nu'5$#$, !$ u$nt&*((- !t*&t 1.

0ample .nput2 3 1 1 1 31 1 !! ! !

$ 3 3 2 $ 3! 3 !! 2 !! 3 !! 1 !

! ! ! ! ! !

0ample :utputMaHe 1

FDDDFDDDFDDDFG 1G G "GF F F FG 2 3 $GFDDDFDDDFDDDF

MaHe 2

FDDDFDDDFDDDFG G GF FDDDF F

G 3 $ "GF FDDDF FG 2 1G *GF FDDDF FG G <GFDDDFDDDFDDDF

32

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 33/499

Fecha 22b*5#&(b2<<: Nombre de la competencia S pt&'*!C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR = B*-*'7nAutor ACM Tipo de competencia P#+@#*'*"&7nProblema

The Boggle 9ameT $ (*n@u*@$ P&@E u *! * )$#- !&'p($ !-nt* . E*" +#, &n t &! (*n@u*@$ *! $ *"t(- 4 ($tt$*" +#, "+nt*&n! $ *"t(- t + )+ $(! - &! "+n!&,$# * )+ $( &n P&@E u%. F+# &n!t*n"$6 '**#$)$n *#$ ($@&t&'*t$ +#,!6 *#t! &! n+t * ($@*( +#,.

In t $ @*'$ 5+@@($6 -+u *#$ @&)$n * 4 4 *##*- + ($tt$#! *n, *!?$, t+ &n, *(( +#,! "+nt*&+#, &n +u# "*!$ P&@E u% &(( t u! 5$ * !$ u$n"$ + 4 ,&!t&n"t ! u*#$! ($tt$#!% t *t +#' * *n, !u" t *t $*" ! u*#$ t+u" $! *)$ * "+#n$# +# $,@$ &n "+''+n% t $ n$ t ! u*#$.

F+# $ *'p($

6 ; ; =; > E I

J K 9 L 7 7

In t &! 5+*#, * p*#t&*(% (&!t + ($@*( +#,! &n"(u,$

6; 7 ;6>K JK9 JKI= ;I=E L7JK

BEBO &! * ($@*( +#, 5ut &t &! n+t +n t &! 5+@@($ 5+*#, t $#$ *#$ n+ t + B ! $#$%.

K#&t$ * p#+@#*' t *t #$*,! * p*&# + B+@@($ 5+*#,! *n, (&!t! *(( P&@E u +#,! t *t *#$ "+

5+t 5+*#,!.InputT $ &nput &($ &(( &n"(u,$ * $ ,*t* !$t!. E*" ,*t* !$t &(( 5$ * p*&# + 5+*#,! *! ! + n &n t $ !*'p($ &nput. A((&(( 5$ upp$# "*!$ ($tt$#!. T + "+n!$"ut&)$ $nt#&$! +n !*'$ 5+*#, &(( 5$ !$p*#*t$, 5- +n$ 5(*n?. T $ &#!t #+

5+*#, &(( 5$ +n t $ !*'$ (&n$ *! t $ &#!t #+ + t $ !$"+n, 5+*#,. T $- &(( 5$ !$p*#*t$, 5- +u# !p*"$!6 t $ !*'$ &+(, +# t $ #$'*&n&n@ 3 #+ !. B+*#, p*&#! &(( 5$ !$p*#*t$, 5- * 5(*n? (&n$. T $ &($ &(( 5$ t$#'&n*t$, 5- g? .

OutputF+# $*" p*&# + 5+@@($ 5+*#,!6 +utput *n *(p *5$t&"*((->!+#t$, (&!t + *(( "+''+n +#,!6 $*" +#, +n * !$p*#t $ !t*t$'$nt '4ere are no common words for t4is pair of bo le boards&

S$p*#*t$ t $ +utput +# $*" p*&# + 5+@@($ 5+*#,! &t * 5(*n? (&n$.

33

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 34/499

Sample Input= J J > 6 ; 7' 7 9 > 5 E 'K O M I 6 P 0 M > E K I 5

6 Q ; J 77 N C K 6 L J '

I ' 9 N 6 L P M > K K >

?

Sample Output'4ere are no common words for t4is pair of bo le boards&

6N K6K NN6KK6NN6KN K6K6NK N6

34

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 35/499

Un&)$#!&,*, ,$ Pu$#t+ R&"+ $n B*-*'7nD$p*#t*'$nt+ ,$ C&$n"&*! C+'put*,+#*!

A!+"&*"&7n ,$ E!tu,&*nt$! ,$ C&$n"&*! C+'put*,Categoría Principiante.nstrucciones generales

1. L$* ,$t$n&,*'$nt$ "*,* p#+5($'* - *!&@n$ $( +#,$n u$ p&$n!*n t#*5*0*#(+!.

2. L+! p#+5($'*! !$ ,$5$n $nt#$@*# !$@/n !$ )*n#$!+()&$n,+. N+ $!p$#$ *( &n*(.

3. I,$nt& & u$ $(diskette *!&@n*,+ "+n $( n+'5#$ ,$ !u p*#$0*.

4. A!$@/#$!$ ,$ u$ !$ p+n@* (* $" * $n (* +0* ,$!+(&"&tu, ,$ $)*(u*"&7n ,$( p#+5($'* - $( n+'5#$ p#+@#*'*.

. N: ut&(&"$ (* '&!'* +0* !& )* * )+()$# * !+'$t$#'&!'+ p#+5($'* ,$ nu$)+. U!$ +t#* +0* nu$)*.

:. D$5$ "#$*# - "+'p&(*# (+! p#+@#*'*! $n $(desktop ,$!u "+'put*,+#*. En $(diskette !7(+ )* * &n"(u&# $("7,&@+ ,$( p#+@#*'* u$ )* * !+'$t$#.

. A( &n*( #$"u$#,$ ,$)+()$#($ *( Hu$8 t+,*! (*! +u$ !$ ut&(&8*#+n p*#* !+'$t$# !u! p#+@#*'*!. *-u,* 'u" + *( '+'$nt+ ,$ ,$t$#'&n*# (*! p+!&"&+n$!.

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 36/499

-ines?eeperJ*)$ -+u $)$# p(*-$, M&n$! $$p$#h T &! "ut$ (&tt($ @*'$ "+'$! &t * "$#t*&n +p$#*t&n@ !-!t$' +!$ n*'$

#$'$'5$#. T $ @+*( + t $ @*'$ &! t+ &n, $#$ *(( t $ '&n$! *#$ (+"*t$, &t &n * x % &$(,.

T $ @*'$ ! + ! * nu'5$# &n * ! u*#$ &" t$((! -+u + '*n- '&n$! t $#$ *#$ *,0*"$nt t+ t *! u*#$. E*" ! u*#$ *! *t '+!t $&@ t *,0*"$nt ! u*#$!. T $ 4x 4 &$(, +n t $ ($ t "+nt*&n! t + '&n$$*" #$p#$!$nt$, 5- * gg. " *#*"t$#. I $ #$p#$!$nt t $ !*'$ &$(, 5- t $ &nt nu'5$#! ,$!"#&*5+)$6 $ $n, up &t t $ &$(, +n t $ #&@ t

.&&&&&&&&.&&

&&&&

.1!!221!1.1!111!

Input

T $ &nput &(( "+n!&!t + *n *#5&t#*#- nu'5$# + &$(,!. T $ &#!t (&n$ + $*" &$(, "+nt*&n *n, m < f n6m 1<<% &" !t*n, +# t $ nu'5$# + (&n$! *n, "+(u'n! + t $ &$(,6 #$!p$"t&)$E*" + t $ n$ t n (&n$! "+nt*&n! $ *"t(-m " *#*"t$#!6 #$p#$!$nt&n@ t $ &$(,.

S* $ ! u*#$! *#$ ,$n+t$, 5- gg& *n, '&n$ ! u*#$! 5- gg. 6 5+t &t +ut t $ u+t$!. T $ &#!t &$(, (&$#$ n Xm X < #$p#$!$nt! t $ $n, + &nput *n, ! +u(, n+t 5$ p#+"$!!$,.

Output

F+# $*" &$(,6 p#&nt t $ '$!!*@$Jield ? x : +n * (&n$ *(+n$6 $#$ & !t*n,! +# t $ nu'5$# + t $&$(, !t*#t&n@ #+' 1. T $ n$ tn (&n$! ! +u(, "+nt*&n t $ &$(, &t t $ gg& " *#*"t$#! #$p(*"$, 5- t $nu'5$# + '&n$! *,0*"$nt t+ t *t ! u*#$. T $#$ 'u!t 5$ *n $'pt- (&n$ 5$t $$n &$(, +utput!.

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría P#&n"&p&*nt$ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 1

3:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 37/499

Sample Input (File: mines eeper.in)$ $

.&&&&&&&&.&&&&&&3 "..&&&&&&&&&.&&&! !

Sample Output (File: mines eeper.out)Jield ?1:.1!!221!1.1!111!

Jield ?2:..1!!332!!1e1<<

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 38/499

@$RT U

A "+''+n t-p&n@ $##+# &! t+ p(*"$ -+u# *n,! +n t $ ?$-5+*#, +n$ #+ t+ t $ #&@ t + t $ "+# p+!&t&+n. T $n gg0 &! t-p$, *! gg *n, ggO &! t-p$, *! gg *n, !+ +n. Y+u# t*!? &! t+ ,$"+,$ *'$!!*@$ t-p$, &n t &! '*nn$#.

InputInput "+n!&!t! + !$)$#*( (&n$! + t$ t. E*" (&n$ '*- "+nt*&n ,&@&t!6 !p*"$!6 upp$#"*!$ ($tt$#! $ "$pt gg0 6 gg6 6 gg %6 +# pun"tu*t&+n ! + n *5+)$ Q$ "$pt 5*"?> u+t$ R% . $-! (*5$($, &t +#,! Q'ab 6>ac ;p 6Control 6 $t". *#$ n+t#$p#$!$nt$, &n t $ &nput.

OutputY+u *#$ t+ #$p(*"$ $*" ($tt$# +# pun"tu*t&+n !-'5+( 5- t $ +n$ &''$,&*t$(- t+ &t! ($ t +n t $ KERTY ?$-5+*#, *5+)$. Sp*"$! &n t $ &nput ! +u(, 5$ $" +$, &n t $ +utput.

Sample Input (Screen)K ;, KM5 IPJ;7

Sample Output (Screen)9 6M J9NE 'K=6I

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría P#&n"&p&*nt$ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 2

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 39/499

!C>#isplayE!"#&5* un p#+@#*'* u$ pu$,* '+!t#*# ut&(&8*n,+ "*#*"t$#$!6 (+! ,`@&t+! nu' #&"+! u$ E!t+! ,`@&t+! ,$5$n '+!t#*#!$ $n +#'*t+ LCD !&'&(*# *( u$ 'u$!t#*n (*! "*("u(*,+#*!.

Input

S$ )* * ($$# ,$ un *#" &)+ ,$ )*#&*! (`n$*!. C*,* (`n$* )* * t$n$# ,+! n/'$#+! $nt$#+! !$p*un $!p*"&+. E( p#&'$# ,*t+ !% &n,&"* $( t*'*9+ !&8$% $n $( u$ ,$5$ !$# '+!t#*,+ $( n/'$ s i1<% - $( !$@un,+ ,*t+ n% &n,&"* $( n/'$#+ u$ !$ ,$!$* '+!t#*# < in i 6 6 %. L* /(t&'*(`n$* ,$ ,*t+! )* * t$n$# ,+! "$#+! < <% &n,&"*n,+ u$ n+ *- '_! n/'$#+! p*#* t#*5*0*#.

Output

Mu$!t#$ $n p*nt*((* (+! n/'$#+! $!p$"& &"*,+! $n $( *#" &)+ ,$ &nput $n +#'*t+ LCD ut@u&7n > % p*#* (+! !$@'$nt+! +#&8+nt*($! - $( j % p*#* (+! !$@'$nt+! )$#t&"*($!. C$ *"t*'$nt$ s 2 "+(u'n*! - 2 s 3 &(*!. D$5$ *5$# $ *"t*'$nt$ un* "+(u'n* ,$ 5(*n"+! $nt#$ ",+! ,`@&t+!.

D$5$ *5$# un* (`n$* $n 5(*n"+ $nt#$ "*,* n/'$#+. A "+nt&nu*"&7n !$ 'u$!t#* un $0$'p(+.

Sample Input

(File: LCdispla .in)

2 123$"3 *< B!! !

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría P#&n"&p&*nt$ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 3

3

Sample Output

(File: LCdispla .out) DD DD DD

G G G G G GG G G G G G

DD DD DD DDG G G G G

G G G G G DD DD DD

DDD DDD DDD DDD DDDG G G G G G G GG G G G G G G GG G G G G G G G DDD DDD DDD

G G G G G G G GG G G G G G G GG G G G G G G G DDD DDD DDD DDD

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 40/499

Primary ArithmeticC &(,#$n *#$ t*u@ t t+ *,, 'u(t&>,&@&t nu'5$#! #+' #&@ t t+ ($ t6 +n$ ,&@&t *t * t&'$. Mgg"*##- +p$#*t&+n6 $#$ * 1 &! "*##&$, #+' +n$ ,&@&t p+!&t&+n t+ t $ n$ t6 t+ 5$ * !&" *(($n@$. Y+u# 0+5 &! t+ "+unt t $ nu'5$# + "*##- +p$#*t&+n! +# $*" + * !$t + *,,&t&+!+ t *t $,u"*t+#! '*- *!!$!! t $&# ,& &"u(t-.

InputE*" (&n$ + &nput "+nt*&n! t + un!&@n$, &nt$@$#! ($!! t *n 1< ,&@&t!. T $ (*!t (&n$ + &nput "+nt*&n! gg! ! .

OutputF+# $*" (&n$ + &nput $ "$pt t $ (*!t6 "+'put$ t $ nu'5$# + "*##- +p$#*t&+n! t *t #$!u(t #+' *,,&n@ t $ t + nu'5 p#&nt t $' &n t $ +#'*t ! + n 5$(+ .

Sample Input (File: primar .in)123 $"*""" """123 "B$! !

Sample Output (File: primar .out)No carry operation&3 carry operations&1 carry operation&

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría P#&n"&p&*nt$ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 4

4<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 41/499

Un&)$#!&,*, ,$ Pu$#t+ R&"+ $n B*-*'7nD$p*#t*'$nt+ ,$ C&$n"&*! C+'put*,+#*!

A!+"&*"&7n ,$ E!tu,&*nt$! ,$ C&$n"&*! C+'put*,

Categoría .ntermedio.nstrucciones generales

1. L$* ,$t$n&,*'$nt$ "*,* p#+5($'* - *!&@n$ $( +#,$n u$ p&$n!*n t#*5*0*#(+!.

2. L+! p#+5($'*! !$ ,$5$n $nt#$@*# !$@/n !$ )*n#$!+()&$n,+. N+ $!p$#$ *( &n*(.

3. I,$nt& & u$ $(diskette *!&@n*,+ "+n $( n+'5#$ ,$ !u p*#$0*.

4. A!$@/#$!$ ,$ u$ !$ p+n@* (* $" * $n (* +0* ,$!+(&"&tu, ,$ $)*(u*"&7n ,$( p#+5($'* - $( n+'5#$ p#+@#*'*.

. N: ut&(&"$ (* '&!'* +0* !& )* * )+()$# * !+'$t$#'&!'+ p#+5($'* ,$ nu$)+. U!$ +t#* +0* nu$)*.:. D$5$ "#$*# - "+'p&(*# (+! p#+@#*'*! $n $( ,$!?t+!u "+'put*,+#*. En $( ,&!?$tt$ !7(+ )* * &n"(u&#"7,&@+ ,$( p#+@#*'* u$ )* * !+'$t$#.

. A( &n*( #$"u$#,$ ,$)+()$#($ *( Hu$8 t+,*! (*! +u$ !$ ut&(&8*#+n p*#* !+'$t$# !u! p#+@#*'*!.

*-u,* 'u" + *( '+'$nt+ ,$ ,$t$#'&n*# (*! p+!&"&+n$!.

41

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 42/499

(e)erse an* &**

T $ re'erse and add un"t&+n !t*#t! &t * nu'5$#6 #$)$#!$! &t! ,&@&t! *n, *,,! t $ #$)$#!$ t+ +#&@&n*(. I t $ !u' &! n+t * p*(&n,#+'$ '$*n&n@ &t ,+$! n+t @&)$ t $ !*'$ nu'5$# #$*, #+#&@ t *n, #&@ t t+ ($ t%6 $ #$p$*t t &! p#+"$,u#$ unt&( &t ,+$!.

F+# $ *'p($6 & $ !t*#t &t 1 *! t $ &n&t&*( nu'5$#6 $ @$t 633 *! t $ #$!u(t&n@ p*(&n,#t $ +u#t *,,&t&+n

T &! '$t +, ($*,! t+ p*(&n,#+'$! &n * $ !t$p! +# *('+!t *(( +t $ &nt$@$#!. But t $#$ *#$ &nt$#$!t&n@ $ "$pt&+n!. 1 : &! t $ &#!tnu'5$# +# &" n+ p*(&n,#+'$ *! 5$$n +un,. It *! n$)$# 5$$n p#+)$n6 + $)$#6 t *t n+ !u" p*(&n,#+'$ $ &!t!.

Y+u 'u!t #&t$ * p#+@#*' t *t t*?$! * @&)$n nu'5$# *n, @&)$! t $ #$!u(t&n@ p*(&n,#+'$ &*n, t $ nu'5$# + &t$#*t&+n!b*,,&t&+n! &t t++? t+ &n, &t.

Y+u '*- *!!u'$ t *t *(( t $ nu'5$#! u!$, *! t$!t ,*t* &(( t$#'&n*t$ &n *n *n! $# &t ($!! t *n 16<&t$#*t&+n! *,,&t&+n!%6 *n, -&$(, * p*(&n,#+'$ t *t &! n+t @#$*t$# t *n 462 46 : 62 .InputT $ &#!t (&n$ &(( "+nt*&n *n &nt$@$# % < f % 1<<%6 @&)&n@ t $ nu'5$# + t$!t "*!$!6 &($ t $ n$ t % (&n$! $*" "+nt*&n!&n@($ &nt$@$# +!$ p*(&n,#+'$ -+u *#$ t+ "+'put$.

OutputF+# $*" + t $ % &nt$@$#!6 p#&nt * (&n$ @&)&n@ t $ '&n&'u' nu'5$# + &t$#*t&+n! t+ &n, t $ p*(&n,#+'$6 *t $n t $ #$!u(t&n@ p*(&n,#+'$ &t!$( .

Sample Input (File: reverse.in)31B"2*"<"!

Sample Output (File: reverse.out)$ B33B" $"2"$3 ****

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 1

1 : 164 3 62141 : 36 41 4612

>>> >>> >>> >>>: 164 3 6214 633

42

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 43/499

@here s @aldor7

G&)$n *nm 5- n @#&, + ($tt$#! *n, * (&!t + +#,!6 &n, t $ (+"*t&+n &n t $ @#&, *t &" t $ 5$ +un,.

A +#, '*t" $! * !t#*&@ t6 un&nt$##upt$, (&n$ + ($tt$#! &n t $ @#&,. A +#, "*n '*t" t $ ($tt@#&, #$@*#,($!! + "*!$ &.$.6 upp$#> *n, (+ $#"*!$ ($tt$#! *#$ t+ 5$ t#$*t$, *! t $ !*'$%. T"*n 5$ ,+n$ &n *n- + t $ $&@ t +#&8+nt*(6 )$#t&"*(6 +# ,&*@+n*( ,&#$"t&+n! t #+u@ t

Input

T $ &nput 5$@&n! &t * !&n@($ p+!&t&)$ &nt$@$# +n * (&n$ 5- &t!$( &n,&"*t&n@ t $

+((+ $, 5- * 5(*n? (&n$. T $#$ &! *(!+ * 5(*n? (&n$ 5$t $$n $*" t + "+n!$"ut&)$ "*!$!.

E*" "*!$ 5$@&n! &t * p*&# + &nt$@$#!m +((+ $, 5- n +n * !&n@($ (&n$6 $#$ 1m6n < &n,$"&'*( n+t*t&+n. T $ n$ tm (&n$! "+nt*&nn ($tt$#! $*" 6 #$p#$!$nt&n@ t $ @#&, + ($tt$#! $#$+#,! 'u!t 5$ +un,. T $ ($tt$#! &n t $ @#&, '*- 5$ &n upp$#> +# (+ $#"*!$. F+((+ &n@ t $ @#($tt$#!6 *n+t $# &nt$@$#k *pp$*#! +n * (&n$ 5- &t!$( 1k 2<%. T $ n$ tk (&n$! + &nput "+nt*&n (&!t + +#,! t+ !$*#" +#6 +n$ +#, p$# (&n$. T $!$ +#,! '*- "+nt*&n upp$#> *n, (+ $#"*!$ ($+n(- > n+ !p*"$!6 -p $n!6 +# +t $# n+n>*(p *5$t&" " *#*"t$#!.

Output

F+# $*" +#, &n $*" t$!t "*!$6 +utput * p*&# + &nt$@$#! #$p#$!$nt&n@ &t! (+"*t&+n &@#&,. T $ &nt$@$#! 'u!t 5$ !$p*#*t$, 5- * !&n@($ !p*"$. T $ &#!t &nt$@$# &! t $ (&n$ &&#!t ($tt$# + t $ @&)$n +#, "*n 5$ +un, 1 #$p#$!$nt! t $ t+p'+!t (&n$ &n t $ @#&,6 *n,m #$p#$!$nt!t $ 5+tt+''+!t (&n$%. T $ !$"+n, &nt$@$# &! t $ "+(u'n &n t $ @#&, $#$ t $ &#!t ($tt$# + t+#, "*n 5$ +un, 1 #$p#$!$nt! t $ ($ t'+!t "+(u'n &n t $ @#&,6 *n,n #$p#$!$nt! t $ #&@ t'+!t"+(u'n &n t $ @#&,%. I * +#, "*n 5$ +un, '+#$ t *n +n"$ &n t $ @#&,6 t $n +utput t $ (+"*t&upp$#'+!t +""u##$n"$ + t $ +#, &.$.6 t $ +""u##$n"$ &" p(*"$! t $ &#!t ($tt$# + t $ +#, "t+ t $ t+p + t $ @#&,%. I t + +# '+#$ +#,! *#$ upp$#'+!t6 +utput t $ ($ t'+!t + t $!$ +""u##$nA(( +#,! "*n 5$ +un, *t ($*!t +n"$ &n t $ @#&,.

T $ +utput + t + "+n!$"ut&)$ "*!$! 'u!t 5$ !$p*#*t$, 5- * 5(*n? (&n$.

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 2

43

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 44/499

Sample Input (File: aldorf.in)1

11abc=EJ 4i4Eb al=orJty6waldK5mJtsimr src

byo6r>e=eyvlcb wi omstrE> ad4rby7i lxcn>8f$aldorf>ambi>etty=a bert

Sample Output (File: aldorf.out)2 "2 31 2<

44

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 45/499

0ummation o7 Four PrimesK*#&n@ ! p#&'$ nu'5$# "+n0$"tu#$ !t*t$! t *t $)$#- +,, &nt$@$# &! $&t $# p#&'$ +# t $ !u' p#&'$!. G+(,5*" ! "+n0$"tu#$ &! t *t $)$#- $)$n &nt$@$# &! t $ !u' + t + p#&'$!. B+t p#+5( 5$$n +p$n +# +)$# 2<< -$*#!.

In t &! p#+5($' -+u *)$ * !(&@ t(- ($!! ,$'*n,&n@ t*!?. F&n, * *- t+ $ p#$!! * @&)$n &nt$@!u' + $ *"t(- +u# p#&'$!.

Input

E*" &nput "*!$ "+n!&!t! + +n$ &nt$@$#n n 1<<<<<<<% +n &t! + n (&n$. Input &! t$#'&n*t$, 5&($.

Output

F+# $*" &nput "*!$n6 p#&nt +n$ (&n$ + +utput "+nt*&n&n@ +u# p#&'$ nu'5$#! &" !u' up n. I t $nu'5$# "*nn+t 5$ $ p#$!!$, *! * !u''*t&+n + +u# p#&'$ nu'5$#! p#&nt t $ (&n$ gg9mpossible& &n *!&n@($ (&n$. T $#$ "*n 5$ 'u(t&p($ !+(ut&+n!. An- @++, !+(ut&+n &(( 5$ *""$pt$,.

Sample Input (File: fourprimes.in)2$

3*$*

Sample Output (File: fourprimes.out)3 11 3 <3 < 13 1311 11 1< <

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 3

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 46/499

Ant on a Chessboard

On$ ,*-6 *n *nt n*'$, A(&"$ "*'$ up+n *n x " $!!5+*#,. S $ *nt$, t+ $ p(+#$ *(( t $ "$((! +t $ 5+*#,. S+ ! $ 5$@*n t+ *(? *(+n@ t $ 5+*#, 5- p$$(&n@ + * "+#n$# + t $ 5+*#,.

A(&"$ !t*#t$, *t ! u*#$ 16 1%. F&#!t6 ! $ $nt up +# * !t$p6 t $n * !t$p t+ t $ #&@ t6 *n, * !t,+ n *#,. A t$# t *t6 ! $ $nt * !t$p t+ t $ #&@ t6 t $n t + !t$p! up *#,6 *n, t $n t + @#&,! t+ t $($ t. In $*" #+un,6 ! $ *,,$, +n$ n$ #+ *n, +n$ n$ "+(u'n t+ t $ "+#n$# ! $ *, $ p(+#$,.

F+# $ *'p($6 $# &#!t 2 !t$p! $nt (&?$ t &!6 $#$ t $ nu'5$#! &n $*" ! u*#$ ,$n+t$ +n &" ! $ )&!&t$, &t.

2 24 23 22 21

1< 11 12 13 2< 14 12 3 : 1 11 4 1: 1

J$# t !t$p put $# +n ! u*#$ 26 3%6 &($ $# 2<t !t$p put $# +n ! u*#$ 6 4%. Y+u# t*!? &,$"&,$ $#$ ! $ *! *t * @&)$n t&'$6 *!!u'&n@ t $ " $!!5+*#, &! (*#@$ $n+u@ t+ *""$pt *(('+)$'$nt!.Input

T $ &nput &($ &(( "+nt*&n !$)$#*( (&n$!6 $*" &t *n &nt$@$# % ,$n+t&n@ t $ !t$p nu'5$# $#$ 1 % 2 x 1<. T $ &($&(( t$#'&n*t$ &t * (&n$ t *t "+nt*&n! t $ nu'5$#! .

OutputF+# $*" &nput !&tu*t&+n6 p#&nt * (&n$ &t t + nu'5$#! &6 y% ,$n+t&n@ t $ "+(u'n *n, t $ #+ nu'5$##$!p$"t&)$(-. T $#$ 'u!t 5$ * !&n@($ !p*"$ 5$t $$n t $'.Sample Input (File: ant.in)

2!2"!

Sample Output (File: ant.out)2 3" $1 "

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 4

4:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 47/499

Un&)$#!&,*, ,$ Pu$#t+ R&"+ $n B*-*'7nD$p*#t*'$nt+ ,$ C&$n"&*! C+'put*,+#*!

A!+"&*"&7n ,$ E!tu,&*nt$! ,$ C&$n"&*! C+'put*,

Categoría $5perto.nstrucciones generales

1. L$* ,$t$n&,*'$nt$ "*,* p#+5($'* - *!&@n$ $( +#,$n u$ p&$n!*n t#*5*0*#(+!.

2. L+! p#+5($'*! !$ ,$5$n $nt#$@*# !$@/n !$ )*n#$!+()&$n,+. N+ $!p$#$ *( &n*(.

3. I,$nt& & u$ $(diskette *!&@n*,+ "+n $( n+'5#$ ,$ !u p*#$0*.

4. A!$@/#$!$ ,$ u$ !$ p+n@* (* $" * $n (* +0* ,$!+(&"&tu, ,$ $)*(u*"&7n ,$( p#+5($'* - $( n+'5#$ p#+@#*'*.

. N: ut&(&"$ (* '&!'* +0* !& )* * )+()$# * !+'$t$#'&!'+ p#+5($'* ,$ nu$)+. U!$ +t#* +0* nu$)*.:. D$5$ "#$*# - "+'p&(*# (+! p#+@#*'*! $n $( ,$!?t+!u "+'put*,+#*. En $( ,&!?$tt$ !7(+ )* * &n"(u&#"7,&@+ ,$( p#+@#*'* u$ )* * !+'$t$#.

. A( &n*( #$"u$#,$ ,$)+()$#($ *( Hu$8 t+,*! (*! +u$ !$ ut&(&8*#+n p*#* !+'$t$# !u! p#+@#*'*!.

*-u,* 'u" + *( '+'$nt+ ,$ ,$t$#'&n*# (*! p+!&"&+n$!.

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 48/499

FmtT $ UNI; p#+@#*' fmt #$*,! (&n$! + t$ t6 "+'5&n&n@ *n, 5#$*?&n@ t $' !+ *! t+ "#$*t$ *n +&t (&n$! *! "(+!$ t+ 2 " *#*"t$#! (+n@ *! p+!!&5($ &t +ut $ "$$,&n@ t &! (&'&t. T $ #u($"+'5&n&n@ *n, 5#$*?&n@ (&n$! *#$ *! +((+ !

• A n$ (&n$ '*- 5$ !t*#t$, *n- $#$ t $#$ &! * !p*"$ &n t $ &nput. K $n * n$ (&n$ &! !t*#t$,6 5(*n?! *t t $t $ p#$)&+u! (&n$ *n, *t t $ 5$@&nn&n@ + t $ n$ (&n$ *#$ $(&'&n*t$,.

• A (&n$ 5#$*? &n t $ &nput '*- 5$ $(&'&n*t$, &n t $ +utput un($!! 1% &t &! *t t $ $n, + * 5(*n? +# $'pt&t &! +((+ $, 5- * !p*"$ +# *n+t $# (&n$ 5#$*?. K $n * (&n$ 5#$*? &! $(&'&n*t$,6 &t &! #$p(*"$, 5- *

• Sp*"$! 'u!t 5$ #$'+)$, #+' t $ $n, + $*" +utput (&n$.• An- &nput +#, "+nt*&n&n@ '+#$ t *n 2 " *#*"t$#! 'u!t *pp$*# +n *n +utput (&n$ 5- &t!$( .

Y+u '*- *!!u'$ t *t t $ &nput t$ t ,+$! n+t "+nt*&n *n- t*55&n@ " *#*"t$#!.

Sample Input (File: fmt.in) 7nix fmt

'4e unix fmt pro ram reads lines of text, combininand brea in lines so as to create anoutput file wit4 lines as close to wit4out exceedin<2 c4aracters lon as possible& '4e rules for combinin and brea inlines are as follows&

1& 6 new line may be started anyw4ere t4ere is a space in t4e input&9f a new line is started, t4ere will be no trailin blan s at t4eend of t4e previous line or at t4e be innin of t4e new line&

2& 6 line brea in t4e input may be eliminated in t4e output, providedit is not followed by a space or anot4er line brea & 9f a linebrea is eliminated, it is replaced by a space&

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría E;PERTO Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 1

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 49/499

Sample Output (File: fmt.out) 7nix fmt

'4e unix fmt pro ram reads lines of text, combinin and brea in linesso as to create an output file wit4 lines as close to wit4out exceedin<2 c4aracters lon as possible& '4e rules for combinin and brea inlines are as follows&

1& 6 new line may be started anyw4ere t4ere is a space in t4e input&9f a new line is started, t4ere will be no trailin blan s at t4e end oft4e previous line or at t4e be innin of t4e new line&

2& 6 line brea in t4e input may be eliminated in t4e output,provided it is not followed by a space or anot4er line brea & 9f a linebrea is eliminated, it is replaced by a space&

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 50/499

Calculator !anguage

C*("u(*t+# L*n@u*@$ CL% !upp+#t! *!!&@n'$nt6 p+!&t&)$ *n, n$@*t&)$ &nt$@$#! *n,T $ *((+ *5($ " *#*"t$#! &n * CL !t*t$'$nt *#$ t u!

A(( +p$#*t+#! *)$ t $ !*'$ p#$"$,$n"$ *n, *#$ #&@ t *!!+"&*t&)$6 t u! 1 > > 3 X 1 > > 3+n$ +u(, $ p$"t6 5#*"?$t! &(( +#"$ t $ $ p#$!!&+n &t &n t $' t+ 5$ $)*(u*t$, &#!t. B#*"?$t 5$ n$!t$, *#5&t#*#&(- ,$$p(-. An $ p#$!!&+n n$)$# *! t + +p$#*t+#! n$ t t+ $*" +t $# $)$n!$p*#*t$, 5- * 5#*"?$t%6 *n *!!&@n'$nt +p$#*t+# &! *( *-! &''$,&*t$(- p#$"$,$, 5- * )*#&*($ t'+!t +p$#*t+# +n * (&n$ &! *( *-! *n *!!&@n'$nt. F+# #$*,*5&(&t-6 !p*"$! '*- 5$ #$$(- &*n $ p#$!!&+n6 $ "$pt 5$t $$n * n$@*t&)$ !&@n *n, * nu'5$#. A n$@*t&)$ !&@n &(( n+t )*#&*5($. A(( )*#&*5($! *#$ &n&t&*(&!$, t+ 8$#+ <% *n, #$t*&n t $&# )*(u$! unt&( " *n

K#&t$ * p#+@#*' t *t &(( *""$pt *n, $)*(u*t$ $ p#$!!&+n! #&tt$n &n t &! (*n@u*@$. E*"+""up&$! +n$ (&n$ *n, "+nt*&n! *t ($*!t +n$ *!!&@n'$nt +p$#*t+#6 *n, '*-5$ '+#$.

Input

Input &(( "+n!&!t + * !$#&$! + (&n$!6 $*" (&n$ "+nt*&n&n@ * "+##$"t CL $ p#$!!&+n. (+n@$# t *n 1<< " *#*"t$#!. T $ &($ &(( 5$ t$#'&n*t$, 5- * (&n$ "+n!&!t&n@ + * !&n@($? .

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría E;PERTO Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 2

<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 51/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 52/499

Chec3 the Chec3 Y+u# t*!? &! t+ #&t$ * p#+@#*' t *t #$*,! * " $!!5+*#, "+n &@u#*t&+n *n, &,$nt& &$! $tun,$# *tt*"? &n " $"?%. A ?&n@ &! &n " $"? & &t &! +n ! u*#$ &" "*n 5$ t*?$n 5- t $ +pn$ t '+)$.

K &t$ p&$"$! &(( 5$ #$p#$!$nt$, 5- upp$#"*!$ ($tt$#!6 *n, 5(*"? p&$"$! 5- (+ $#"*!$ ($tt$#!&,$ &(( *( *-! 5$ +n t $ 5+tt+' + t $ 5+*#,6 &t t $ 5(*"? !&,$ *( *-! +n t $ t+p.

F+# t +!$ un *'&(&*# &t " $!!6 $#$ *#$ t $ '+)$'$nt! + $*" p&$"$

Pa?n 2 p or +6( "*n +n(- '+)$ !t#*&@ t * $*,6 +n$ ! u*#$ *t * t&'$. J+ $)$#6 &t t*?$! p&$"$! ,&*@+n*((-6 *n, t *t &! *-+u &n t &! p#+5($'.

Dnight 2n or , 6 *! *n L>! *p$, '+)$'$nt ! + n 5$(+ . It &! t $ +n(- p&$"$ t *t "*n 0u'p +)$# +t $# p&$"$!.

Bishop 2 b or 6 "*n '+)$ *n- nu'5$# + ! u*#$! ,&*@+n*((-6 $&t $# +# *#, +# 5*"? *#,.

Roo3 2r or ( 6 "*n '+)$ *n- nu'5$# + ! u*#$! )$#t&"*((- +# +#&8+nt*((-6 $&t $# +# *#, +# 5*"? *#,.

Eueen 2% or 6 "*n '+)$ *n- nu'5$# + ! u*#$! &n *n- ,&#$"t&+n ,&*@+n*((-6 +#&8+nt*((-6 +# )$#t&"*((-% $&t $#

5*"? *#,.

Ding 2k or 6 "*n '+)$ +n$ ! u*#$ *t * t&'$ &n *n- ,&#$"t&+n ,&*@+n*((-6 +#&8+nt*((-6 +# )$#t&"*((-% $&t $# + 5*"? *#,.

M+)$'$nt $ *'p($! *#$ ! + n 5$(+ 6 $#$ gg . &n,&"*t$! t $ p+!&t&+n! $#$ t $ p&$"$

"*n "*ptu#$ *n+t $# p&$"$

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría E;PERTO Universidad UPR> B*-*'7nAutor ACM Tipo de Competencia P#+@#*'*"&7nProblema 3

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 53/499

Pawn 5oo >is4op 0ueen in ni 4t &&&&&&&& &&&.&&&& &&&&&&&. &&&.&&&. &&&&&&&& &&&&&&&& &&&&&&&& &&&.&&&& .&&&&&.& .&&.&&.& &&&&&&&& &&&&&&&& &&&&&&&& &&&.&&&& &.&&&.&& &.&.&.&& &&&&&&&& &&.&.&&& &&&&&&&& &&&.&&&& &&.&.&&& &&...&&& &&...&&& &.&&&.&& &&&p&&&& ...r.... &&&b&&&& ... .... &&. .&&& &&&n&&&& &&.&.&&& &&&.&&&& &&.&.&&& &&...&&& &&...&&& &.&&&.&& &&&&&&&& &&&.&&&& &.&&&.&& &.&.&.&& &&&&&&&& &&.&.&&& &&&&&&&& &&&.&&&& .&&&&&.& .&&.&&.& &&&&&&&& &&&&&&&&

R$'$'5$# t *t t $ ?n&@ t &! t $ +n(- p&$"$ t *t "*n 0u'p +)$# +t $# p&$"$!. T $ p* n '+)$'$nt &,$p$n, +n &t! !&,$. I &t &! * 5(*"? p* n6 &t "*n +n(- '+)$ +n$ ! u*#$ ,&*@+n*((- ,+ n t $ 5+* &t$ p* n6 &t "*n +n(- '+)$ +n$ ! u*#$ ,&*@+n*((- up t $ 5+*#,. T $ $ *'p($ *5+)$ &! * 5(* p* n6 ,$!"#&5$, 5- * (+ $#"*!$ ggp . K$ u!$ ggmo'e t+ &n,&"*t$ t $ ! u*#$! $#$ t $ p* n "*n"*ptu#$ *n+t $# p&$"$.

Input

T $#$ &(( 5$ *n *#5&t#*#- nu'5$# + 5+*#, "+n &@u#*t&+n! &n t $ &nput6 $*" "+n!&!t&n$&@ t " *#*"t$#! $*" . A gg& ,$n+t$! *n $'pt- ! u*#$6 &($ upp$#> *n, (+ $#"*!$ ($tt$#! #$p#$!$ p&$"$! *! ,$ &n$, *5+)$. T $#$ &(( 5$ n+ &n)*(&, " *#*"t$#! *n, n+ "+n &@u#*t&+n! $#$*#$ &n " $"?. Y+u 'u!t #$*, unt&( -+u &n, *n $'pt- 5+*#, "+n!&!t&n@ +n(- + gg& " *#*"t$#!6 &"! +u(, n+t 5$ p#+"$!!$,. T $#$ &(( 5$ *n $'pt- (&n$ 5$t $$n $*" p*&# + 5+*#, "+n &@u#*t& 5+*#,!6 $ "$pt +# t $ $'pt- +n$6 &(( "+nt*&n $ *"t(- +n$ &t$ ?&n@ *n, +n$ 5(*"? ?&n@.

Output

F+# $*" 5+*#, "+n &@u#*t&+n #$*, -+u 'u!t +utput +n$ + t $ +((+ &n@ *n! $#!

ame ? d : w4ite in is in c4ec &

ame ? d : blac in is in c4ec &

ame ? d : no in is in c4ec &

$#$ d !t*n,! +# t $ @*'$ nu'5$# !t*#t&n@ #+' 1.

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 54/499

Sample Input (File: c*ec$.in)&& &&&&&ppp&pppp

&&&&&&&&&5&&&>&&&&&&&&&&&&&&&&&&PPPPPPPP&&&&&&&

rnb &nrppp&&ppp&&&&p&&&&&&p&&&&&bPP&&&&&&&&&N&&PP&&PPPP5N>0 >&5

&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&

Sample Output (File: c*ec$.out)ame ?1: blac in is in c4ec &ame ?2: w4ite in is in c4ec &

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 55/499

0E! 0.-U!AT:R N+ "#$+ u$ t$n@* u$ $ p(&"*# * $!t$ n&)$( (+ u$ $! S L - !u u!+ $n (*! B*!$! ,$ D*t+!. V*"#$*# un !&'u(*,+# ,$( "+'*n,+ SELECT ,$ un* *p(&"*"&7n ,$ B*!$ ,$ D*t+! "+'+ (+ $! O#*"$0$'p(+. E( +#'*t+ ,$( SELECT !$n"&((+ u$ )*'+! * ut&(&8*# p*#* "#$*# $!t* !&'u(*"&7n!&@u&$nt$

" atributos( M entidad

7 ( condici@n( ( atributoT

S7(+ )*'+! * t#*5*0*# "+n un* t*5(* - (*! p+!&5($! "+'5&n*"&+n$! !+n (*! !&@u&$nt$!

'. "

0$!$CT e0$!$CT *t#&5ut+l1

0$!$CT *t#&5ut+l16 *t#&5ut+l26 *t#&5ut+ln

''. ( M

FR:- $nt&,*,

'''. 7 (

@;$R$ *t#&5ut+ m X j Zj f j ZX j fX j WX m "+n!t*nt$ j !t#&n@ QmAND j OR "+n,&t

':. ( ( :R#$R B *t#&5ut+ QASC j DESC a

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría E;PERTO Universidad UPR> B*-*'7nAutor N$((&u, D. T+##$! Tipo de Competencia P#+@#*'*"&7nProblema 4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 56/499

InputL* t*5(* !$ )* * "*#@*# ,$ un *#" &)+ !$"u$n"&*( - )* * t$n$# $( !&@u&$nt$ +#'*t+

nombre de la tabla

atributoS1, atributoS2,U atributoSn

tipo de datoD1, tipo de datoD2, U tipo de datoDn

valorS1, valorS2,U valorSn,

! !

1. En (* p#&'$#* (`n$* )* * $!t*# $( n+'5#$ ,$ (* t*5(* !&n $!p*"&+! $n 5(*n"+.

2. L* !$@un,* (`n$* $!t*#_ $n 5(*n"+.

3. L* t$#"$#* (`n$* )* * t$n$# (+! n+'5#$! ,$ (+! *t#&5ut+!.

4. L* "u*#t* (̀ n$* $!t*#_ $n 5(*n"+.

"& L* u&nt* (`n$* )* * &n,&"*# $( t&p+ ,$ ,*t+. ; X *( *nu' #&"+ strin# %6 X nu' #&"+ $nt$#+6

X nu' #&"+ #$*(

:. L* !$ t* (`n$* $!t*#_ $n 5(*n"+.

. D$ (* ! pt&'* (`n$* $n *,$(*nt$ !$ $n"u$nt#*n (+! ,*t+!.

. L* /(t&'* (`n$* )* * t$n$# ,+! "$#+! <% !$p*#*,+! p+# un $!p*"&+ $n 5(*n"+. E!t+ n+

&n,&"*# u$ $! $( &n*( ,$ (* t*5(*.

L+! "+'*n,+! ,$ S L !$ p&,$n p+# p*nt*((*. Pu$,$n t$n$# '_! ,$ un* (̀ n$* - n+ !$ pu$,$0$"ut*# *!t* $n"+nt#*# $( punt+ - "+'* a%. S$ t&$n$ u$ )*(&,*# (*! !&nt* &! ,$ (*! &n!t#n+'5#$! ,$ (+! *t#&5ut+! - t*5(*. E( #$!u(t*,+ !$ 'u$!t#* &nt$#*"t&)*'$nt$ $n p*nt*((*.

OutputS$ )* * '+!t#*# (+! #$!u(t*,+! ,$( S L $n p*nt*((*. T*'5& n ,$5$n !*(&# (+! '$n!*0$! ,$ $##+#$n"*5$8*'&$nt+! u$ !$ )*n * '+!t#*# $n (+! $0$'p(+!.

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 57/499

Sample Input (File: s+l.in)estudiante

nombre, numeroSestudiante, edad, enero, promedio

x, x, B, x, v

acarias Piedras =el 5io, 123D$"D*< B, 1B, M, 3&3$Pepito ;anto Cielo, B <D*"D$321, 22, M, 2& 1Ouana a oca, 1*3D$"D< 23, 21, J, $&!!Oose 9van 6lcara, B$"D23D$"*2, 1<, M, 1&*BMin uita omeH, "2<D 3D"B12, 2 , J, 2&"$! !

Sample Output (Screen)

; ;E EC' . J5KM estudianteT

; ;E EC' nombre, edad, enero J5KM estudianteT

; ;E EC' nombre, edd, enero; J5KM estudianteT

... 6tributo invalido VeddW ...

nombre numeroSestudiante edad enero promedio DDDDDDDD DDDDDDDDDDDDDDDDD DDDD DDDDDD DDDDDDDDacarias Piedras =el 5io 123D$"D*< B 1B M 3&3$Pepito ;anto Cielo B <D*"D$321 22 M 2& 1Ouana a oca 1*3D$"D< 23 21 J $&!!Oose 9van 6lcara B$"D23D$"*2 1< M 1&*BMin uita omeH "2<D 3D"B12 2 J 2&"$

nombre edad eneroDDDDDDDD DDDD DDDDDD

acarias Piedras =el 5io 1B MPepito ;anto Cielo 22 MOuana a oca 21 JOose 9van 6lcara 1< MMin uita omeH 2 J

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 58/499

; ;E EC' nombre, edad, enero; J5KM estudiant; T

... 'abla invalida VestudiantW ...

; ;E EC' nombre, edad, enero J5KM estudiante; LE5E edad W% 21T

; ;E EC' nombre, edad, enero J5KM estudiante; LE5E edad W% 21; K5=E5 >I nombre 6;CT

; ;E EC' nombre, promedio J5KM estudiante; K5=E5 >I promedio 6;CT

nombre edad eneroDDDDDDDD DDDD DDDDDD

Pepito ;anto Cielo 22 MOuana a oca 21 JMin uita omeH 2 J

nombre edad eneroDDDDDDDD DDDD DDDDDD

Ouana a oca 21 JMin uita omeH 2 JP$p&t+ S*nt+ C&$(+ 22 M

nombre promedio DDDDDDDD DDDDDDDDOose 9van 6lcara 1&*B

Min uita omeH 2&"$Pepito ;anto Cielo 2& 1acarias Piedras =el 5io 3&3$Ouana a oca $&!!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 59/499

Impor!ador de da!o" de"de CO#O$ alSolon Da!aba"e Managemen! S%"!em &SD#MS'

S$ ($ * $n"+'$n,*,+ (* t*#$* ,$ "+n!t#u&# un p#+@#*'* u$ &'p+#t$ ,*t+! ,$ un !&!t$'* ,$ *#" &)+!le#acy '*n$0*,+ p+#COBOL * un !&!t$'* ,$ 5*!$ ,$ ,*t+! ((*'*,+ SDBM>>>>>>>>>>>>>>>>>>>>>S. E( p#+@#*'* u$ &'p+#t* (+!$nt#*,* un *#" &)+ $n ;ML ,$ (* !&@u&$nt$ '*n$#*

V xml versi@n%X!&!1alp4aX encodin %X7'JD X WV;c4emaDJormatWV6lp4anumericW3!VA6lp4anumericWVNumberW VANumberWVNumberW &2VANumberWV=ateWyyyymmddVA=ateWVA;c4emaDJormatWVAxmlW

SDBMS !+(+ '*n$0* 3 t&p+! ,$ ,*t+! 1% A( *nu' #&"+6 2% N/'$#+! - 3% F$" *!. N+t$ u$ $nt#$'$,&+ ,$ (*! $tta#s % ,$ ;ML !$ $n"u$nt#* (+!descriptores ,$ (+! t&p+! ,$ ,*t+!.

A( *nu' #&"+ !+(+ pu$,$ (($)*# un n/'$#+ $nt$#+ $nt#$ *'5*! $t& u$t*! - $!t$ n/'$#+ &n,&"* (* "*nt&,*, ,$ $!p*"SDBMS $!p$#* @u*#,*# $n (* 5*!$ ,$ ,*t+! F*)+# )$# $( $0$'p(+%. S& $( *#" &)+ u$ !$ &'p+#t* ,$ COBOL t$( n/'$#+ &n,&"*,+ $!t+! "*#*"t$#$! n+ !$ ($$n6 $! ,$"&#6 !+(+ !$ @u*#,*n (+! "*#*"t$#$! &n,&"*,+! $n (* 5*!!&!t$'* ,$5$ #$p+#t*# (* "*nt&,*, ,$ "*#*"t$#$! u$ n+ &n"(u-+ $n (* &'p+#t*"&7n.

L* $t& u$t* p*#* $( n/'$#+ !+(+ (($)* $nt#$'$,&+ un )*(+# u$ &n,&"* (* "*nt&,*, ,$ $!p*"&+! #$!$#)*,+! p*#*

)*(+# nu' #&"+. En $( $0$'p(+ fNu'5$#Z fbNu'5$#Z !&@n& &"* un $nt$#+ ,$ un '_ &'+ ,$ $!p*"&+!.fNu'5$#Z .2fbNu'5$#Z !&@n& &"* un n/'$#+ #$*( "+n un '_ &'+ ,$ $!p*"&+! - 2 ,$"&'*($!.#e encontrar un valorno num rico donde se supone Gue e5ista uno el sistema emitir* un errorHE( $!p*"&+ '_ &'+ u$ pu$,$ *5$##$!$#)*,+ !+n 12 $!p*"&+! p*#* (+! $nt$#+! - : p*#* (+! ,$"&'*($!. D$ *5$#!$ !+5#$p*!*,+ ,$ $!t+! (&'&t$! $( !&n,&"*#* $( !&@u&$nt$ '$n!*0$ [V*(+# nu' #&"+ u$#* ,$ +#'*t+\.

L*! $" *! !$ ($$n0.$-PR$ "+n $( *9+ p#&'$#+ !$@u&,+ p+# $( n/'$#+ ,$( '$! - &n*('$nt$ "+n $( nu'$#+ ,$ ,`*. P$0$'p(+ 2<< <411 $! (* $" * <4b11b2<< . E( !&!t$'* ,$5$ )*(&,*# u$ (* $nt#*,* ,$ (* $" * !$* "+##$"t*. SDBMun"&+n* "+n un* )$nt*n* ,$ $" *! "+n *9+! ,$!,$ 1 = 2< 4. L+! )*(+#$! p*#* (+! '$!$! !+n $nt$#+! p+!&t&)+!

m 1* . L+! ,`*! !+n $nt$#+! p+!&t&)+! ,+n,$n *+ $ "$pt+ p*#* $( '$! ,$ $5#$#+.No se preocupe por validar aIosbisiestosJ P$R: recuerde Gue hay meses de =KJ 'L o =& días4 D$ *5$# $##+# $n $( +#'*t+ ,$ $nt#*,* p*#* (* $" * ,$ &n,&"*#en donde $ &!t$ $( $##+# ,$ $nt#*,*.$%emplo de un mensa%e [En (* $" * <2b33b2<< $ &!t$ un $##+# $n $(,$( '$!\.

Fecha b'*-b2<< Nombre de la competencia S$ t*! C+'p$t$n"&*!Categoría E;PERTO Universidad UPR> B*-*'7nAutor Hu*n S+(_ S(+*n Tipo de Competencia P#+@#*'*"&7nProblema

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 60/499

:8:( FA/:R #$ N:-BRAR $! ARC;./: C:N $0T$ N:-BR$( SDBMS>IN.T;T

Sample Input (File: S ,-S IN./0/)$%emplo de entrada de un archivo(

V xml versi@n%X!&!1alp4aX encodin %X7'JD X WV;c4ema JormatWV6lp4anumericW1!VA6lp4anumericWVNumberW"&2VANumberWV=ateWyyyymmddVA=ateWV6lp4anumericW1VA6lp4anumericWVA;c4ema JormatWVAxmlW< VD Cantidad de recordsManc4e o,123$"&*<,1BB"!11*,El 4ombre de cemento,<*"$3&21,1B !123,BMordor,M1"&32,2!!"12!1,J

MC !$ <,!&"1,1B !2!<,6'rinity,*&*<,21!"!2!1,6;aruman,123.&! ,1B 33!1,andalf,2!!&!!,1BB211!3,'4e 4ite iHard

Sample Output (File: S ,-S O1/./0/)E( !&!t$'* ,$5$ &'p#&'&# un* (&!t* ,$5$ ($$# $( *#" &)+ ,$ $nt#*,* - (u$@+ @$n$#*# $( !&@u&$nt$output

5e istro 1: 9mportado sin errores&5e istro 2: 9mportado sin incluir 1! caracteres alfanumYricos parael campo 1&5e istro 3: Error: Car)cter no permitido en campo numYrico5e istro $: 9mportado sin errores5e istro ": Error: En la fec4a !2A!1A21!" existe un error en el a o5e istro *: Error: Car)cter no permitido en campo numYrico& En lafec4a 33A!1A1B existe un error en el valor del mes&5e istro <: 9mportado sin incluir 1" caracteres del valoralfanumYrico para el campo $&

:<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 61/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Euintas Competencias de Programación'KK+

23perto

:1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 62/499

Fecha 24b*5#&(b2<<4Categoría E p$#t+Autor 3* COMPETENCIA IBEROAMERICANA DE

INFORM TICA

Problema 1

Nombre de la competencia u&nt*!C+'p$t$n"&*!Universidad UPR = B*-*'7nTipo de competencia P#+@#*'*"&7n

ENCA(AR.nput File Name( $NCA8AR4.N:utput File Name( MpantallaNarrativaEn un t*(($# $( +#,$n $! 'u- &'p+#t*nt$ -* u$ $! &n,&!p$n!*5($ t$n$# +#@*n&8*,*! t+,*! (*! $##*'&*"&(&t*# !u u5&"*"&7n. P$n!*n,+ $n $!t+ !$ * "+(@*,+ un t*5($#+ $n (* p*#$, !+5#$ $( "u*( !$ "+,$ (*! $##*'&$nt*!. Aun u$ $! un* 5u$n* !+(u"&7n6 !$ *"$ p#+5($'_t&"+ *@#$@*# nu$)*! $##*'&t*5($#+ "u*n,+ -* n+ u$,* 'u" + $!p*"&+ (&5#$.

En 5u!"* ,$ un* !+(u"&7n * $!t$ p#+5($'* !$ *n $!"*n$*,+ $n 5(*n"+ - n$@#+ $( t*5($#+ - (* $##*'&,$!$* "+(@*#. E( $!"*n$+ !$ "+'p+n$ ,$ un *##$@(+ ,$ 8+n*! "u*,#*,*! $n (*! "u*($! un* [;\ &n,&"* u"u5&$#t* p+# un* $##*'&$nt* - un punt+ .% un* 8+n* (&5#$. P+# $0$'p(+6 (* +#'* - $!"*n$+ ,$ un

###

###

&#&

&

#& &#&

L* nu$)* $##*'&$nt* !$#_ '*"&8*6 (+ u$ !&@n& &"* u$ t+,+! !u! punt+! !+n *,-*"$nt$! $nt#$ !` "+*( '$n+! un ) #t&"$%. A,$'_! $n !u $!"*n$+ !$ *n $(&'&n*,+ &(*! - "+(u'n*! )*"`*!.ProblemaS$ ,$!$* u$ u!t$, $(*5+#$ un p#+@#*'* u$ !+(u"&+n$ *ut+'_t&"*'$nt$ $!t$ p#+5($'* t$n&$n,+ "+'+ $(+! $!"*n$+! ,$( t*5($#+ ,$ $##*'&$nt*! - ,$ (* nu$)* $##*'&$nt* u$ !$ u&$#$ "+(@*#. D$5$ t+'*# u$ (* nu$)* $##*'&$nt* !7(+ pu$,$ !$# #+t*,* $n _n@u(+! '/(t&p(+! ,$ <o6 p+# (+ u$ !7(+ *5#_n "u+#'*! p+!&5($! ,$ u5&"*# (* $##*'&$nt* ,$nt#+ ,$( t*5($#+6 ,$!&@n*,*! "+n (+! "7,&@+! Q<..3

< PARA<

1 PARA<o

2 PARA1 <

PAR2 <

:2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 63/499

L* nu$)* $##*'&$nt* ,$5$ +"up*# un* 8+n* ,$( t*5($#+ t*( u$ n+ ut&(&"$ 8+n*! -* +"up*,*! p+# +t#$##*'&$nt*! n+ p+,#`* "+(@*#!$%.

$ntrada ENCAHAR.IN

E!t$ *#" &)+ "+nt&$n$ &n +#'*"&7n u$ #$p#$!$nt* $( $!"*n$+ ,$( t*5($#+ - ,$ (* $##*'&$nt*.

!ínea &( t "t 1fX t6 "t fX2<<%. N/'$#+ ,$ &(*! - "+(u'n*! ,$( $!"*n$+ ,$( t*5($#+.

!ínea( 2.. t 1 Un* "*,$n* ,$ "t "*#*"t$#$! Q ;d6d.d #$p#$!$nt*n,+ un* (`n$* ,$( $!"*n$+.

!ínea( t 2 6 " 1fX 6 "fX1<<%. N/'$#+ ,$ &(*! - "+(u'n*! ,$( $!"*n$+ ,$ (* $##*'&$nt*.

!íneas( t 3.. t 2 Un* "*,$n* ,$ " "*#*"t$#$! Q ;d6d.d #$p#$!$nt*n,+ un* (`n$* ,$( $!"*n$+.

0alida( ENCAHAR.OUT

!ínea &( f, c. L*! "++#,$n*,*! ,$ (* p+!&"&7n ,$ (* $! u&n* !up$#&+# &8 u&$#,* ,$ (* $##*'&$nt* ,t*5($#+. E!t$ punt+ "+&n"&,$ "+n (* p+!&"&7n 16 1% ,$( $!"*n$+ ,$ (* $##*'&$nt*.

!ínea '( E( "7,&@+ ,$ (* +#'* $n u$ !$ "+(+"*#_ (* &@u#*6 ,$ *"u$#,+ * (+ ,$!"#&t+ *nt$#&+#>'$'_! ,$ un* !*(&,* )_(&,* p*#* un* $nt#*,*6 u!t$, ,$5$ #$p+#t*# !7(+ un* ,$ $((*!. S& n+ $! p+!&5($ unu$)* $##*'&$nt*6 $( *#" &)+ ,$ !*(&,* ,$5$ "+nt$n$# $( '$n!*0$ [N+ *- !+(u"&7n\.

!ínea = en adelante( E( ,&5u0+ ,$( t*5($#+ &n"(u-$n,+ (* $##*'&$nt* nu$)*. S$ ut&(&8*#_ $( *!t$#&&n,&"*# $n ,+n,$ $!t_ (* nu$)* $##*'&$nt*.

$%emplo,"&<

&(. ,,"&<

&(. &

"1!

3$

###U&&#&

3

#U###&#&

###U&&#&

###U&&#&

#UU&#&

#U###&#&

#U

&&#U

###..

U#&"3

#&&.....#&

### #&&..&#U

###&#&&#&&#&

:3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 64/499

DIAGRAMA VISUAL DE LA NUEVA JERRAMIENTA EN EL TABLERO

1 2 3 $ " * < B !123

$"

:4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 65/499

Fecha( 24<*5#&(<2<<4Catgoría( E p$#t+Autor( ACM Int$#n*t&+n*( C+(($@&*t$Problema 2

Nombre de la competencia( u&nt*!"+'p$t$n"&*!Universidad( UPR = B*-*'7nTipo de competencia( P#+@#*'*"&7n

Mor"e Mi"ma!c e"

.nput File Name( '+#!$.&n

S*'u$( F. B. M+#!$ &! 5$!t ?n+ n +# t $ "+,&n@ !" $'$ t *t "*##&$! &! n*'$. M+#!$ "+,$ &!u!$, &n &nt$#n*t&+n*( #*,&+ "+''un&"*t&+n. T $ "+,&n@ + t$ t u!&n@ M+#!$ "+,$ &! !tE*" " *#*"t$# "*!$ &! &n!&@n& &"*nt% &! t#*n!(*t$, t+ * p#$,$ &n$, !$ u$n"$ +dits *n, dahs t $$($'$nt! + M+#!$ "+,$%. D&t! *#$ #$p#$!$nt$, *! p$#&+,! [.\% *n, ,* ! *#$ #$p#$!$nt$, *! '&nu! !&@n! [>\%. E*" $($'$nt &! t#*n!'&tt$, 5- !$n,&n@ * !&@n*( +# !+'$ p$#&+, + t&#*t $# ! +#t6 *n, * ,* &!6 &n p$# $"t(- +#'$, "+,$6 t #$$ t&'$! *! (+n@ *! * ,&t. A ! +#t !&($*pp$*#! 5$t $$n $($'$nt!6 &t * (+n@$# !p*"$ 5$t $$n " *#*"t$#!. A !t&(( (+n@$# !p*"$ !$p+#,!. T &! ,$p$n,$n"$ &n t $ !p*"&n@ *n, t&'&n@ + $($'$nt! '$*n! t *t M+#!$ "+,$ +p$#*t+!+'$t&'$! ,+ n+t !$n, p$# $"t "+,$. T &! #$!u(t &n ,& &"u(t&$! +# t $ #$"$&)&n@ +p$#*t+##$ u$nt(- t $ '$!!*@$ "*n 5$ ,$"+,$, ,$p$n,&n@ +n "+nt$ t.

In t &! p#+5($' $ "+n!&,$# #$"$pt&+n + +#,! &n M+#!$ "+,$ &t +ut !p*"&n@ 5$t $$n ($tt$K&t +ut t $ !p*"&n@6 &t &! p+!!&5($ +# 'u(t&p($ +#,! t+ 5$ "+,$, t $ !*'$. F+# $ *'p($6 &'$!!*@$ [,&t ,&t ,&t\ $#$ #$"$&)$,6 &t "+u(, 5$ &nt$#p#$t$, *! [EEE6 EI6 IE\ +# [S\ 5*!$, +"+,&n@ !" $'$ ! + n &n t $ !*'p($ &nput. T+ ,$"&,$ 5$t $$n t $!$ 'u(t&p($ &nt$#p#$t*t&+n!6*!!u'$ * p*#t&"u(*# "+nt$ t 5- $ p$"t&n@ $*" #$"$&)$, +#, t+ *pp$*# &n * ,&"t&+n*#-.

F+# t &! p#+5($' -+u# p#+@#*' &(( #$*, * t*5($ @&)&n@ t $ $n"+,&n@ + ($tt$#! *n, ,&@"+,$6 * (&!t + $ p$"t$, +#,! conte&t %6 *n, * !$ u$n"$ + +#,! $n"+,$, &n M+#!$ "+,$ morse)T $!$ morse +#,! '*- 5$ (* $,. F+# $*" morse +#,6 -+u# p#+@#*' &! t+ ,$t$#'&n$ t $ '*t" &n+#, #+' conte&t 6 & *n-. I 'u(t&p($ +#,! #+'conte&t '*t" morse 6 +# & n+ +#, '*t" $!

p$# $"t(-6 -+u# p#+@#*' &(( ,&!p(*- t $ 5$!t '*t" &n@ +#, *n, * '&!'*t" &n,&"*t+#.

I * !&n@($ +#, #+'conte&t '*t" $! morse p$# $"t(-6 &t &(( 5$ ,&!p(*-$, +n * !&n@($ (&n$6 5I 'u(t&p($conte&t +#,! '*t" morse p$# $"t(-6 t $n !$($"t t $ '*t" &n@ +#, &t t $ $ $!t" *#*"t$#!. I t &! !t&(( #$!u(t! &n *n *'5&@u+u! '*t" 6 *n- + t $!$ '*t" $! '*- 5$ ,&!p(*-$,. I'u(t&p($conte&t +#,! $ &!t +# * @&)$nmorse 6 t $ '*t" &n@ +#, &(( 5$ ,&!p(*-$, +((+ $, *n$ "(*'*t&+n p+&nt [W\%.

K$ *!!u'$ +n(- * !&'p($ "*!$ + $##+#! &n t#*n!'&!!&+n &n &" $($'$nt! '*- 5$ $&t $# t#un"#+' t $ $n, + * morse +#, +# *,,$, t+ t $ $n, + * morse +#,. K $n n+ p$# $"t '*t" $! +#

morse *#$ +un,6 ,&!p(*- t $ +#, #+'conte&t t *t '*t" $! t $ (+n@$!t p#$ & +morse 6 +# *! t $$ $!t $ t#* $($'$nt! 5$-+n, t +!$ &n morse . I 'u(t&p($ +#,! &nconte&t '*t" u!&n@ t $!$ #u($!6*n- + t $!$ '*t" $! '*- 5$ ,&!p(*-$,. K+#,! t *t ,+ n+t '*t" p$# $"t(- *#$ ,&!p(*-$, &t *u$!t&+n '*#? [h\% !u & $,.

T $ &nput ,*t* &(( +n(- "+nt*&n "*!$! t *t *(( &t &n t $ p#$"$,&n@ #u($!.

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 66/499

.nput

T $ M+#!$ "+,$ t*5($ &(( *pp$*# &#!t *n, "+n!&!t! + (&n$! $*" "+nt*&n&n@ *n upp$#"*,&@&t C6 8$#+ +# '+#$ 5(*n?!6 *n, * !$ u$n"$ + n+ '+#$ t *n !& p$#&+,! *n, -p $n! @&)&M+#!$ "+,$ +# C. B(*n?! '*- p#$"$,$ +# +((+ t $ &t$'! +n t $ (&n$. A (&n$ "+nt*&n&n@ **!t$#&!? [e\%6 p+!!&5(- p#$"$,$, +# +((+ $, 5- 5(*n?!6 t$#'&n*t$! t $ M+#!$ "+,$ t*5($. Y+*!!u'$ t *t t $#$ &(( 5$ M+#!$ "+,$ @&)$n +# $)$#- " *#*"t$# t *t *pp$*#! &n t $conte&t !$"t&+n.

T $ conte&t !$"t&+n n$ t6 &t +n$ +#, p$# (&n$6 p+!!&5(- p#$"$,$, *n, +((+ $, 5- 5(*n?!. E*+#, &n "+nt$ t &(( "+nt*&n n+ '+#$ t *n t$n " *#*"t$#!. N+ " *#*"t$#! +t $# t *n upp$# "*!$*n, ,&@&t! &(( *pp$*#. T $#$, &(( 5$ *t '+!t 1<< "+nt$ t +#,!. A (&n$ "+nt*&n&n@ +n(- *!t$#&!? [e\%6 p+!!&5(- p#$"$,$, +# +((+ $, 5- 5(*n?!6 t$#'&n*t$! t $ "+nt$ t !$"t&+n.

T $ #$'*&n,$# + t $ &nput "+nt*&n!morse +#,! !$p*#*t$, 5- 5(*n?! +# $n,>+ >(&n$ " *#*"t$#!. A"+nt*&n&n@ +n(- * !&n@($ *!t$#&!? [e\%6 p+!!&5(- p#$"$,$, +# +((+ $, 5- 5(*n?!6 t$#'&n N+morse +#, &(( *)$ '+#$ t *n $&@ t- <% $($'$nt!.

:utputF+# $*" &nputmorse +#,6 ,&!p(*- t $ *pp#+p#&*t$ '*t" &n@ +#, #+'conte&t +((+ $, 5- *n$ "(*'*t&+n '*#? [W\% +# u$!t&+n '*#? [h\% & *pp#+p#&*t$. E*" +#, &! t+ *pp$*# +n *(&n$ !t*#t&n@ &n "+(u'n +n$.

0ample .nput =6 .- 6N> -> E65'L076 EC -.-. E6'= -.. K=E . L6'LJ ..-. 9M

--. 5E6=IL >. 'K9 .. L6'O .--- 5K'L

-.- ..-. & .-->..-- >..-->.

M DD --.----.. .--.-.----..N D& .-->..-- .--.K DDD ..-.-.->.--.-..-.--.-.P &DD& ..-- .->--..-.--0 DD&D ---- ..--

5 &D&

::

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 67/499

; U .' D :utput 7or the 0imple .nput7 ..- L6'Q &&D L6'L# D&&D K=I D&DD 5K'L

DD&& L6'! DDDDDD 6N

1 &DDDDD E65'L076 E2 &&DDD 9MZ3 UDD 5E6=I$ U&D 'K" U&D 9MZ* DU&< DDU

DDD&&B DDDD&

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 68/499

Fecha 24b*5#&(b2<<4 Nombre de la competencia u&nt*! C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR> B*-*'7nAutor Hu*n M. S+(_ Tipo de Competencia P#+@#*'*"&7nProblema ( 3

$)*AT DE*RA+, E-E

.nput File Name(L>FAT. T;T:utput File Name( DEFRAG. T;T

L> FAT $! (* t*5(* ,$ (+"*(&8*"&7n ,$ *#" &)+! ut&(&8*,* p+# LECJON>DOS. U!t$, ,$5$ "+n!t#u&# un p#+@un L>FAT #*@'$nt*,+6 ,$5* p#+,u"&# un L>FAT ,$ #*@'$nt*,+.

$%emplo(L>FAT #*@'$nt*,+

0tartat .# Filename 0tart at $nd at

Ne5t.#

1 C<1 '+n!t#+.'p@ < << < A<21 M<4 < F&($1. ,(( 1< :4 1< 1 C2<13

< F <1 '+n!t#+.'p@

1 1 3 1 e

1 U< :1 ; &@.#p' 3 2 <<< e

< H<12 F&($1.,(( <1<<1 <2: e

< A<2 M+!t#+.' p@

1<<1 13 2 F <1

< C2<13 F&($1.,(( < : 1<<< H<12

L>FAT ,$ #*@'$nt*,+

0tartat .# File

Name0tart at $nd at

N$ tID

1 M<4 < F&($1.,(( < :<2 < e

1 C<1 '+!t#+.' p@

:<2 < :< 4: e

1 U< :1 ; &@.#p' :< 4: :<: 1: e

N+t$ (+ !&@u&$nt$1. L>FAT ,$ #*@'$nt*,+ !$ +#@*n&8* p+# +#,$n *( *5 t&"+ $n (* "+(u'n* ,$ [ &($n*'$\.

2. L+! *#" &)+! !$ "+(+"*n $'p$8*n,+ $n (* p+!&"&7n < $n $( ,&!"+ ,u#+.

3. E( "+'&$n8+ ,$ un *#" &)+ $!t_ '*#"*,+ "+n un 1 $n (* p#&'$#* "+(u'n*.

4. S$ p#$!$#)* $( ID ,$( p#&n"&p&+ ,$( *#" &)+ *( ,$ #*@'$nt*# $( L>FAT.

. Un < $n (* p#&'$#* "+(u'n* &,$nt& &"* * un #*@'$nt+ $n $( L>FAT #*@'$nt*,+.

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 69/499

:. L+! 5#&n"+! *"&* +t#+! #*@'$nt+! $n $( L>FAT #*@'$nt*,+ pu$,$n !$# *"&* un ID '_! *5*0+ + '_! *

(&!t*.

. A( ,$ #*@'$nt*# un *#" &)+ pu$,$ +"u##&# u$ +t#+ t$n@* u$ !$# '+)&,+ ,$( L>FAT p*#* *u$ $!t$ p#&

n+ ($ p*!$ p+# $n"&'* *( !$@un,+ *#" &)+.

$%emplo

f&nputZ!>FAT4TOT

0tartat .# Filename 0tart at $nd at

Ne5t.#

1 C<1 '+n!t#+.'p@ < << < A<21 M<4 < F&($1. ,(( 1< :4 1< 1 C2<13< F <1 '+n!t#+.'p@ 1 1 3 1 e1 U< :1 ; &@.#p' 3 2 <<< e< H<12 F&($1.,(( <1<<1 <2: e< A<2 M+!t#+.'p@ 1<<1 13 2 F <1< C2<13 F&($1.,(( < : 1<<< H<12

f+utputZ #$FRA94TOT

0tart

at.# File Name 0tart at $nd at

N$ t

ID1 M<4 < F&($1.,(( < :<2 < e1 C<1 '+!t#+.'p@ :<2 < :< 4: e1 U< :1 ; &@.#p' :< 4: :<: 1: e

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 70/499

Fecha 24b*5#&(b2<<4 Nombre de la competencia u&nt*! C+'p$t$n"&*!Categoría E p$#t+ Universidad UPR> B*-*'7nAutor Hu*n M. S+(_ Tipo de competencia P#+@#*'*"&7nProblema (4

Di.er"ión Con +rafo".nput File Name( G#* +.t t:utput File Name( M p*nt*((*Z

Un @#* + ,&#&@&,+ !$ #$p#$!$nt* "+n GX V6E% ,+n,$ V $! $( "+n0unt+ ,$ (+! n+,+! - E $! $( "+n0unt+ ,$ (*$0$'p(+ ,$ !u *#" &)+ ,$ $nt#*,* $!

fNu'$#+ ,$ N+,+!Z* 5",$4 fNu'$#+ ,$ *#t&!t*!Z*65 56*,6* 56"

9 2/J$6VXm*656"6,6$ - EXm *65%6 ,6*%6 56"%

D$5$ "(*!& &"*# (+! n+,+! ,$ (* !&@u&$nt$ +#'*

N+,+ * $! u$#t$'$nt$ "+n$ + "+n 5 N+,+ 5 $! u$#t$'$nt$ "+n$ + "+n * N+,+ 5 $! "+n$ + "+n " N+,+ , $! "+n$ + "+n * N+,+ $ $! ,&!"+n$ +

N+t*

1. N+ $ &!t$n "&"(+! $n (+! @#* +! ,*,+! ,$ $nt#*,*. S+(+ pu$,$ "(*!& &"*# $n t#$! "(*!$! Fuertemente cone&o, cone&o o discone&o2. Un n+,+ * $! u$#t$'$nt$ "+n$ + "+n 56 !& $ &!t$ un *#&!t* ,$( n+,+ * *( n+,+ 5 - ,$( n+,+ 5 *( n+,+ * E

*65% - 56*%%.3. Un n+,+ $! "+n$ + !& $ &!t$ un* *#&!t* ,$ !*(&,* * +t#+ n+,+ E0$'p(+ ,6*%%4. Un n+,+ $! ,&!"+n$ + !& n+ $ &!t$ un* *#&!t* ,$ !*(&,* n& ,$ $nt#*,* *"&* $(. E0$'p(+ n+,+ $%.. Un n+,+ u$ $! u$#t$'$nt$ "+n$ +6 t*'5& n $! un n+,+ "+n$ +. P+# $n,$ NO ,$5$ (&!t*# *( n+,+ * "+'+ "+

"+n 5 -* u$ $! u$#t$'$nt$ "+n$ + "+n $( n+,+ 5.

:re%ita( UtiliQar matriQ de adyacencia

<

* 5

$

",

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 71/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Euintas Competencias de Programación'KK+

Intermedio

1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 72/499

Fecha 24b*5#&(b2<<4 Nombre de la competencia u&nt*! C+'p$t$n"&*!Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor 4t+C+'p$t$n"&* I5$#+*'$#&"*n* ,$ In +#'_t&"* Tipo de competencia P#+@#*'*"&7nProblema 1

PARENT.nput File Name( PAR$NT4.N:utput File Name( PAR$NT4 :UT

#escripción

S$ t&$n$ un* !$"u$n"&* ,$ t*'*9+ p*# ,$ p*# nt$!&! $n ,+! $!t*,+! p+!&5($! *5&$#t+! - "$##*,+! %d - !$ ,$!$*(@un+! ,$ +#'* t*( u$ !$ +5t$n@* un* !$"u$n"&* )_(&,* ,$ p*# nt$!&! *5&$#t+! - "$##*,+!.

T*#$*D*,* un* !$"u$n"&* ,$ t*'*9+ p*# ,$ *!t* 1.<<< p*# nt$!&!6 $n"+nt#*# $( n/'$#+ ,$ p*# nt$!&! u$ ,$5$n "*'5&*$!t*,+ p*#* u$ !$* un* !$"u$n"&* )_(&,*.

E0$'p(+

S$* (* !$"u$n"&* %%

L* !$"u$n"&* n+ $! )_(&,*6 p*#* *"$#(* )_(&,* !$ pu$,$n *"$# $n ,+! p*!+!6 un* ,$ !u! !+(u"&+n$! $! (* !&@u"*'5&*n,+ (*! p+!&"&+n$! 163 - : !$ +5t&$n$ % % %6 !&$n,+ $!t* un* !$"u$n"&* ,$ p*# nt$!&! )_(&,*.

Ent#*,* PAR$NT4.N

En (* p#&'$#* - /n&"* (`n$* ,$( *#" &)+ *p*#$"$ un* "*,$n* ,$ (+n@&tu, p*# L O fXL fX 1.<<<% +#'*,* p+# - %d !&n $!p*"&+! $nt#$ $((+!.

S*(&,*PAR$NT4:UT

En (* p#&'$#* (`n$* ,$( *#" &)+ ,$ !*(&,* ,$5$ *p*#$"$# $( )*(+# ,$ M6 &n,&"*n,+ $( '`n&'+ ,$ p*# nt$!&! u$ !"*'5&*# p*#* +5t$n$# un* !$"u$n"&* )_(&,* - $n (* !$@un,* (`n$* M $nt$#+! !$p*#*,+! p+# $!p*"&+ &n,&"*,,+n,$ !$ ,$5$n *"$# (+! "*'5&+!. S& n+ $! n$"$!*#&+ *"$# "*'5&+!6 $( *#" &)+ ,$ !*(&,* !7(+ "+nt$n,#_ un* (n/'$#+ <.

$8$-P!:

PAR$NT4 .N PAR$NT4 :UT%% 3

14:

2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 73/499

Fecha(24b*5#&(b2<<4 Nombre de la competencia u&nt*!C+'p$n"&*!

Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor 1 2 ACM S" +(*!t&" P#+@#*''&n@ C+nt$!tTipo de Competencia P#+@#*'*"&7nProblema 2

Spread" ee! Calcula!or

.nput File Name(SPRCAL.IN:utput File Name( SPRCAL. OUT

A !p#$*,! $$t &! * #$"t*n@u(*# *##*- + "$((!. C$((! "+nt*&n ,*t* +# $ p#$!!&+n! t *t "*n 5$ $)*(u*t$ t+ +5t*&[!&'p($\ !p#$*,! $$t &! +n$ &n &" ,*t* *#$ &nt$@$#! *n, $ p#$!!&+n! *#$ '& $, !u'! *n, ,& $#$n"$! + &nt$#! #$ $#$n"$!. F+# *n- $ p#$!!&+n6 & $*" "$(( t *t &! #$ $#$n"$, "+nt*&n! *n &nt$@$#6 t $n t $ $ p#$!!&+n "*nt $ &nt$@$# t+ &" t $ $ p#$!!&+n $)*(u*t$!. Y+u *#$ t+ #&t$ * p#+@#*' &" $)*(u*t$! !&'p($ !p#$*,! $$t!.

.nput

Input "+n!&!t! + * !$ u$n"$ + !&'p($ !p#$*,! $$t!. E*" !p#$*,! $$t 5$@&n! &t * (&n$ !p$"& -&n@ t $ nu'5$#*n, t $ nu'5$# + "+(u'n!. N+ !p#$*,! $$t "+nt*&n! '+#$ t *n 2< #+ ! +# 1< "+(u'n!. R+ ! *#$ (*5$($, 5- "*p&t*(($tt$#! A t #+u@ T. C+(u'n! *#$ (*5$($, 5- ,$"&'*( ,&@&t! < t #+u@ . T $#$ +#$6 t $ "$(( &n t $ &#!t #+ *n,"+(u'n &! #$ $#$n"$, *! A<a t $ "$(( &n t $ t $nt&$t #+ *n, & t "+(u'n! &! #$ $#$n"$, *! T4.

F+((+ &n@ t $ !p$"& &"*t&+n + t $ nu'5$# + #+ ! *n, "+(u'n! &! +n$ (&n$ + ,*t* +# $*" "$((6 p#$!$nt$, &n #+#,$#. %T *t &!6 *(( "$((! +# t $ &#!t #+ "+'$ &#!t6 +((+ $, 5- *(( "$((! +# t $ !$"+n, #+ 6 $t".% E*" "$(( &n"+nt*&n! * !&@n$, &nt$@$# )*(u$ +# *n $ p#$!!&+n &n)+()&n@ un!&@n$, &nt$@$# "+n!t*nt!6 "$(( #$ $#$n*,,&t&+n% *n, = !u5t#*"t&+n%. IF * "$(( &n&t&*((- "+nt*&n! * !&@n$, &nt$@$#6 t $ "+##$!p+n,&n@ &np+pt&"*( '&nu! !&@n +((+ $, 5- +n$ +# '+#$ ,$"&'*( ,&@&t!. I * "$(( &n&t&*((- "+nt*&n! *n $ p#$!!&+n6 &t"+nt*&n +n$ +# '+#$ "$(( #$ $#$n"$! +# un!&@n$, &nt$@$# "+n!t*nt! !$p*#*t$, #+' $*" +t $# 5- *n, = !&@n'u!t 5$@&n &t * "$(( #$ $#$n"$. N+ $ p#$!!&+n "+nt*&n! '+#$ t *n " *#*"t$#!. N+ (&n$ + &nput "+nt*&n! 5(*n?!. N+ $ p#$!!&+n "+nt*&n! *n- $'5$,,$, 5(*n?!. J+ $)$#6 *n- (&n$ '*- "+nt*&n t#*&(&n@ 5(*n?!.

T $ $n, + t $ !$ u$n"$ + !p#$*,! $$t &! '*#?$, 5- * (&n$ !p$"& -&n@ < #+ ! *n, < "+(u'!.

:utput

F+# $*" !p#$*,! $$t &n t $ &nput6 -+u *#$ t+ ,$t$#'&n$ t $ )*(u$ + $*" $ p#$!!&+n *n, ,&!p(*- t $ #$!u(t&n@ *! * #$"t*n@u(*# *##*- + nu'5$# &t t $ #+ ! *n, "+(u'n! *pp#+p#&*t$(- (*5$($,. In $*" ,&!p(*-6 *(( nu'5$#! +"+(u'n 'u!t *pp$*# t&@ t>0u!t& &$, *n, *(&@n$, &t t $ "+(u'n (*5$(. Op$#*t+#! *#$ $)*(u*t$, ($ t t+ #&@ t &$ p#$!!&+na )*(u$! &n "$((! *#$ *( *-! ($!! t *n 1<<<< &n *5!+(ut$ )*(u$. S&n"$ $ p#$!!&+n! '*- #$ $#$n"$ "$(t $'!$()$! "+nt*&n $ p#$!!&+n!6 t $ +#,$# &n &" "$((! *#$ $)*(u*t$, &! ,$p$n,$nt +n t $ $ p#$!!&+n! t $'!$()$!.

I +n$ '+#$ "$((! &n * !p#$*,! $$t "+nt*&n $ p#$!!&+n! &t "&#"u(*# #$ $#$n"$!6 t $n t $ +utput +# t *t !p#$*,!"+nt*&n +n(- * (&!t + t $ un$)*(u*t$, "$((! &n #+ >'*0+# +#,$#6 +n$ p$# (&n$6 &t $*" (&n$ "+nt*&n&n@ t $

"+(+n6 * 5(*n?6 *n, t $ "$((d! +#&@&n*( $ p#$!!&+n.

3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 74/499

A 5(*n? (&n$ ! +u(, *pp$*# +((+ &n@ t $ +utput +# $*" !p#$*,! $$t. S*'p($ &nput *n, +utput *#$ 5$(+ .

S*'p($ Input Output +# t $ S*'p($ Input2 2 ! 16lF>1 6 3 "" > 3 D23>KD6l 6K: 6K2 2 >K: Cl6K Cl:"Cl<6lF>l>KF6l

! !

4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 75/499

F$" * 24b*5#&(b2<<4 N+'5#$ ,$ (* "+'p$t$n"&* u&nt*! C+'p$t$n"&*C*t$@+#`* Int$#'$,&+ Un&)$#!&,*, UPR> B*-*'7nAut+# N$((&u, D. T+##$! T&p+ ,$ "+'p$t$n"&* P#+@#*'*"&7nP#+5($'* 3

ESCA$ERA ARITM/TICA

L+! *nt&@u+! G#&$@+! ,$!"u5#&$#+n "+'+ "+n!t#u&# $( (*#@+ ,$ (+! n/'$#+! &##*"&+n*($! ut&(&8*n,+ $(E((+! ut&(&8*5*n p+(`@+n+! - "+n"$pt+! ,$ (`'&t$! p*#* "*("u(*# $( _#$* ,$ un "`#"u(+. T*'5& n ,$!*##+((*#+$!"*($#* *#&t' t&"* ut&(&8*n,+ #*,&+! p*#* *p#+ &'*# $( )*(+# ,$ (+! n/'$#+! &##*"&+n*($!. T#*5*0* ,$ (* !+#'*n ,+! "+(u'n*! - (*! ,+! )*n * "+'$n8*# "+n $( n/'$#+ un+ 1%. S& (+ (($)*'+! * "&n"+ p*!+!6 (* $!"*($#* !$#`!&@u&$nt$

PA0:0 !A##$R &

!A##$R '

< 1 11 2 3

23 12 14 2 41

<

D$!*##+(($ un p#+@#*'* u$ ($ p&,* *( u!u*#&+ ,+! n/'$#+! &n&"&*($! - (* "*nt&,*, ,$ p*!+! u$ ,$!$* )$# ,$ u'_ &'+ ,$ )$&nt$ 2<%%.

$%emplo Corrida(

Ent#$ (+! ,+! n/'$#+! &n&"&*($! 1 = %=

Ent#$ (* "*nt&,*, ,$ p*!+! u$ ,$!$* "+t$0*# 1 >2<%'' N/'$#+ &n"+##$"t+6 t#*t$ ,$ nu$)+Ent#$ (* "*nt&,*, ,$ p*!+! u$ ,$!$* "+t$0*# 1 = 2<%,

A p*#t&# ,$( p*!+ un+6 (+! n/'$#+! ,$ (* "+(u'n* ((*'*,*[LADDER 1\ !$ +#'*n ut&(&8*n,+ $( !&@u&$nt$ p#+"$,&'&$nt+

P*!+ 1 1 1 X 2P*!+ 2 2 3 X P*!+ 3 X 12P*!+ 4 12 1 X 2

P*!+ 2 41 X <L+! n/'$#+! ,$ (* "+(u'n* ((*'*,* [LADDER 2\ !$ +#'*nut&(&8*n,+ $( !&@u&$nt$ p#+"$,&'&$nt+

P*!+ 1 1 2 X 3P*!+ 2 2 X P*!+ 3 12 X 1P*!+ 4 12 2 X 41P*!+ 2 < X

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 76/499

PASOS LADDER 1 LADDER 2

< 3 1 112 1 23 4: :4 111 1

2: 3: :4 1

:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 77/499

Fecha 24b*5#&(b2<<4 Nombre de la competencia u&nt*! C+'p$t$n"&*!Categoría( Int$#'$,&+ Universidad UPR = B*-*'7nAutor( N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema ( 4

N0M#ER PROPERTIES

A p+!&t&)$ &nt$@$# &! "+n!&,$#$, p#&'$ & &t &! $)$n(- ,&)&!&5($ +n(- 5- &t!$( *n, 1. A(!+6 5- "+n)$nt& p#&'$. T u!6 t $ !$ u$n"$ + p#&'$! 5$@&n!2636 6 61161361 6

A p+!&t&)$ &nt$@$# &! "*(($, p$# $"t & &t &! t $ !u' + &t! p#+p$# ,&)&!+#!. F+# $ *'p($6 2 &! * p$# $"t nu1 2 4 14.

Y+u# *!!&@n'$nt &! t+ #&t$ * p#+@#*' t *t &(( &nput * !$ u$n"$ + &nt$@$#!6 +n$ p$# (&n$6 *n, +utput t $&nt$@$# &n t $ +((+ &n@ +#'*t

I t $ nu'5$# &! n$&t $# p#&'$ n+# p$# $"t6 +utput [Du((\.I t $ nu'5$# &! p#&'$ 5ut n+t p$# $"t6 +utput [P#&'$\.I t $ nu'5$# &! p$# $"t 5ut n+t p#&'$6 +utput [P$# $"t\.I t $ nu'5$# &! 5+t p#&'$ *n, p$# $"t6 +utput [T &! p#+@#*' ,+$!ndt +#?\.

A(( &nput! &(( 5$ p+!&t&)$ &nt$@$#!. T $ $n, + &nput &(( 5$ '*#?$t 5- t $ nu'5$# < n+ +utput ! +u(, 5$ @$n

$5ample(

9nput

2<1$!1

"!

Kutput

PerfectPrime=ull=ull

Prime

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 78/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Cuartas Competencias de Programación'KK=

23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 79/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#Categoría E p$#t+ Universidad UPR>B*-*'7nAutor Fu#'*n Un&)$#!&t- 2<<< Tipo de competencia P#+@#*'*"&7nProblema 1

A Real Pu11ler

Input F&($ N*'$ prob&4inOutput to the screen

#escription(A " &(,#$nd! pu88($ t *t *! p+pu(*# &n t $ ,*-! 5$ +#$ )&,$+ @*'$! "+n!&!t$, + * 5- #*'$ &" "+nt*&!'*(( t&($! + $ u*( !&8$. A un& u$ ($tt$# + t $ *(p *5$t *! p#&nt$, +n $*" !'*(( t&($. S&n"$ t $#$ $#t&($! &t &n t $ #*'$6 t $ #*'$ *(!+ "+nt*&n$, *n $'pt- p+!&t&+n &" *! t $ !*'$ !&8$ *! * !'*(( t&($. "+u(, 5$ '+)$, &nt+ t *t $'pt- p+!&t&+n & &t $#$ &''$,&*t$(- t+ t $ #&@ t6 t+ t $ ($ t6 *5+)$ +# 5$(+

p+!&t&+n. T $ +50$"t + t $ pu88($ *! t+ !(&,$ t&($! &nt+ t $ $'pt- p+!&t&+n !+ t *t t $ #*'$ ,&!p(*-$&n *(p *5$t&"*( +#,$#. T $ &((u!t#*t&+n 5$(+ #$p#$!$nt! * pu88($ &n &t! +#&@&n*( "+n &"+n &@u#*t&+n * t$# t $ +((+ &n@ !$ u$n"$ + : '+)$!

1. T $ t&($ *5+)$ t $ $'pt- p+!&t&+n &! '+)$,.2. T $ t&($ t+ t $ #&@ t + t $ $'pt- p+!&t&+n &! '+)$,.3. T $ t&($ t+ t $ #&@ t + t $ $'pt- p+!&t&+n &! '+)$,.4. T $ t&($ 5$(+ t $ $'pt- p+!&t&+n &! '+)$,.. T $ t&($ 5$(+ t $ $'pt- p+!&t&+n &! '+)$,.:. T $ t&($ t+ t $ ($ t + t $ $'pt- p+!&t&+n &! '+)$,.

T R 9 0 8

O # : D .

- / ! N

@ P A B $

U E ; C F

T R 9 0 8

O : D ! .

- # / B N

@ P A $

U E ; C F

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 80/499

Input +# -+u# p#+@#*' "+n!&!t! + !$)$#*( pu88($!. E*" &! ,$!"#&5$, 5- &t! &n&t&*( "+n &@u#*t&+n *n'+)$! +n t $ pu88($. T $ &#!t (&n$! + $*" pu88($ ,$!"#&pt&+n *#$ t $ !t*#t&n@ "+n &@u#*t&+n. T $ n$t $ !$ u$n"$ + '+)$!.

T $ &#!t (&n$ + t $ &nput "+##$!p+n,! t+ t $ t+p (&n$ + t&($! &n t $ pu88($. T $ +t $# (&n$! +((+ &n $'pt- p+!&t&+n &! &n,&"*t$, 5- * 5(*n?. E*" &nput (&n$ "+nt*&n! $ *"t(- " *#*"t$#!6 5$@&nn&n@ &t tt $ ($ t'+!t t&($ +# * 5(*n? & t $ ($ t'+!t t&($ &! t $ $'pt- #*'$ p+!&t&+n%.

T $ !$ u$n"$ + '+)$! &! #$p#$!$nt$, 5- * +n$ (&n$ !$ u$n"$ + A!6 B!6 R! *n, L! t+ ,$n+t$ &" t&($ '+)$! &t $ $'pt- p+!&t&+n. A ,$n+t$! t *t t $ t&($ *5+)$ t $ $'pt- p+!&t&+n '+)$!a B ,$n+t$! t *t t $ t&($ 5$(+ t $ $'pt p+!&t&+n '+)$!a L ,$n+t$! t *t t $ t&($ t+ t $ ($ t + t $ $'pt- p+!&t&+n '+)$!a R ,$n+t$! t *t t $ t&($ t+ t $ #&@t $ $'pt- p+!&t&+n '+)$!.

Input &(( 5$ t$#'&n*t$, &t 1 8$#+ <% &n t $ pu88($ ,$!"#&pt&+n.

Output +# $*" pu88($ 5$@&n! &t * pu88($ (*5$( Pu88($ 16 Pu88($ 26 $t".%. T $ &n*( "+n &@u#*t&+n! +u(, t $n 5$ p#&nt$,. F+#'*t $*" (&n$ +# * &n*( "+n &@u#*t&+n !+ t *t t $#$ &! * 5(*n? " *#*"t$# 5$*,0*"$nt ($tt$#!. T#$*t t $ $'pt- t&($ t $ !*'$ *! * ($tt$#. S$p*#*t$ +utput #+' ,& $#$nt pu88($ #$"+#,! 5- +n$ (&n$.

$5ample(

Input (? < @ ' M : , +&

$ 7" &(( & "

?7'< M,

+ ( $: @(&&&0

Output +uAAle B1# ( ? < @ '

M : , + &

$ 7 "

+uAAle B2# & " ? 7 ' M , < + ( $ : @

Additional notes(Y+u '*- *!!u'$ t *t t $ &nput &(( "+##$!p+n, t+ * ($@&t&'*t$ pu88($. In *,,&t&+n6 *(( !$ u$n"$! + '+)$! &(( 5$ )*(&&(( n+t '+)$ +ut!&,$ t $ 5+un,! + t $ pu88($. N+ !$ u$n"$ &(( 5$ (+n@$# t *n < " *#*"t$#!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 81/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría E p$#t+ Universidad UPR>B*-*'7nAutor ACSL-1998 Tipo de competencia P#+@#*'*"&7nProblema 2

+o

T $ @*'$ + G+ &! p(*-$, +n *n >5-> 5+*#,. T $#$ *#$ t + p(*-$#!6 &t$ K% *n, 5(*"? B%. T $ p(*-$#! t*?$ tu#n! p(*"&n@ * p&$"$ + t $&# "+(+# +n t $ 5+*#,6 &t t $ @+*( + "*ptu#&n@ t $ p&$"$. Y+u "*ptu#$ -+u# +pp+n$nt ! p&$"$ 5- !u##+un,&n@ &t &t -+u# + n p&$"$! +n t $ +#&)$#t&"*( !&,$!.

T $ 5+*#,! 5$(+ &((u!t#*t$ t $ "*ptu#$ + * !&n@($ &t$ p&$"$6 $n t $ &t$ p&$"$ &! &n t $ &$,@$6 *n, "+#n$# #+' ($ t>t+>#&@ t%. N+t$ t *t +n(- t + + -+u# p&$"$! *#$ n$$,$, t+ "*ptu#$ *n+pp+n$nt ! p&$"$ *t * "+#n$#6 *n, t #$$ p&$"$! *#$ n$$,$, $n t $ +pp+n$nt &! +n * ! u*#$ *(+n@$,@$.

T+ '*?$ t &! p#+@#*' '+#$ " *(($n@&n@ * t$# *((6 t &! &! t $ A((>St*# C+nt$!t%6 -+u n$$, t+ "@(+5! + p&$"$!. T *t &!6 @#+up! + p&$"$! + +n$ "+(+#6 *(( t+u" &n@ $*" +t $# +#&8+nt*()$#t&"*((-6 t *t *#$ "+'p($t$(- !u##+un,$, +#&8+nt*((- *n, )$#t&"*((- 5- p&$"$! + t $ +t $# "+(+#

5+*#, *t t $ ($ t &((u!t#*t$! 3 &t$ @(+5!a &n t $ '&,,($ 5+*#,6 t $ @(+5 *t t $ (+ $#>($ t *! 5$$n"*ptu#$, u!&n@ t $ $ $!t nu'5$# + 5(*"? p&$"$!a *n, &n t $ #&@ t 5+*#,6 *(( t #$$ @(+5! *)$ 5$"*ptu#$,6 *@*&n u!&n@ t $ $ $!t nu'5$# + 5(*"? p&$"$! p+!!&5($

T $ &nput t+ t &! p#+@#*' &(( 5$ !$t! + ,*t*. E*" !$t &(( "+n!&!t + * 5+*#, "+n &@u#*t&+n. -+u t $ +#'*t (*t$#.% Y+u n$$, t+ #$p+#t t $ 5$!t '+)$ +# $*" p(*-$#. B- 5$!t '+)$6 $ '$*n t $ p(*"$ +n t $ 5+*#, t *t +u(, "*ptu#$ t $ '+!t +pp+n$nt ! p&$"$!. I t $#$ *#$ n+ !u" (+"*t&+n!6 p#&n+n$. I t $#$ &! '+#$ t *n +n$ (+"*t&+n6 -+u 'u!t p#&nt *((. T $ 5$!t '+)$ +# &t$ +# $*""+n &@u#*t&+n &! +#t 1 p+&nt $*" a t $ 5$!t '+)$ +# 5(*"? +# $*" 5+*#, "+n &@u#*t&+n &! p+&nt $*" .

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 82/499

T+ '*?$ t-p&n@ t $ ,*t* $*!- +n t $ p#+"t+#!6 $ (( $n"+,$ t $ :4 (+"*t&+n! +n t $ 5+*#, &n 5&n*#-$*" p(*-$#. T *t &!6 * :4>5&t !t#&n@ &(( @&)$ *(( p+!&t&+n! $#$ 5(*"? p&$"$! #$!&,$6 *n, 5&t !t#&n@ &(( @&)$ t $ &t$ p&$"$!. AND&n@ t $ t + !t#&n@! t+@$t $# &! @u*#*nt$$, t+ #!t#&n@ t *t &! *(( 8$#+ !. T &n? *5+ut &t.% T $ 5+*#, &! $n"+,$, #+' ($ t>t+>#&@ t6 5+tt+'>t+>t+p. T *t &!6t $ (+ $# ($ t "+#n$# &! t $ ($*,&n@ 5&t + t $ :4>5&t !t#&n@6 t $ "$(( *5+)$ &t t $ t '+!t !&@n&*n, !+ +n.

T $ 5&t>!t#&n@! &(( 5$ "+n)$#t$, t+ 5*!$ 1:. T $ #&@ t'+!t 5+*#, &n t $ !$"+n, !$t + &'*@$! *5$n"+,$, *! B<2 4A1 F C :B1< +# 5(*"? *n, *!4<D< B<E2 <: 3 1<<< +# &t$.

A! '$nt&+n$,6 +# $*" 5+*#, "+n &@u#*t&+n6 p#&nt t $ 5$!t '+)$ $*" p(*-$# "+u(, '*?$ & $ $#$n$ t. E*" !$t + &nput #$!u(t! &n t + +utput!6 $*" +#t +n$ p+&nt. P#&nt t $ (+"*t&+n + t $ 5$!t *! * nu'5$# #+' 1 t +u@ :46 '*pp&n@ t+ t $ p+!&t&+n + t *t "$(( &n t $ 5&t !t#&n@. F+# &n!t*n&t$ p&$"$ &n t $ ($ t'+!t 5+*#, &n t $ t+p !$t + &'*@$! &! *t "$(( 44. I n+ '+)$ +u(, #$!u(t &n t

"*ptu#$ + *n- + t $ +pp+n$nt ! p(*-$#!6 p#&nt t $ !t#&n@ n+ &n.

0ample .nput(

ine 1: !!!$ 1 !1 !"3! "2!B !!!1 $$1! $2C 2B !

ine 2: 12!$ !!! 12!! 21!$ !1 ! 22 ! !! $ 1! !

0ample :utput(

Kutput 1: blac : $ and "B Kutput 2: w4ite: *3 Kutput 3: blac : 1* Kutput $: w4ite: no win

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 83/499

Programming Problem #2 – o ! E" er$o

Te%$ Da$a In &$'

?1: !!C 11!! $2$! 1 1!$ ! $! 2"2! $2!2 ?2: $!2! !C3! $6$! 3!B! 31$2 2!! 3!3! !"!1

?3: JJ!! E<!! BB1 E<!! !!E< 1 BB !!E< !!JJ ?$: !2! !$!2 !!B! 211! !!!2 3 $! !1* !!!! ?": 1! 2!!2 B$2 1!> !362 !! "2 $!1

Te%$ Da$a O&$ &$'

?1: blac : 2 ?2: w4ite: "* ?3: blac : $" ?$: w4ite: 1 ?": blac : 12 and 13 ?*: w4ite: "2 and "3 ?<: blac : no win ? : w4ite: no win ?B: blac : "!?1!: w4ite: 2, 2", 3 , and "Note: There are 5 inputs; each input results in two outputs, one for black and one for white. Thelabels "black" and "white" are optional. Outputs 5, 6, and 10 ha e !ore than one alue; all !ustbe present to recei e credit, and the !a appear in an order. Outputs # and $ !ust be the strin%"no win."

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 84/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría E p$#t+ Universidad UPR>B*-*'7nAutor ACSL-1998 Tipo de competencia P#+@#*'*"&7nProblema 3

2D Tic)Tac)Toe

This problem takes the game of tic-tac-toe to a higher dimension. Consider threetic-tac-toe boards aligned above each other such that there are ! cubes in "hichto place a marker. The game is pla#ed bet"een t"o pla#ers$ % and &$ b# takingturns placing a marker in one of the cubes. The "inner is the first pla#er to getthree in a ro". &f course$ the cubes do not need to be from the same board'ho"ever$ connecting the centers of the cubes does need to form a straight line.

There "ill be 1( sets of data. )ach set consists of an initial configuration of %*s and&*s$ follo"ed b# the placement of the ne+t ,%,.

The initial configuration is given b# a string that is ! characters long consisting of%*s$ &*s$ and *s for blanks/. The string K.K..#.#KK.#.#.KK.#.#.#...K represents thefollo"ing three boards0

The placement of the ne+t ,%, is given b# an integer$ 1 through !$ representingthe ! cubes in the board. The numbering scheme is the same order as the !-character long string representing the initial configuration. or e+ample$ the &*s onthe boards above are at positions 1$ 2$ 9$ 1($ 13$ 1!$ and !.

or each input set$ determine if ,%, "ins$ and if so$ "hich t"o other cubes on theboards contribute to the "in. 4f ,%, "ins in more than one "a#$ #ou must print all"a#s. 4f ,%, cannot "in$ print a message to that effect.

Sam le In &$'

ine 1: K.K..#.#KK.#.#.KK.#.#.#...K, " ine 2: #K..#.K..K...#.##K..#...K.K, 11

Sam le O&$ &$'

Kutput 1: 1$ and 23 Kutput 2: 1$ and 1<T 1 and 21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 85/499

5rogramming 5roblem 62 - (D Ti)!Ta)!Toe !E" er$o

Te%$ Da$a In &$'

?1: .#K..#K.KKK..#.K.#..K.#.#.#, 22 ?2: .#.K#.#KK.K##....K.K.#..K.#, 3 ?3: #.#.#.K.KK.K.K.#.##.#...K.K, 23

?$: #K..#.K#.K.K#KK#.#.K..#KK##, 1< ?": .KK#K.##.K#.KK.#K#KK#.#..#., 2" ?*: KK.K.###K.KK#KK#.#.#.##.K.., 1B ?<: K#..KKK.#.##KK......##....., 1" ? : ...K#.#KK#.K#.#KK#.K#.#...K, 1$ ?B: K..##.KK#.K...K..#K##.##.KK, 1$?1!: .K..K#K#KK#K##K#.##K#K.#K#K, 23

Te%$ Da$a O&$ &$'

?1: * and 1$ ?2: " and < ?3: NK 9N

?$: 1* and 1 T and 2* ?": < and 1*T 21 and 23 ?*: < and 13 ?<: B and 21 ? : " and 23T < and 21T 1! and 1 T 13 and 1" ?B: " and 23T $ and 2$?1!: NK 9N

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 86/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 87/499

Sam le In &$'

ine 1: 2, ", $", $, D3! ine 2: $, 2, B!, 2, 1 !, 2, 2<!, 2, !

Sam le O&$ &$'

Kutput 1: *&BBB, 1&"3" Kutput 2: !, !

Programming Problem #* ! Trea%&re I%lan+ ! E" er$o

Te%$ Da$a In &$'

?1: 3, 2, $", 2, 3!, 2, *! ?2: 3, 2, D$", 2, D3!, 2, D*!

?3: 3, 2, B!, 2, 1 !, 2, 2<! ?$: 3, 2, DB!, 2, D1 !, 2, D2<! ?": 3, 2, 3!, 2,3!, 2, 3! ?*: $, 2, D$", 2, DB!, 2, D1 !, 2, 1 ! ?<: $, 2, 3*!, 2, D3*!, 2, <2!, 2, D<2! ? : $, 2, D$", 2, D13", 2, D22", 2, D31" ?B: $, 2, 3B!, 2, <"!, 2, D12!, 2, D1 !?1!: ", 2, !, 2, B!, 2, DB!, 2, D2<!, 2, D1 !

Te%$ Da$a O&$ &$'

?1: $&1$*2*, $&1$*2* ?2: $&1$*2*, D$&1$*2* ?3: D2, ! ?$: D2, ! ?": "&1B*1", 3 ?*: D2&" "< , D3&$1$21 ?<: , ! ? : !,! ?B: &$*$1!1, &2*<B$B?1!: !, 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 88/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Cuartas Competencias de Programación'KK=

Intermedio

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 89/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&Categoría Int$#'$,&+ Universidad UPR>B*-*'7nAutor P#+ . N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 1

ESTRE$$ASArchivos(

Input $!t#$((*!.,*tOutput NbA

#e7inición(Un observatorio astronómico requiere de un programa que analice una fotografía del cielo tomada porla noche. La información de la fotografía está almacenada en forma de tabla, donde cada elementorepresenta la cantidad de luz que se registró para cada punto. Los valores registrados van del 0 al 20,por e emplo!

0 " # 0 0 0 $ %& '" $ 0 0 0 2 "2 $ 2 ( " 0 '0 00 0 # '& # ' % 00 0 ( '2 $ ) '0 #& 0 $ '0 $ # % 0

La persona encargada de analizar la información supone que ha* una estrella en + i4 j si!

• el punto no se encuentra en las orillas de la fotografía +primero o -ltimo renglón o columna ,*

• (a5i4 j6 7 a5i '4 j6 7 a5i 7 '4 j6 7 a5i4 j '6 7 a5i4 j 7 '6) 8 9

e espera como resultado del análisis, una tabla b con un / 1 en las pare as + i4 j en las que sesupone que ha* una estrella. l resto de la tabla debe quedar lleno de espacios. La tabla bque resulta del e emplo anterior es!

' 2 " # & $ ( %'2"

#&$

Problema(

3ealice un programa en 455 que!1. Lea las dimensiones de la tabla m * n con +' m4 n .2. Lea los valores de cada elemento de la tabla a .3. 4onstru*a la tabla b.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 90/499

4. 6mprima la tabla b.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 91/499

$%emplo de .nput(

NbA = L$$# (* t*5(* ,$ un *#" &)+

$%emplo de :utput 20creen6(

' 2 " # & $ ( %'2"#&$

E( t+t*( ,$ $!t#$((*! $!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 92/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría Int$#'$,&+ Universidad UPR>B*-*'7nAutor Fu#'*n Un&)$#!&t- 2<<< Tipo de competencia P#+@#*'*"&7nProblema 2

Super *re3Input File Name: prob2.inOutput: to the screen

Description:

A character is known to its homeboys as a super freq if it occurs with frequency strictly greater than 15% ina gi en passage of te!t" #rite a program that rea$s an A &II te!t file an$ i$entifies all the 'nglishalphabet (A)*+ a),- super freqs in that te!t file" .our program shoul$ be case insensiti e"

/here will only be one passage of te!t in the input file+ an$ it will consist of a single line"

0se all characters in the file (inclu$ing spaces an$ punctuation- in calculating the frequency of aparticular alphabet character+ but you $on t ha e to compute the frequency of these 2e!tra3 characters"

Example:Input: Sally sells sea shells by the sea shore.Output: S is a super freq.

Input: How now brown cow.Output: O is a super freq.

W is a super freq.

Input: Hey Sam!

Output: here are no super freqs.

""itional notes:

/he input file will not contain any tabs+ carriage returns or other special formatting characters"

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 93/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría Int$#'$,&+ Universidad UPR>B*-*'7nAutor ACSL-1998 Tipo de competencia P#+@#*'*"&7nProblema 3

Po"!4In

=iven an e+pression in a functional language e+pressed in postfi+$ convert it toinfi+. The language "ill consist of the unar# function abs and the binar# functions!in and !a& . >ead each input as a single string' the output should have a spaceafter each comma.

Sam le Da$a sets of data' the test data has 1( sets of data/0

In &$ O&$ &$2 D$ min abs 2 1 max max max-abs-min-2, D$//, max-2, 1//

2 21 13 max min abs abs-min-2, max-21, 13///

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 94/499

Program # (, Po%$2In - In$erme+io

In &$ O&$ &$1 2 max max-1, 2/

1 2 3 max min min-1, max-2, 3//

1 2 max 3 min min-max-1, 2/, 3/

11 22 max 33 $$ min max max-max-11, 22/, min-33, $$//

! abs abs abs-abs-!//

1 D2 min abs abs-min-1, D2//

1 abs D2 min min-abs-1/, D2/

1 abs 2 abs min min-abs-1/, abs-2//

D1 abs D2 abs min abs abs-min-abs-D1/, abs-D2///

11 D2 max D33 $$ D" max min min min-max-11, D2/, min-D33, max-$$, D"///

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 95/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría Int$#'$,&+ Universidad UPR>B*-*'7nAutor ACSL-1998 Tipo de competencia P#+@#*'*"&7nProblema 4

#o!c agaloop

The botcha%aloop value of a number & is found as follo"s. irst$ convert & to base8. Call this p . ?e+t$ sort the digits of p in increasing order. Call this ' . Subtract 'from p in base 8$ of course/. >epeat the ,sort-subtract, se;uence more times$or until the digits in the result are in sorted order "hichever come first/. inall#$convert the number back to base 1(.

or e+ample$ 2 18 has a botchagaloop value of 1((8. 4t is computed as follo"s0

2 18 < 3 2 base 8/'

1. 3 2 - 2 3 < 1 '. 1 - 1 < (!'

2. (! - ! < 2('. 2( - 2 < (( '. (( - < 1!3('

and finall#$ 1!3( < 1((8 base 1(/.

?ote that there is at least one subtraction and at most subtractions.

There "ill be inputs. )ach is a positive integer less than 1$((($(((. 5rint thebotchagaloop value of each input.

Sam le In &$'

Enter number: 3$1

Sam le O&$ &$'

'4e number is: 1!!

Sam le In &$'

Enter number: 123

Sam le O&$ &$'

'4e number is: 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 96/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Cuartas Competencias de Programación'KK=

;rincipiante

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 97/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría P#&n"&p&*nt$ Universidad UPR>B*-*'7nAutor P#+ . N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 1

CON(ET0RA DE 0$$MANArchivos(

Input NbAOutput NbA

#e7inición(

La con etura de Ullman establece que si empiezas con cualquier n-mero positivo, alaplicar el siguiente procedimiento, siempre te va a dar uno!

'. mpezar con cualquier entero positivo.2. i es par, dividirlo entre dos.". i es impar se multiplica por tres +" * se le suma uno+' .#. 7or cada entero que se obtenga que no sea uno +' se vuelve a repetir los pasos 2 *

"&. 8l final, se debe obtener uno +' .

Problema(

9esarrolle un programa que le solicite al usuario un n-mero entero * comienze amostrar en pantalla los resultados de los pasos 2 * " hasta que llegue a uno.

$%emplo de corrida(

Ent#$ un n/'$#+ $nt$#+ p+!&t&)+',

2: L+ ,&)&,+ $nt#$ ,+!13 Mu(t&p(&"+ p+# 3 - ($ !u'+ 14< L+ ,&)&,+ $nt#$ ,+!2< L+ ,&)&,+ $nt#$ ,+!1< L+ ,&)&,+ $nt#$ ,+!

Mu(t&p(&"+ p+# 3 - ($ !u'+ 11: L+ ,&)&,+ $nt#$ ,+! L+ ,&)&,+ $nt#$ ,+!4 L+ ,&)&,+ $nt#$ ,+!2 L+ ,&)&,+ $nt#$ ,+!1 R$!u(t*,+ F&n*(

I'p+#t*nt$ T&$n$ u$ p+n$# (* "+##&,* $ *"t*'$nt$ "+'+ !$ )$ * u`.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 98/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría P#&n"&p&*nt$ Universidad UPR>B*-*'7nAutor P#+ . N$((&u, D. T+##$! Tipo de competencia P#+@#*'*"&7nProblema 2

5ISTO+RAMA DE PA$A#RAS

Archivos(

Input p*(*5#*!.t tOutput NbA

#e7inición(S$ u&$#$ p+,$# *"$# un &!t+@#*'* )$#t&"*( u$ &n,& u$ (* "*nt&,*, ,$ "*#*"t$#$! u$ t&

p*(*5#* ut&(&8*n,+ *!t$#&!"+!.

Problema(

D$!*##+(($ un p#+@#*'* u$ ($* p*(*5#*! ,$ un* *#" &)+ ((*'*,+ [p*(*5#*!.t t\ - 'u$!t#$ $n p*nt*((* un &!t+@#*'* +#&8+nt*( ,$ "*,* p*(*5#*. En $( *#" &)+ "*,* p*(*5#* $!t*#_ !$p*#*,* $!p*"&+ $n 5(*n"+.

$%emplo de .nput(

Un *#" &)+ u$ t$n@* (+ !&@u&$nt$$sta es una muestra de archivo

$%emplo de :utput20creen6(

P6 6>56 L9;'K 56M6

Esta ....es ..una ...muestra .......de ..arc4ivo .......

.mportante6 n&n@un* p*(*5#* !$#_ '*-+# ,$ 1 "*#*"t$#$!. C*,* p*(*5#* pu$,$ t$n$# ($t#*! '*-/!"u(*! + '&n/!"u(*!. T&$n$ u$ &n"(u&# $($n"*5$8*'&$nt+ "+'+ !$ 'u$!t#* * u` - (* &n,$nt*"&7n $nt#$ (* p*(*5#* - (*!t$#&!"+!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 99/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría P#&n"&p&*nt$ Universidad UPR>B*-*'7nAutor ACSL-1998 Tipo de competencia P#+@#*'*"&7nProblema 3

Cabracci

The terms of the ibonacci se;uence are the numbers 1$ 1$ $ 2$ $ 8$ 12$ .... Thene+t term in the se;uence is found b# summing the previous t"o terms.

?umbers in a (abracci se;uence are formed b# summing the previous three termsand subtracting 2. or e+ample$ the Cabracci se;uence starting "ith 1$ ($ and isas follo"s0 1$ ($ $ $ 2$ 3$ 8$ 1 $ $ ....

There "ill be sets of data. )ach set consists of four integers0 a1$ a $ a2$ and ?.The first three numbers are the first three terms of a Cabracci se;uence. Thefourth number is the term to print. or each input set$ print the ?th term of theCabracci se;uence defined b# the first three numbers in the input set.

Sam le In &$' Screen/

Enter $ numbers: 1 ! $ B

Sam le O&$ &$' Screen/

'4e number is: 2"

Sam le In &$' Screen/

Enter $ numbers: 1 1 2 "

Sam le In &$' Screen/

'4e number is: 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 100/499

Programming Problem = S Cabracci > Principiantes

Te%$ Da$a In &$'

?1: 1, 1, 1, 1!?2: 1, 3, ", 12?3: D1, D2, D3, 1!

?$: 2, $, *, ?": ", 1!, 1", *

Te%$ Da$a O&$ &$'

?1: D"1?2: *<!?3: D3 *?$: B1?":

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 101/499

Fecha 2:b*5#&(b2<<3 Nombre de la competencia 4t*! C+'p$t$n"&*! Int$#un&)$#!&t*#&*!Categoría P#&n"&p&*nt$! Universidad UPR>B*-*'7nAutor Fu#'*n Un&)$#!&t- 1 Tipo de competencia P#+@#*'*"&7nProblema 4

#alanced Paren! e"e"

Input PARENTESIS.T;TOutput NbA SCREEN%

Description:

#rite a program that checks an arithmetic e!pression for balance$ parentheses" Fore!ample+ e!pressions containing the sequences ( - an$( ( ( - ( - - - are balance$ but (--( an$ (((-- are not"

/he input file contains a series of e!pressions+ one per line4 each line is en$e$ with acarriage return" For each e!pression" $eci$e only if it has balance$ parentheses" 'chothe e!pression an$ in$icate whether it #' )FO67'8 or NO/ #' )FO67'8"

Example:

Input:#2$%&#2&&##'($2&)#*'%&&

*+,&%)2&

Output:#2$%& -S WE '/O01ED#2&& -S O WE '/O01ED##'($2&)#*'%&& -S WE '/O01ED*+, -S WE '/O01ED&%)2& -S O WE '/O01ED

""itional notes:

/he program $oes not ha e to account for the rest of the e!pression+ that is+ whether theoperators an$ operan$s are legal or not" It is require$ to test only for parentheses"

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 102/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Terceras Competencias de Programación'KK'

;rincipiante

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 103/499

Fecha 2<b*5#&(b2<<2 Nombre de la competenciallllllll Categoría P#&n"&p&*nt$ Universidad UPR> B*-*'7nAutor llllllllll Tipo de Competencia lllllllllll Problema ( Algoritmos lllllllllllllllllll

Common $e!!er"

Problema(

K#&t$ * p#+@#*' t *t t*?$! t + +#,! *n, &n,! *n- "+''+n ($tt$#! t *t t $- *)$. F+# $ *'p($6 t $+#,! "+'put$#d *n, p#+@#*'d *)$ t $ ($tt$#! +d6 'd6 pd6 #d6 &n "+''+n. T $ +utput ! +u(, 5$

5+t +#,! &t *(( "+''+n ($tt$#! &n "*p&t*(!. N$&t $# +#, &(( *)$ '+#$ t *n ($tt$#!.

$%emplo de .nput(

Enter two words : computer pro ram

$%emplo de :utput(

cKMPute5 P5K 5aM

T$!t -+u# p#+@#*' &t t $ +((+ &n@ p*&#! + +#,!

4ello allbye all

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 104/499

Fecha 2<b*5#&(b2<<2 Nombre de la competenciallllllllll Categoría P#&n"&p&*nt$! Universidad UPR> B*-*'7nAutor llllllllllllll Tipo de competenciallllllll Problema ( Algoritmos lllllllllllll

S!ring Compre""ion

Problema(

C+n!&,$# t $ !t#&n@ AAAABCCCCCDDDDd "+n!&!t&n@ + *(p *5$t&" " *#*"t$#! +n(-. T &!($n@t 14. S&n"$ t $ !t#&n@ "+n!&!t + *(p *5$t&" " *#*"t$#! +n(-6 ,up(&"*t$ " *#*"t$#! "*n 5$*n, #$p(*"$, &t * ,up(&"*t&+n *"t+# n. K&t t &! t$" n& u$ t $ !t#&n@ "*n 5$ "+'p#$!!$, *n,#$p#$!$nt&n@ 5- 4AB C4Dd. T $ "+'p#$!!$, !t#&n@ &! + ($n@t . K#&t$ * p#+@#*' &" t*?$&n "+'p#$!!$, +#' *n, #$"#$*t$! t $ +#&@&n*( un"+'p#$!!$, !t#&n@.

$%emplo d .nput(

T $ !t#&n@ &(( 5$ + t $ +#'*t nA d $#$ n6 t $ ,up(&"*t&+n *"t+#6 &! *n &nt$@$# 5$t $$n 2 **n, A &! *n upp$#"*!$ *(p *5$t&" " *#*"t$#. A !t#&n@ '*- "+nt*&n !&n@($ " *#*"t$#! n+t p#$ &,up(&"*t&+n *"t+#. I t &! $#$ n+t t $ "*!$6 +# &n!t*n"$6 t $ !t#&n@ AABCDEd +u(, 5$ "+'p#AABCDEd +u(, 5$ "+'p#$!!$, t+ 2ABCDEd.T $ '* &'u' ($n@t + *n &nput !t#&n@ &! < " *#*"t$#!.

$%emplo de :utput(

T $ un"+'p#$!!$, !t#&n@6 4< " *#*"t$#! p$# (&n$ &t '*- 5$ n$"$!!*#- t+ 5#$*? *n un"+'p#$!!$, !t+)$# 'u(t&p($ (&n$!%.

$5ample &

.nputEntre el strin : 3&4 !

:utput666>>>>=======$5ample '

.nputEntre el strin : 22 !&"18 ?

:utput======================6666666CJJJJJJJJJJJJJJJJJJ =

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 105/499

Fecha 2<b*5#&(b2<<2 Nombre de la competencialllllllll Categoría P#&n"&p&*nt$ Universidad UPR>B*-*'7nAutor P#+ . N$((&u, D. T+##$! Tipo de Competencialllllllllll Problema ( Algoritmos llllllllllllllll

DECIMA$ COMP$EMENTS

#e7inición(

Mu" *! "+'put*,+#*! p*#* #$p#$!$nt*# un n/'$#+ n$@*t&)+6 (+ *('*"$n*n "+'+ !u "+'p($'$nt+ *#&t' t&"+. E!t+ p$#'&tu$ *( $ $"tu*# un* #$!t*6 !$ pu$,* ut&(&8*# (* !u'* - +5t$n$# $( #$!u(t*,+ $!p$#*,+. P*#* +5t$n$# $( "+'p($'$nt+ ,$ un/'$#+ $n nu$!t#+ !&!t$'* nu' #&"+ ,$"&'*(6 t$n$'+! p#&'$#+ u$ "*("u(*# $( "+'p($'$nt+ 5*!$ nu$)$ ,$( n/'$#+. E!t+ $!6"u*nt+! n/'$#+! *(t*n p*#* u$ $( ,`@&t+ !$ "+n)&$#t* $n nu$)$. P+# $0$'p(+ $( "+'p($'$nt+ 5*!$ nu$)$ ,$ $! 46 ,$ 3 ,$ 3 $! ,$ < $! - *!` p+# $( $!t&(+. E( "+'p($'$nt+ 5*!$ ,&$8 !$ +5t&$n$ *( !u'*#($ un+ *( "+'p($'$nt+ 5*!$ nu$)$. E( p#+"$,&'&$nt+ u$ $0$"ut* un* "+'put*,+#* p*#* #$!t*# '$,&*nt$ (* !u'* $! $( !&@u&$nt$

1. Sup+n@*'+! u$ t$n$'+! (* !&@u&$nt$ #$!t* :142>4 1:2. C+n)$#t&'+! $( !u!t#*$n,+ 4 1: $n "+'p($'$nt+ 5*!$ nu$)$ (+ "u*( ,* 1 3.3. L$ !u'*'+! un+ *( #$!u(t*,+ 1 3 1X 1 44. Su'*'+! *'5+! n/'$#+! :142 1 4X1132:. E(&'&n*'+! $( /(t&'+ ,`@&t+ * (* &8 u&$#,* - +5t$n$'+! $( #$!u(t*,+ 132:

Problema(

D$!*##+(($ un p#+@#*'* u$ !+(&"&t$ *( u!u*#&+ un* #$!t*. Lu$@+ 'u$!t#$ $n p*nt*((* t+,+! (+! p*!+! n$"$!*#&+!+5t$n$# $( #$!u(t*,+ ut&(&8*n,+ $( "+'p($'$nt+ 5*!$ 1<.

$%emplo de .nput(

Ent#$ un* #$!t*=' > & =

$%emplo de :utput(

N/'$#+ !$($""&+n*,+ 1 3C+'p($'$nt+ 5*!$ nu$)$ 4:C+'p($'$nt+ 5*!$ ,&$8 4R$!u(t*,+ ,$ (* !u'* 11 4R$!u(t*,+ 1 4

N+t*[ % Espacio en >lanco

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 106/499

Fecha <4b2<b2<<2 Nombre de la competencialllllllllll Categoría P#&n"&p&*nt$ Universidad UPR>B*-*'7nAutor Ant+n&+ Ju$#t*! Tipo de Competenciallllllll Problema ( Algoritmos lllllllllllll

#ANNER N0MERICO

Problema(

D$!*##+(($ un p#+@#*'* u$ "+n)&$#t* un ,*t+ nu' #&"+ $nt#*,+ p+# p*nt*((* $n un [B*nn$#\. S7(+ !$ *"$pt*#_n n/'(+! !`'5+(+! - >. E( t*'*9+ ,$( ,`@&t+ ,$5$ !$# ,$ : "+(u'n*! p+# &(*!. A "+nt&nu*"&7n un $0$'p(+ ,$ "*,* ,`@&t+.

!! 11 !! 222222 333333 4 !! 4 !! 555555 6666661111 !! !!!!! 2 !!!!! 3 4 !! 4 !! 5 !!!!! 6 !!!!!1 ! 11 !! 222222 333333 4 $$ 4 $$ 555555 666666!! 11 !! 2 !!!!! !!!!! 3 !!! 4 !! !!!!! 5 6 !!!! 6111111 222222 333333 !!! 4 !! 555555 666666

0!!!!! 888888 999999 000000 !!FF!! !!!!!! !!!!! ! 8 !!!! 8 9 !!!! 9 0 0 !FF!! !!!!!! !!!!! ! 888888 999999 0 CC FFFF DDDDDD !!!!! ! 8 !!!! 8 !!!!! 9 0 0 !FF!! !!!!!! !!!!! ! 888888 999999 000000 !!FF!! !!!!!!

E( !`'5+(+ < #$p#$!$nt* un $!p*"&+ $n 5(*n"+.

$%emplo de .nput(

Ent#$ un n/'$#+ 3

$%emplo de :utput(

++ ====== LLLLLL ++ = L L ++++++ ====== LLLLLL ++ = L L ++ ====== LLLLLL

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 107/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Terceras Competencias de Programación'KK'

Intermedio

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 108/499

F$" * 2<b*5#&(b2<<2 N+'5#$ ,$ (* C+'p$t$n"&* lllllll C*t$@+#`* Int$#'$,&+ Un&)$#!&,*, UPR> B*-*'7nAut+# lllllllll T&p+ ,$ C+'p$t$n"&* lllllllllllll P#+5($'* A(@+#&t'+! llllllllllllll

6E$$ ORDERED N0M#ERS

#e7inición(

T $ nu'5$# 13 &! "*(($, $((>+#,$#$, 5$"*u!$ t $ ,&@&t! &n t $ nu'5$# 1636 % &n"#$*!$ #+' ($ t t+ #&@ t 1 f3 f %. nu'5$# 3: &! n+t $((>+#,$#$, 5$"*u!$ : &! (*#@$# t *n .

Problema(

K#&t$ * p#+@#*' t *t &(( &n, *n, ,&!p(*- *(( p+!!&5($ t #$$ ,&@&t $((>+#,$#$, nu'5$#!. R$p+#t t $ t+t*( nu'5$# + ,&@&t $((>+#,$#$, nu'5$#!.

$%emplo de :utput(

$5ample

T $ t #$$ ,&@&t $(( +#,$#$, nu'5$#! *#$123 124 12 12: 12 12 12 13413 13: 13 13 13 14 14: 1414 14 1 : 1 1 1 1: 1:4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 44 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4: : :

T $ t+t*( nu'5$# &! hh

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 109/499

Fecha 2<b*5#&(b2<<2 Nombre de la Competencia llllllllllll Categoría Int$#'$,&+ Universidad UPR> B*-*'7nAutor llllllllll Tipo de Competencia lllllllllllll Problema ( Algoritmos llllllllllllllll

5ORI7ONTA$ 5ISTO+RAM

Problema(

K#&t$ * p#+@#*' t *t *""$pt! * !$t + ,&@&t! < t+ % *! &nput *n, p#&nt! * +#&8+nt*( &!t+@#*' #$p#$!$nt&n@ t$*" ,&@&t.

T$!t -+u# p#+@#*' &t t $ !$t + 13 ,&@&t!16 1626 66 61636 6 6 6 6<

$%emplo de .nput(

Enter a Number: 12Enter 12 di its:1,<,2,B,*,<,1,3,<,",<,B

$%emplo de :utput(

<1 e e2 e3 e4

e: e

e e e e

e e

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 110/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 111/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 112/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Terceras Competencias de Programación'KK'

23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 113/499

Fecha 2<b*5#&(b2<<2 Nombre de la Competencia lllllllllll Categoría E p$#t+ Universidad UPR>B*-*'7nAutor lllllllll Tipo de Competencia lllllllllllll Problema ( Algoritmos lllllllllllll

898 C5EC ER C5A$$EN+ER

Problema(

E *'&n$ t $ : : " $"?$#5+*#, 5$(+ *n, n+t$ t *t t $ !& " $"?$#! *#$ *##*n@$, +n t $ 5+*#, !+ t *t + n *n, +n(-+n$ &! p(*"$, &n $*" #+ *n, $*" "+(u'n6 *n, t $#$ &! n$)$# '+#$ t *n +n$ &n *n- ,&*@+n*(. D&*@+n*(! #un #+' !+t+ n+#t $!t *n, !+ut $!t t+ n+#t $*!t *n, &n"(u,$ *(( ,&*@+n*(!6 n+t 0u!t t $ '*0+# t +.%

C+(u'n1 2 3 4 :

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>1 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>2 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>3 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>4 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>: >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

T $ !+(ut&+n ! + n *5+)$ &! ,$!"#&5$, 5- t $ !$ u$n"$ 2 4 : 1 3 6 &" @&)$! t $ "+(u'n p+!&t&+n! + t $ " $"?$#! +# $#+ #+' 1 t+ :.

5K 1 2 3 $ " *

CK 7MN 2 $ * 1 3 "

T &! &! +n$ !+(ut&+n t+ t $ : : C $"?$#! C *(($n@$. K#&t$ *! p#+@#*' t *t !$*#" $! *n, &n,! *(( un& u$ !+(ut&+n! !$t+ t $ : : C $"?$#! C *(($n@$. P#&nt +ut t $ !+(ut&+n u!&n@ t $ "+(u'n n+t*t&+n ,$!"#&5$, *5+)$ *n, "+unt t $ t+t*( n+ !+(ut&+n! +un, &n"(u,&n@ #$ ($"t&+n *n, #+t*t&+n!%.

$%emplo de :utput(

2 $ * 1 3 "3 * 2 " 1 $

'LE5E 65E ;K 7'9KN; 'K 'LE *#* CLEC E5; CL6 EN E.

<

<

<

<

<

<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 114/499

F$" * 2<b*5#&(.2<<2 N+'5#$ ,$ (* "+'p$t$n"&* llllll C*t$@+#`* E p$#t+ Un&)$#!&,*, UPR>B*-*'7nAut+# N$((&u, D. T+##$! T&p+ ,$ "+'p$t$n"&* llllllllll P#+5($'* A(@+#&t'+! llllllllllllllllll

N;MERO OC0$TOArchivos(

Input OCULTO.INPOutput NbA

#e7inición(

D$ *"u$#,+ * un* t*5(* ,*,* ,$ )*(+#$!6 ,$t$#'&n$ "u*( $! $( n/'$#+ +"u(t+. C*,* $! u$'* ,$ p&!t*! "+n (*! u$ u!t$, p+,#,$,u"&# un n/'$#+ "+'pu$!t+ p+# "u*t#+ "& #*! ,&!t&nt*! $($@&,*! ,$( < *( %6 u$ n+ $'p&$8* "+n "$#+. En (* "+(u 5&$n% &n,&"*'+! "u_nt+! ,`@&t+! *- *((` $n "+'/n "+n $( n/'$#+ 5u!"*,+ - $n (* '&!'* p+!&"&7n. En (* "+(u'n* R ,$#$@u(*#% !$ &n,&"* (* "*nt&,*, ,$ ,`@&t+! $n "+'/n p$#+ $n p+!&"&7n &n"+##$"t*. S& $n *(@/n "*!+ $n"u$nt#* t,`@&t+! u$ +#'*n $( n/'$#+ '&!t$#&+!+ - n+ ,* "+n $( #$!t*nt$ u$ n+ $! n&n@un+ ,$ (+! ,`@&t+! u$ &nt$#)&$n$n $n/'$#+!>p&!t*% ,$5$#_ 5u!"*# "u_( $! $( ,`@&t+ u$ n+ +#'* p*#t$ ,$ ,&" +! n/'$#+!>p&!t*. S& !$ t#*t* ,$ un /n&"+ n*u!$nt$6 !$ !$#_ $( "u*#t+ ,`@&t+ 5u!"*n,+.

EHEMPLOS

E( n/'$#+ +"u(t+ $! :1 <

B R

1<2<

12<1:

11<1

11<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 115/499

Problema(

D$!*##+(($ un p#+@#*'* u$ ($* un* t*5(* ,$ un *#" &)+ ,$ Input - 'u$!t#$ "+'+ Output $( n/'$#+ !$"#$t+.

$%emplo de .nput(

4 2 < 1

3 < 2 4 1 2 1 2

3 4 2 <$%emplo de :utput(

EL NÚMERO OCULTO ES 1 32$%emplo de otras tablas con sus respuestas(

N+t*• X E!p*"&+ $n B(*n"+

B R

11231

<1<3:

2<4

212<4

EL NUMERO OCULTO ES 43 2

B R

<1<42

<<34

<1<14

11<4

EL NUMERO OCULTO ES 21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 116/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 117/499

Fecha( 2<<*5#&(<2<<2 Nombre de la competencia( llllllllllllllllllllll Categoría( E p$#t+ Universidad( UPR>B*-*'7nAutor( P#+ . N$((&u, D. T+##$! Tipo de competencia( llllllllllllllllllllllllll Problema ( Algoritmos( llllllllllllllllllllllllllllllllll

M0$TIP$ICACI<N POR E$ M/TODO DE $A RE(I$$A

Archivos(

Input NbAOutput NbA

#e7inición(En (* In@(*t$##* ,$( !&@(+ ;VI6 (+! $!tu,&*nt$! ,$ '*t$'_t&"*! u!*5*n un !&!t$'* ,$ 'u(t&p(&"*"&7n u$6 *un

pu$,* p*#$"$# un p+"+ &n"7'+,+6 ,* (* #$!pu$!t* "+##$"t* #_p&,*'$nt$. S$ ((*'* $( ' t+,+ ,$ (* #$0&((* - +p$#* ,$ (*!&@u&$nt$ +#'*.

Sup+n@*'+! u$ !$ ,$!$* 'u(t&p(&"*#&'= p+#+ ,

&4 D&5u0*'+! un* '*t#&8 ,$ 3 3 - $!"#&5&'+! un+ ,$ (+! n/'$#+! $n (* p*#t$ ,$ *##&5* - $( +t#+ $n (* p*#t$ ,$ *5*0+T*'5& n ,&)&,&'+! ,&*@+n*('$nt$ "*,* un* ,$ (*! "$(,*!.

1 2 3

4

:

'4 S$ 'u(t&p(&"* $( n/'$#+ &n*( ,$ "& #* !up$#&+# 3% p+# "*,* un+ ,$ (+! n/'$#+! ,$ (* "& #* u$ $!t_ * (* ,$#$" *. #$!u(t*,+ !$ *('*"$n* $n (* "$(,* $n ,+n,$ &nt$#!$"*n. S& $( #$!u(t*,+ ,$ (* 'u(t&p(&"*"&7n $! '*-+# ,$ nu$)$6 !$ $( !$@un,+ ,`@&t+ $n (* p*#t$ !up$#&+# ,&*@+n*(. Su -* *5`* un n/'$#+ $n $!* p+!&"&7n6 !$ pu$,$n !u'*#. E!$ #$p&t$ "+n (+! +t#+! ,+! ,`@&t+! 1 -2%.

1 2 3

<4

< 12 4

< 1<

1

<:

12

1:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 118/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 119/499

Fecha(<4<2<<2<<2 Nombre de la competencia( lllllllllllllllllllllll Categoría( E p$#t+ Universidad( UPR>B*-*'7nAutor( P#+ . Hu*n M. S+(_ Tipo de competencia( lllllllllllllllllllllllllll Problema ( Algoritmos( llllllllllllllllllllllllllllllllllll

5TM$ CODE OPTIMI7ER

A(@un+! $,&t+#$! ,$ p_@&n*! ,$ Int$#n$t "+(+"*n t*@! ,$ JTML #$,un,*nt$!. In"(u!&)$ $ &!t$n t*@! "+n "+nt$n&,E0$'p(+ fPZ fbPZ. E!t$ $! un t*@ u$ *5#$ - "&$##* un p_##* + "+n un $!p*"&+ *,$nt#+. Ot#+ p+!&5($ p#+5($'* $!$n"+nt#$'+! un p_##* + u$ *5#$ - "&$##* - u$ !7(+ t&$n$ $!p*"&+!6 t*5! - $nt$#. D$nt#+ ,$ JTML $ &!t$n t*@! #$,P+# $0$'p(+ $n un* t*5(* t$n$'+! t*@! ,$ (* !&@u&$nt$ '*n$#* fTABLEZ fTDZ1. "+nt$n&,+fbTDZfTRZfTDZ2.C+nt$n&,+fbTDZfbTABLEZ. E( t*@ fbTDZ$! #$,un,*nt$ -* u$ n+ *"$ ,& $#$n"&* !& $!t_ + n+.

JTML n+ "+n!&,$#* (+! $nt$#! n+ (+! $!p*"&+! '/(t&p($!. P*#* JTML6 n $!p*"&+! X 1 $!p*"&+. L+! $nt$#! - t*5! n+ p*#* JTML.

Su p#+@#*'* ,$5$ ($$# un *#" &)+ ,$ t$ t+ "+n "+nt$n&,+ $n JTML - ,$5$ $(&'&n*# (+! !&@u&$nt$! t*@! #$,un,*nt$fbTDZ6fbOPTIONZ6 fbULZ6 fbTJZ - fbLIZ. A,$'_! ,$5$ $(&'&n*# (+! t*@! u$ t$n@*n $!p*"&+!6 t*5! - $nt$# !+(*'$$0$'p(+ fPZ fbPZ%. S& !u p#+@#*'* $n"u$nt#* '_! ,$ un $!p*"&+ $n 5(*n"+6 $nt$# + t*56 $(&'&n*#_ $( $ "$!+. Su pt*'5& n "*'5&*#_ t+,*! (*! +"u##$n"&*! ,$ (+! !&@u&$nt$! p*t#+n$! 'n$'7n&"+! p+# $0$'p(+ nt&(,$% p+# p*t#+n$!p+# $0$'p(+ 241%. V$* (* !&@u&$nt$ t*5(* ,$ $ u&)*($n"&*!

.NPUT $N ;T-! :UTPUT $N ;T-! CARWCT$R Nt&(,$a 6 nt&(,$a 2< a 241a q 9A*"ut$a **"ut$a 1 3a 22 a _E*"ut$a $*"ut$a 2<1a 233a I*"ut$a &*"ut$a 2< a 23 a r `O*"ut$a +*"ut$a 211a 243a Ó 7U*"ut$a u*"ut$a 21 a 2 <a Ú /

$%emplo(

.nput(fJTMLZfTITLEZE0$'p(+fTITLEZfPZ fbPZfPZE!t+ $! un p_##* +

fbPZfTABLEZfTJZ T`tu(+ ,$ (* t*5(*fbTJZfTDZ Nt&(,$a*'$ B+0+t u*"ut$afbTDZ fbTABLEZ

fbJTMLZ

:utput(fJTMLZfTITLEZE0$'p(+fTITLEZfPZE!t+ $! un p_##* +fbPZfTABLEZfTJZ T`tu(+ ,$ (* t*5(*fbTRZfTDZ 2< aAME B+0+t 2 <fbTABLEZfbJTMLZ

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 120/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Primeras Competencias de Programación'KKK

23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 121/499

C*t$@+#`* E;PERTO UPRB P#+@#*''&n@ C+nP#+5($' !$t

Aut+# N$((&u, D. T+##$! Ap#&( 2 6 2

PIR=MIDES N0M/RICAS

D$!*##+(($ un p#+@#*'* u$ "+'p($t$ un* p&#_'&,$ "+(+"*n,+ un n/'$#+ ,$ un* + '_! "& #*! $n "*,* "*!&((*6 ,'+,+ t*( u$ "*,* "*!&((* "+nt$n@* (*! !u'*! ,$ (+! ,+! n/'$#+! ,$ (*! "*!&((* &n $#&+#$!. D$nt#+ ,$ (* p&#_'&,$ !$$!t*5($"$#_n un+! n/'$#+! @u`*! u$ *-u,*#_n * #$!+()$# $( p#+5($'*. L+! punt+! * "+n!&,$#*# !+n (+! !&@u&$nt$!

1. S$ &n,&"*#_n +" + % n/'$#+! p+# p&#_'&,$.2. L* p&#_'&,$ t&$n$ +" + % &(*!.3. P*#* "*,* &(* p+,#`* *5$# *!t* un '_ &'+ ,$ t#$! n/'$#+! p#$>$!t*5($"&,+!.4. N+ t+,*! (*! &(*! t&$n$n u$ t$n$# un n/'$#+ $!t*5($"&,+.. P+,#`*n *5$# *!t* un '_ &'+ ,$ t#$! 3% &(*! "+'p($t*'$nt$ $n 5(*n"+ p+# p&#_'&,$.

E0$'p(+ Pir*mide .nicial P&#_'&,$.&n%

Pir*mide Final P&#_'&,$.+ut%

43

''V 2<

1<124

+L

1<3

,

22&&&,

31 33''1 11

:

2:3:2<

4&'

=

1

44 14

''V

+L,

&&&, ''

&'

=

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 122/499

.nput(

!22B !! ! !*< ! $ !! ! ! ! !

! 1* ! 11 ! 2212 ! ! ! ! ! !! ! ! ! 3 ! ! !

:utput(

$3<22B 2!12$ 1!" 1!3*< "< $ ""3* 31 2* 22 332! 1* 1" 11 11 2212 < $ < 1" $ $ $ 3 1 * B

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 123/499

C*t$@+#`* E;PERTO UPRB P#+@#*''&n@ C+nt$!tP#+5($' !$t

Aut+# N$((&u, D. T+##$! Ap#&( 2 6 2<<<

$A AMENA7A

En un t*5($#+ ,$ *0$,#$8 !$ "+(+"*#_n p&$8*! #$p#$!$nt*,*! "+n (*! !&@u&$nt$! ($t#*! H6 6L6M - N. E!t#$p#$!$nt*n un #$-6 un* #$&n*6 un* t+##$6 un *( &( - un "*5*((+ *un u$ n+ n$"$!*#&*'$nt$ $n p#+@#*'* * "#$*# ,$"u*( p&$8* #$p#$!$nt* "*,* ($t#*. L+! punt+! * "+n!&,$#*# !+n (+! !&@u&$nt$!

1. Pu$,$n *5$# ,$ ,+! * t#$! "*!&((*! "+n $( )*(+# "$#+.2. S&$'p#$ *5#_ un* !+(u"&7n.3. C*!&((* )*"̀ * !$ #$p#$!$nt*#_ "+n un *!t$#&!"+ $n $( *#" &)+ ,$ $nt#*,*.4. L*! ($t#*! $!t*#_n $n $( *#" &)+ $n '*-/!"u(*!.. L*! p&$8*! !+n ,$ un !+(+ "+(+#a p+# (+ t*nt+ pu$,$n $!t*# p$@*,*! un*! ,$ (*! +t#*!.

E0$'p(+ Posición en el tablero

8 K

D K

! - N K

Resultado

8XR$-aD XD*'*a! XT+##$a- XC*5*((+aNXA( &(

.nput( T*5($#+.&n%

. e e e e e e ee e e e e e e ee e e e e e e eH e e e < e e ee e e e e e e e

e e e e e e ee e < e e e e e

L e M e N < e e

Output T*5($#+.+ut%

8XR$-aD XD*'*a! XT+##$a- XC*5*((+aNXA( &(

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 124/499

C*t$@+#`* E;PERTO

Aut +# Hu*n M. S+(_ S(+*n

UPRB P#+@#*''&n@ C+nt$!tP#+5($' !$t

Ap#&( 2 6 2<<<

DNS C*" $

Addre"" Re"olu!ion Simula!ion

L+! DNS D+'*&n N*'$ S$#)$#!% '*n$0*n (*! ,&#$""&+n$! ,*,*! ,$ *"u$#,+ * (* "(*!& &"*"&7n ,$( !&t&+un KAN (*! #$,$! !$ ,&!t#&5u-$n p+# !u5#$,$! - $!*! !u5#$,$! pu$,$n t$n$# +t#*! !u5#$,$!. En un* ,&#$""&"+'+ $!t* (*511<*p"."u5.up#."(u.$,u6 EDU $! (* "(*!& &"*"&7n ,$( !&t$6 CLU $! !u5n$t ,$ EDU6 UPR $! CLU6 CUB $! un !u5n$t ,$ UPR - $( (*511<*p" $! un !u5n$t ,$ CUB. C*,* ,&#$""&7n !$ "+n)&$#t$ $n unoctet un@#up+ ,$ 4 n n/'$#+! u$ #$p#$!$nt*n (* ,&#$""&7n #$*(% p*#$"&,+ * $!t$ 21 . 1. :.1.

L+! DNS p+!$$n un _#5+( "+n t+,*! (*! ,&#$""&+n$! u$ $ &!t$n $n !u _#$*. E((+! !$ $n"*#@*n ,$ t#*,u"&,&#$""&7n $n p*(*5#*! * un* ,&#$""&7n nu' #&"* - $!t*5($"$# (* "+n$""&7n. E!t$ p#+"$!+ !$ ((*'* #$!+(,&#$""&7n *,,#$!! #$!+(ut&+n%. L+! DNS ut&(&8*n t+,* !u '$'+#&* "+'+ un &n'$n!+ "*" $. L*! ,&#$""&!+(&"&t*,*! !$ 5u!"*n p#&'$#+ $n "*" $ - ,$ n+ $!t*# !$ 5u!"*n $n $( _#5+(.

U!t$, "#$*#_ un p#+@#*'* u$ ($$#_ ,+! *#" &)+! ,$ $nt#*,*6 un+ "+n (*! #*'*! ,$( _#5+( - +t#+ "+n (+! p$,&DNS )$# $0$'p(+%. C#$*#_ un "*" $ p*#* @u*#,*# (*! ,&#$""&+n$! '_! !+(&"&t*,*! *( DNS - @$n$#*#_,$ !*(&,*. $l *rbol tendr* un m*5imo de ramas4 $l tamaIo del cache ser* el primer n)mero GueapareQca en reGuest4in y puede ser de K S 'K+L direcciones46

Archivos de entrada(#atabase4in 2Contiene la estructura del *rbol6.EDU bINTER bCLU bbUPR bbbCUB bbbb(*511<*p" bbbCRC bbbCUTPO.MIL bNSA bNAVY bbNSKC bbbBISMAR l2.COM bYAJOO bLYCOS

ReGuest4in 2Eueue de las direcciones a procesar62"*C7>&upr&clu&eduC7>&upr&clu&eduIa4oo&comIa4oo&eduMarcos&lab12&prtc&netC7>&upr&clu&edu

:UTPUT4:UTCub&upr&clu&edu =ept4: $Cub&upr&clu&edu cac4e 4it: ?1Ia4oo&com =ept4: 2Ia4oo&edu Error $!$ Not foundC7>&upr&clu&edu cac4e 4it: ?2

.COM

LYCOSYAJOO

.EDU

NSKC

NSA NAVY

.MIL

DNS

LAB11<APC

UPR

CLU

CUTPOCUB

CRC

INTER

BISMAR2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 125/499

(:

% pies

plataformas!

trompa!

piedra!

entrada cueva! 9

C*t$@+#`* E p$#t+ UPRB P#+@#*''&n@ C+nt$P#+5($' !$t

Aut+# J$"t+# - R&"*#,+ M*#t`n$8 Ap#&( 2 6 2<<

P#+@#*'* p#+@3. *#" &)+ ,$ $nt#*,* p#+@3.&n

archivo de salida( prog=4 out

Problema #3: El elefan!e *urio"o

Un $($ *nt$ $!t_ 'u- u#&+!+ p+# u$ un*! #*t*! *n "+n!t#u&,+ un* "u$)* $n $( +n,+ ,$ !u p+8+ ,$ *@u* #$!"*. P+# (+ u$ $!t$ * ,$"&,&,+ '$t$# (* t#+'p* $n $( *@u* - t*p*# (* $nt#*,* ,$ (* "u$)* "+n un* ,$ (*! p&$,#*! u$ !$ $n"u$nt#*n p+# $( _#$*.D$!* +#tun*,*'$nt$6 $($ *nt$ !$ $n"+nt#7 "+n ,+!

p#+5($'*! p#&'$#+6 "+'+ $( p+8+ $! 'u- p#+ un,+ n+ *("*n8* (* $nt#*,*6 p+# (+ u$ t$n,#_ u$ !+(t*# (* p&$,#*6 - !$@un,+6u$ n+ (* pu$,$ !+(t*# ,&#$"t*'$nt$6 p+# u$ (*! #*t*!6 "*n!*,*! ,$ t*nt+

5u"$*#6 *n "+n!t#u&,+ *,$'*! un*! p(*t* +#'*! &n"(&n*,*! $n (*! u$*"$n $!"*(* *( $nt#*# - !*(&# ,$( *@u*.

Cu*n,+ $( $($ *nt$ !u$(t* (* p&$,#*6 $!t_ *"u'u(*,* )$(+"&,*,6 - #$5+t* "u*n,+ " +"* "+n un* ,$ (*! p(*t* +#'*!.V$#,*,$#*'$nt$6 "*,* )$8 u$ (* p&$,#* "*$6 $!t* *"u'u(*,* )$(+"&,*,. P+# +t#+ (*,+6 (* p&$#,$ "u*n,+ !u5$ + "u*n,+ 'u$)$ p*#* (* &8 u&$#,* + (* ,$#$" *. O5!$#)$ $( !&@u&$nt$ $0$'p(+

L* p&$,#* "*$ 2d6" +"* "+n (* p(*t* +#'*6 !$ ,$!p(*8* 2d * (* ,$#$" *6- "u*n,+ p&$#,$ t+,* (* )$(+"&,*,6 )u$()$ * "*$#.

L* p&$,#* pu$,$ " +"*# "+n (*! p(*t* +#'*! p+# $n"&'* + p+# ,$5*0+. E( $ $"t+ $! !&$'p#$ $( '&!'+ (* p&$,#* pu$,$ !u5&# + '+)$#!$ p*#* (+! (*,+! (* '&!'* "*nt&,*, ,$ p&$! u$ 5*0*.

P#+5($'* D*,+ u$ $( $($ *nt$ pu$,$ un,&# (* t#+'p* $n "u*( u&$# p*#t$ ,$( p+8+ un+! 4 p&$!6 ,$t$#'&n$ ,$ ,+n,$ ,$5!+(t*# (* p&$,#* p*#* u$ $!t* t*p$ (* $nt#*,* ,$ (* "u$)*.

A!u'&#

1. E( p+8+ '&,$ p&$! ,$ *n" + p+# p&$! ,$ p#+ un,&,*,.2. E( $($ *nt$ pu$,$ '+)$# $( /(t&'+ p&$ ,$ (* t#+'p*6 p+# (+ u$ pu$,$6 ,*,+ u$ n+ !$ $n"u$nt#$ n&n@un* p(*t*

$n $( "*'&n+6 un,&# (* t#+'p* 3 p&$! - 1 p*#* (* &8 u&$#,* + (* ,$#$" *.3. E( *#" &)+ "+nt&$n$ un '*p* ,$( p+8+6 ,+n,$ (+! punt+! .% (($n*n (+! $!p*"&+! ,$ *@u*6 (*! p(*t* +#'*! !$

#$p#$!$nt*n "+n (d + [bd6 ,$p$n,&$n,+ ,$ (* ,&#$""&7n ,$ $!t*6 - (* $nt#*,* ,$ (* "u$)* !$ '*#"* "+n un* . L*$nt#*,* ,$ (* "u$)* !&$'p#$ $!t* $n $( +n,+.

4. S& (* p&$,#* p&$#,$ t+,* (* )$(+"&,*,6 - !$ $n"u$nt#* p+!*,* !+5#$ $( p&!+ + un* p(*t* +#'*6 n+ !$ 'u$)$ ,$ *. S& (* p&$,#* " +"* "+nt#* un* ,$ (*! p*#$,$!6 $!t* #$5+t* $n (* ,&#$""&7n "+nt#*#&*.:. S$ @*#*nt&8* u$ $( '*p* t&$n$ !+(u"&7n.. E( @&#*# (* t#+'p* !$ ,$5$ $!p$"& &"*# "+'+ * (* &8 u&$#,*6 ,$#$" *6 + n+ $! n$"$!*#&+.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 126/499

D*t* ,$ $0$'p(+

4 4 4 4 4 4 4 44 4 4 4 4 4 4 44 4 4 4 4 4 4 44 4 4 4 4 4 X 44 4 4 4 4 4 4 44 4 4 X 4 4 4 44 4 4 4 4 < 4 44 4 4; 4 4 4 4

!*(&,*

,&!t*n"&* ,$( 5+#,$ d p#+ un,&,*, 4d@&#*# n+ $! n$"$!*#&+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 127/499

Fecha 1: b M*-+ b 2<<< Nombre de la competencia lllllllllllllllllllllllll Categoría lllllllllll Universidad Un&). D$ Pu$#t+ R&"+6 R$"&nt+ ,$ B*-*'7nAutor I)_n H&' n$8 Tipo de competencia llllllllllllllllllllllllllllll Problema 1 Algoritmos llllllllllllllllllllllllllllllllllllll

6nput ;ile! dblog.inOu!pu! *ile: dblog,ou!Source *ile: dblog,>999?

Da!aba"e $ogging Table"

Problem #escription

M+!t ,*t*5*!$! *)$ * (+@@&n@ !-!t$' t *t ?$$p! t#*"? + *(( ,*t* '+,& &"*t&+n!. T $ (+@ @$n$#*

t &! !-!t$' *&,! &n t $ #$"+)$#- + t $ ,*t*5*!$ * t$# * "#*! .T $ ,*t* '+,& &"*t&+n! *#$ '*,$ t #+u@ "+n"u##$nt t#*n!*"t&+n! t *t * $"t t $ ,*t*5*!$. A t#*n!#$*,! ,*t*6 UPDATE! t $ ,*t* *n, !*)$! &t &n * !p*"$ &n t$'p+#*#- '$'+#-6 "*(($, * p*@$. t#*n!*"t&+n #$ u$!t! t *t *(( ,*t* up,*t$! &t *! '*,$ *#$ COMMITt$, &.$. #&tt$n t+ ,&!?%. Kt *t ,*t* &! #&tt$n t+ ,&!?6 t $ t#*n!*"t&+n *! END$,. In "*!$ + * ,*t*5*!$6 !-!t$' +# ,&!? &t &! p+!!&5($ t+ ABORT * t#*n!*"t&+n. T $ (+@@&n@ !-!t$' ?$$p! * " #+n+(+@&"*( (&!t +E*" (&!t #$"+#, &! + t $ +#'

LSN T-p$ T#*n!ID p*@$ID

E*" #$"+#, *! * un& u$ (+@ !$ u$n"$ nu'5$# LSN%. T $ t-p$ &! t $ *"t&+n 5$&n@ $ $t $ t#*n!*"t&+n up,*t$6 "+''&t6 $n, +# *5+#t%. T $trans . &! t $ &,$nt& &"*t&+n nu'5$# +# tt#*n!*"t&+n. T $ pa#e . &! t $ &,$nt& &"*t&+n nu'5$# +# t $ p*@$ 5$&n@ '+,& &$,.

T+ p#+)&,$ * !t*t&" &'*@$ + t $ ,*t*5*!$ !t*t$ 5$ +#$ * "#*! 6 t $ (+@@&n@ !-!t$' *(!+ ?$$p*"t&)$ t#*n!*"t&+n! *n, '+,& &$, p*@$!. T + t*5($! *#$ u!$, +# t &! pu#p+!$

• A ,&#t- p*@$ t*5($ DPT% ?$$p! t#*"? + t $ p*@$! &n u!$. It !t+#$! t $ pa#e . + t $ '+,& &$, p*@$ *n, t $ /S% 6 "*(($,rec/S% 6 + t $ &#!t (+@ #$"+#, t *t "*u!$, t $ *@$ t+ 5$"+'$ ,&#t-.On"$ t $ t#*n!*"t&+n t *t "*u!$! t $ p*@$ t+ 5$"+'$ ,&#t- $n,! +# &! *5+#t$,6 t $ p*@$ #$"+#, t*5($ &! $#*!$,.

• A t#*n!*"t&+n t*5($ TT% "+nt*&n! +n$ $nt#- +# $*" *"t&)$ t#*n!*"t&+n. T $ $nt#- "+trans ., t $ /S% + t $ '+!t #$"$nt (+@ #$"+#, +# t &! t#*n!*"t&+n "*(($,last/S% % *n, t $ status+ t $ t#*n!*"t&+n t *t &! &n p#+"$!! *"t&)$6 *5+#t$, +# "+''&t$,%. On"$ t $t#*n!*"t&+n &! $n,$, +# *5+#t$, &t! #$"+#, &n t $ t*5($ &! $#*!$,.

G&)$n t $ (+@ #$"+#,!6 #$"+n!t#u"t t $ ,&#t- p*@$ *n, t#*n!*"t&+n t*5($!. S + t $ p#+#$"+n!t#u"t! t $ t*5($!. Input &($ ,5(+@.&n "+nt*&n! t $ (+@ #$"+#,! &n t $ +#'*t

LSN t-p$ t#*n!ID p*@$ID

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 128/499

T $ +utput &($ ,5(+@.+ut ! +u(, "+nt*&n t $ ,&#t- p*@$ t*5($ *n, t#*n!*"t&+n t*5($ &n t $ +#'*t

/S% . " 2pa#e ., rec/S%),34, "" 2 (trans ., last/S%, status) ,34

N+t$!• A t#*n!*"t&+n &! *"t&)$ & &t *! '*,$ *n up,*t$ *n, &! n+t "+''&t$,6 *5+#t$,

+# $n,$,.• On(- up,*t$ #$"+#,! #$ u&#$ pa#e .s• A p*@$ &! n+t t*?$n + t $ ,&#t- p*@$ t*5($ unt&( *(( t#*n!*"t&+n! t *t '+,& &$, &t *#$ $&t

"+''&t$,b$n,$, +# *5+#t$,.

0ample .nput

1< up,*t$ T1 P12< "+''&t T13< $n, T14< up,*t$ T2 P2< up,*t$ T3 P3:< up,*t$ T2 P3

< *5+#t T2< up,*t$ T4 P< up,*t$ T4 P41<< "+''&t T3

Sam le O&$ &$

1< DPTX Q P16 1<% 6 TTX Q T16 1<6 *% 2< DPTX Q P16 1<% 6 TTX Q T16 2<6 "% 3< DPTX Q 6 TTX Q 4< DPTX Q P26 4<% 6 TTXQ T26 4<6 *% < DPTX Q P26 4<% 6 P36 <% 6 TTX Q T26 4<6 *% 6 T36 <6 *% :< DPTX Q P26 4<% 6 P36 <% 6 TTX Q T26 :<6 *% 6 T36 <6 *% < DPTX Q P26 4<% 6 P36 <% 6 TTX Q T26 :<6 5% 6 T36 <6 *% < DPTX Q P36 <% 6 P 6 <% 6 TTX Q T36 <6 *% 6 T46 <6 *% < DPTX Q P36 <% 6 P 6 <% 6 P46 <% 6 TTX Q T36 <6 *% 6 T46 <6 *% 1<< DPTX Q P36 <% 6 P 6 <% 6 P46 <% 6 TTX Q T36 1<<6 "% 6 T46 <6 *%

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 129/499

<Fecha 1: b M*-+ b 2<<< Nombre de la competencia lllllllllllllllllllllllll Categoría lllllllllll Universidad Un&). D$ Pu$#t+ R&"+6 R$"&nt+ ,$ B*-*'7nAutor I)_n H&' n$8 Tipo de competencia llllllllllllllllllllllllllllll Problema 2 Algoritmos llllllllllllllllllllllllllllllllllllll

Inpu! *ile: "ub"e!,inOu!pu! *ile: "ub"e!,ou!

0ource File( subset4M555

Sub"e!"

Problem #escription

G&)$n * !$t + " *#*"t$#!6 &n, *(( &t! !u5!$t!. T $ &nput &($ "+nt*&n! * (&!t + " *#*"t$# 5- !p*"$!. T $ +utput &(( "+nt*&n *(( t $ p+!!&5($ !u5!$t!a +n$ !u5!$t p$# (&n$.

0ample .nput

a b c

0ample :utput

\ a b c d ]\ a b c ]\ a b d ]\ a c d ]\ b c d ]\ a b ]\ a c ]\ a d ]\ b c ]\ b d ]\ c d ]\ a ]\ b ]

\ c ]\ d ]\ ]

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 130/499

Fecha 1: b M*-+ b 2<<< Nombre de la competencia lllllllllllllllllllllllll Categoría lllllllllll Universidad Un&). D$ Pu$#t+ R&"+6 R$"&nt+ ,$ B*-*'7nAutor I)_n H&' n$8 Tipo de competencia llllllllllllllllllllllllllllll Problema 3 Algoritmos llllllllllllllllllllllllllllllllllllll

6ord Pu11le @@

6nput ;ile! puzzle2.inOu!pu! *ile: pu11le4,ou!

ource ;ile! puzzle2.=>>>?

PuQQle #escription

In * +#, pu88($ -+u *#$ @&)$n * (&!t + +#,! *n, * @#&, + ($tt$#!. T $ +50$"t&)$ + t $t+ &n, *(( (&!t$, +#,! $'5$,,$, &n t $ @#&, + ($tt$#!. T $ +#,! "*n 5$ +un, +#&8+nt*((-6 )$#t&"*,&*@+n*((-. In t &! )*#&*t&+n + t $ @*'$6 +#,! "*n *(!+ *pp$*# t &!t$, !$$ &@u#$ 5$(+ %.

M*?$ * p#+@#*' t *t &(( !+()$ * +#, pu88($. Y+u# p#+@#*' 'u!t &n, *(( +#,! p#$!$nt *+utput t $ p+!&t&+n + $*" ($tt$# + t $ +#, +n t $ @#&,. T $ &nput &($ "+n!&!t! + t $ ,&'$n!&+@#&,6 t $ @#&, + ($tt$#! *n, * (&!t + +#,! t+ &n,.

T $ +utput &($ &(( 5$ t $ (&!t + ($tt$#!6 +((+ $, 5- t $ "++#,&n*t$ + $)$#- ($tt$# + t $ +t $ !t#&n@ [n+t +un,\.

t c n 8 l p

D i s u r o e o A t

o b A r e 4

d l m 4 * 9

e E e l l o

0ample .nput

:TCJNLPGKISUR OEO TGOB REJ9L@A96A LLBPu88($

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 131/499

+#, p#+5($'$((+t &!t$,*##*-&nput+utput

Sam le O&$ &$

pu88($ <6 % 16 4% 26 3% 36 2% 46 1% 6 <%+#, 16 1% 26 2% 36 3% 46 4%

p#+5($' n+t +un,$((+ 6 1% 16 1% 6 2% 6 3% 6 4%t &!t$, <6 <% 16 1% 16 2% 16 3% 26 4% 36 4% 46 4%*##*- n+t +un,

&nput n+t +un,+utput n+t +un,

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 132/499

T $ +utput &($ "+n!&!t! + t $ nu'$#&" !$ u$n"$ +((+ $, 5- t $ (&!t + n*'$! t *t '*t" $, t $!$ u$n"$ +# t $ '$!!*@$ [N+ M*t" $! F+un,\.

Sam le In &$

1<V$($86 C*#(+!T+##$!6 An*H+(&$6 An@$(&n*L+p$86 M*#&5$(L*@u$##$6 T+n-L+p$#$n*6 M*#t *S*nt+!6 B$n0*'`n+#@6 H*'$!(&n@$#6 J$&,&u$!t$((6 E,u*#,+4234:: 3

Sam le O&$ &$

S$ u$n"$ 234R$!u(t N+ M*t" $! F+un,

S$ u$n"$ :

R$!u(t!L+p$86 M*#&5$(L+p$#$n*6 M*#t *+#@6 H*'$!

S$ u$n"$ : 3R$!u(t!L+p$#$n*6 M*#t *

S$ u$n"$ R$!u(t!

H+(&$6 An@$(&n*L+p$86 M*#&5$(L*@u$##$6 T+n-L+p$#$n*6 M*#t *S*nt+!6 B$n0*'`n+#@6 H*'$!(&n@$#6 J$&,&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 133/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VVV23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 134/499

C*t$@+#`* E p$#t+ CUB P#+@#*''&n@ C+nP#+5($' S$t

Aut +# P#+ . Hu*n S+(_ S(+*n M*- 2 6 1

Terran vs4 "ergs

Terran Me%%age De)- .erUn @ +!t $!t_ $ p(+#*n,+ $( !$"t+# A(p * 4 ,$( p(*n$t* ; $n p_#!$" 2:. J*"$ ,`*! u$

(+! T$##*n! n+ !*5$n ,$ !u p*#*,$#+ *!t* u$ un '$n!*0$ $n "(*)$ ($! (($@7.

D$"& #$ $( '$n!*0$ ,$ (+! T$##*n! ut&(&8*n,+ ,$ pri'ate key $( )*(+# #$*( 14.2 . E( p#&'$#)*(+# u$ !$ #$"&5$ $n $( *#" &)+ $! $( public key . C+n $( pu5(&" ?$- !$ +5t&$n$ (* p#&'$#* ($t#* ,$(*( *5$t+ $n '*-/!"u(* A%. E( $!p*"&+ - $( punt+ !+n (*! ,+! /(t&'*! ($t#*! $( p#+t+"+(+ (u$@+ ,$ %. L* 7#'u(* p*#* ,$"& #*# $( '$n!*0$ $! "*("u(*,* ut&(&8*n,+ $( )*(+# $n)&*,+ - $( pri'ate key . L*t*5(* p*#* ,$"& #*# "*,* )*(+# #$!u(t*nt$ !$ ,$t$#'&n* ut&(&8*n,+ $( pu5(&" ?$- ,$ 5*!$.

N+t* En (+! '$n!*0$! (+! t$##*n! n+ $!t_n ut&(&8*n,+ $n $!t$ p#+t+"+(+ n/'$#+!. u&$#$ ,$"&# uu&$#$n ,$"&# 14 (+ $n)`*n CATORCE%.

Programe un deci7rador del código enviado por el ghost4 UtiliQara de input el archivo dec4enc ypresentar* el output en pantalla4

$%emplo(

.nput(&=+4 &V,,4 K '& &4 &VV 4KK

:utput(" $ R 9

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 135/499

C*t$@+#&* E;PERTO CUB P#+@#*''&n@ C+ntP#+5($' !$t

Aut +# USACO M*- 2 6 1

S0PERPRIME RI#

But" $#&n@ F*#'$# H+ n ! "+ ! *( *-! -&$(,! t $ 5$!t p#&'$ #&5. Y+u "*n t$(( p#&'$ #&5! 5- (+t $ ,&@&t! (+)&n@(- !t*'p$, *"#+!! t $'6 +n$ 5- +n$6 5- FH *n, t $ USDA. F*#'$# H+ n $n!u#$! pu#" *!$# + &! p#&'$ #&5! @$t! #$*((- p#&'$ #&5!5$"*u!$ $n !(&"$, #+' t $ #&@ t6 t $ nu'5$#&5! "+nt&nu$ t+ !t*- p#&'$ #&@ t ,+ n t+ t $ (*!t #&56 $.@.

3 3 1

T $ !$t + #&5! 331 &! p#&'$a t $ t #$$ #&5! 33 *#$ p#&'$a t $ t + #&5! 3 *#$ p#&'$6 *n,6 + "+(*!t #&56 6 &! p#&'$. T $ nu'5$# 331 &! "*(($, * !up$#p#&'$ + ($n@t 4.

TECJNICAL CONSTRAINTS

1. F+# t $ pu#p+!$! + p#&'$ #&5!6 t $ nu'5$# 1 5- &t!$( % &! n+t * p#&'$ nu'5$#.

2. T $ nu'5$# + #&5! N !*t&! &$! 1sNs .

3. E &t & t $ nu'5$# + #&5! &! $nt$#$, *! <.

K#&t$ * p#+@#*' t *t *""$pt! * nu'5$# + #&5! 1.. % *n, t $n p#&nt! *(( t $ !up$#p#&'$! + t *t ($nE &t & t $ nu'5$# + #&5! $nt$#$, &! <.

E;AMPLE

Nu'5$# + ,&@&t! 4

2333 233 23 3 23 2 2 3 311 313 3 33 3 3 3 3 3 3 1 3 331 333 3 3

TEST CASES

N X N X

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 136/499

C*t$@+#&* E;PERTO CUB P#+@#*''&n@ C+ntP#+5($' !$t

Aut +# USACO M*- 2 61

N0M#ER TRIAN+$ES 3 1 < 2 4 4 4 2 :

Fig4 &

F&@u#$ 1 ! + ! * nu'5$# t#&*n@($. K#&t$ * p#+@#*' t *t "*("u(*t$! t $ &@ $!t !u' + nu'5$#! p*!!$, +n *t *t !t*#t! *t t $ t+p *n, $n,! !+'$ $#$ +n t $ 5*!$. E*" !t$p "*n @+ $&t $# ,&*@+n*((- ,+ n t+ t $ ($ t +# ,&*@+n*(,+ n t+ t $ #&@ t.

In t $ !*'p($ ! + n &n F&@. 16 t $ #+ut$ #+' t+ 3 t+ t+ t+ p#+,u"$! t $ &@ $!t !u' 3<.

T$C;N.CA! C:N0TRA.NT0

1. Put -+u# &nput &($ +# $*" t$!t "*!$ &n * t$ t &($ n*'$, NUMBER.IN.

2. T $ nu'5$# + #+ ! &n t $ t#&*n@($ &! Z 1 5ut fX 1<<.

3. T $ nu'5$#! &n t $ t#&*n@($ *#$ *(( &nt$@$#! 5$t $$n < *n, &n"(u!&)$.

0A-P!$ RUN

NU-B$R4.N *pp$*#! *! +((+ ! T $ &#!t nu'5$# &! t $ nu'5$# + #+ ! &n t $ t#&*n@+((+ $, 5- t $ nu'5$#! &n $*" #+ . T u! t $ t#&*n@($ &n F&@ 1 ! +u(, 5$ !t+#$, &nNU-B$R4.N *!+((+ !

3 1 <2 4 44 2 :

T $ *n! $# &!=K

T$0T CA0$0A t$!t "*!$ &(( 5$ !upp(&$, 5- -+u# t$*" $# +# "++#,&n*t+#.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 137/499

0:!UC.:N$02. Nu'5$# T#&*n@($!

NU-B$R4.N14: 1:4 4 4: 1 31 14 11 3 2

: 21 < 4: : : : 2 1 4< 1

1 3 1 1< 3 1 < 1: :: 4 3< 1 22 2 1 4< 44 3 44 3 4 22 1: 2 43 21 2 1 4

3< 1 1 2 33 4 3 : :: 43 4:3 3: 12 43 2: 4 2: 4 2 23 11 :1 : 42 3 2 :1 3: 2 1 24 1 1: :: 14 1< :1 : 2 3 : 3 4 44 3 2<

NUMBER.OUT:

A @++, p#+@#*' ! +u(, 5$ *5($ t+ !+()$ t $ "*!$ $#$ t $ nu'5$# + #+ ! &! 1<< n$*#(- *! *!t *! t &"*!$.

I p+!!&5($6 *!? t $ !tu,$nt t+ @$n$#*t$ * #*n,+' t#&*n@($ &t 1<< #+ ! *n, !$$ & &!b $# p#+@!t&(( #un &t &n t $ t&'$ (&'&t.

A p#+@#*' t *t t#&$! *(( p+!!&5($ p*t ! @+&n@ +# *#, &(( n$)$# '*?$ &t. It 'u!t +#? 5*"? *#,!.

0uperprime Rib

N X

233 3323 3332 33 333 3333 3 133 3 313 3 33

N X

233 332 33 333 3333 3 133

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 138/499

C*t$@+#&* E;PERTO CUB P#+@#*''&n@ C+ntP#+5($' !$t

Aut +# USACO M*- 2 61

7ERO S0M

C+n!&,$# t $ !$ u$n"$ + ,&@&t! #+' 1 t #+u@ N $#$ NX % &n &n"#$*!&n@ +#,$# 1 2 N *n, &n!$#t $&t $# * % +# *,,&t&+n +# * >% +# !u5t#*"t&+n +# * % Q5(*n? t+ #un t $ ,& N+ !u' t $ #$!u(t *n, !$$ & -+u @$t 8$#+.

K#&t$ * p#+@#*' t *t &(( &n, *(( !$ u$n"$! + ($n@t N t *t p#+,u"$ * ERO SUM.

Test Case &

Input Output 1 2 > 3 4 > > : X <

1 2 > 3 > 4 : > X <1 > 2 3 4 > : > X <1 > 2 > 3 > 4 > : X <1 > 23 > 4 : X <1 > 23 > 4 : X <

T$!t C*!$ 21 2 3 4 = = : = X <1 2 3 = 4 = : = X <1 2 = 3 4 : = = X <1 2 = 3 = 4 = = : X <1 23 = 4 : X <1 = 2 3 = 4 = : = X <1 = 2 > 3 4 > :> X <1 = 2 = 3 4 = : = X <1 = 23 = 4 : X <12 = 34 = : X <

Y+u '*- t$!t t &! p#+@#*' 5- $nt$#&n@ t $ &nt$@$# #+' t $ ?$-5+*#,.U!$ +n$ #$p+#t +#' +# $*" !tu,$nt%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 139/499

Fecha llllbllllb1 Nombre de la competencia llllllllllllllll Categoría $5perto Universidad( CUBYYYYY lllllllllllllAutor lllllllllllll Tipo de competenciaProblema lllll Algoritmos lllllllllllllllllllllllll

*RIDA T5E B2T5

I! F#&,*- t $ 13t #$*((- *n unu!u*( $)$nth T *t &!6 ,+$! t $ 13t + t $ '+nt (*n, +n * F#&,*- ($!!+ t$n t *n +n *n- +t $# ,*- + t $ $$?h T+ *n! $# t &! u$!t&+n6 #&t$ * p#+@#*' t *t &(( "+'put$ t#$ u$n"- t *t t $ 13t + $*" '+nt (*n,! +n Sun,*-6 M+n,*-6 Tu$!,*-6 K$,n$!,*-6 T u#!,*-6F#&,*-6 *n, S*tu#,*- +)$# * @&)$n p$#&+, + N -$*#!. T $ t&'$ p$#&+, t+ t$!t &(( 5$ #+' H*nu*t+ D$"$'5$# 316 1 << N>1 +# *n- nu'5$# + -$*#! N. T $#$ *#$ * $ *"t! -+u n$$, t+ ?n+ 5$ +#-+u "*n !+()$ t &! p#+5($'

1. H*nu*#- 16 1 << *! +n * M+n,*-.

2. T &#t- ,*-! *! S$pt$'5$#6 Ap#&(6 Hun$6 *n, N+)$'5$#6 *(( t $ #$!t *)$ 31 $ "$pt +# F$5&" *! 2 $ "$pt &n ($*p -$*#! $n &t *! 2 .

3. E)$#- -$*# $)$n(- ,&)&!&5($ 5- 4 &! * ($*p -$*# 1 2 X 4e4 !+ 1 2 &(( 5$ * ($*p -$*#6 5-$*# 1 << &! n+t * ($*p -$*#%

4. Ru($ 3 ,+$! n+t +(, +# "$ntu#- -$*#!. C$ntu#- -$*#! ,&)&!&5($ 5- 4<< *#$ ($*p -$*#!6 *(( n+t. T u! t $ "$ntu#- -$*#! 1 <<6 1 <<6 1 << *n, 21<< *#$ n+t ($*p -$*#!6 5ut 2<<< &! * ($*p -

T$!t -+u# p#+@#*' +# NX2< *n, NX4<<.

N:T$( T+ '*?$ &t *&# +# $)$#-+n$6 -+u '*- n+t u!$ *n- 5u&(t>&n ,*t$ un"t&+n! &n -+u# "(*n@u*@$.

T$0T CA0$ &Ent$# t $ nu'5$# + -$*#! Nh'KFROM HAN 16 1 << TO DECEMBER 316 1 1 TJE 13TJ OF TJE MONTJ LANDS ON

#A :F T.-$0

SUNDAY 33

-:N#A =+

TUESDAY 33KEDNESDAY 3TJURSDAY 3FRIDAY 34SATURDAY 3:I * !+(ut&+n &n"#$'$nt! ,*- 5- ,*- &n!t$*, + '+nt 5- '+nt &t &(( t*?$ 3< t&'$! (+n@$# t+ $ *'&n$4<< -$*#! *n, '&@ t #un t++ (+n@.%

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 140/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VVVIntermedio

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 141/499

C*t$@+#&* INTERMEDIO CUB P#+@#*#''&n@ C+nt$ P#+5($' !$tAut +# N$((&u, D. T+##$! M*- 2 6 1

PRO+RAM $ISTIN+

Un* "u*(&,*, u$ p*#$"$ ,&!'&nu&# "+n $( u!+ ,$ (+! ($n@u*0$! ,$ p#+@#*'*"&7n $n *'PC $! (* &'p#$!&7n $n p*p$( ,$ un [!+u#"$ p#+@#*'\ u$ pu$,* (&!t*# $( "7,&@+ "+n $nu'$#*(`n$* - $n"*5$8*'&$nt+ $n "*,* p_@&n*. E!t* +p"&7n !$ u!* 'u" + $n *'5&$nt$! ,$ [M*&n #*'(&!t*,+! ,$ p#+@#*'*! (*#@+! u$ !$ &'p#&'$n "+n (* +p"&7n [!.0T.N9Z p*#* p+,$# $ *'&n*#,$t$n&,*'$nt$ $( p#+@#*'*6 !u! )*#&*5($! $ &n"(u!+ (+! '$n!*0$! ,$ $##+#$!.

L* +p"&7n ,$ [!.0T.N9 \ n+ !+(+ @$n$#* un (&!t*,+ "+n $n"*5$8*'&$nt+ p+# p_@$nu'$#*"&7n p+# (`n$*6 !&n+ u$ t*'5& n (&!t* (+! $##+#$! ,$ !&nt* &! !& $! u$ $ &!t$ *(@(`n$* !$ $n"u$nt#*. T*'5& n pu$,$ @$n$#*# un (&!t*,+ ,$ )*#&*5($!6 $n ,+n,$ !$ ,$ &n$n6 $n

'+,& &"*n - $n ,+n,$ !$ ut&(&8*n. E!t+ $#* ,$ @#*n *-u,* * (+! p#+@#*'*,+#$! ,$ *'5&$nt$ [M*- t*'5& n "+n!&,$#+ u$ pu$,$ !$# ,$ *-u,* * (+! p#+@#*'*,+#$! ,$ *'5&$nt$PC.

PR:B!$-A

J*@* un p#+@#*'* u$ ($* un p#+@#*'* ,$ P*!"*( ,$ $nt#*,* - @$n$#$ ,$ !*(&,* un$n"*5$8*'&$nt+ p+# p_@&n* - $nu'$#$ un* (`n$* ,$ "7,&@+ u$ t$n@* $( p#+@#*'*.

PUNT:0 .-P:RTANT$0

T$n@* $n '$nt$ (+ !&@u&$nt$

1. E( p#+@#*'* ,$5$ &'p#&'&#!$ *!t* (`n$*! p+# p_@&n*.

2. En (* p#&'$#* p*#t$ ,$( $n"*5$8*'&$nt+ !$ ut&(&8*#_#* $( n+'5#$ ,$( p#+@#*'* pu$!t+ ,$!puPR:9RA- "+n (* $ t$n"&7nPA0.

3. En (* !$@un,* p*#t$ !$ &n"(u&#_(* $" * - +#* ,$ (* "+'put*,+#* - $( ,`* ,$ (* !$'*n*.4. F&n*('$nt$ $n (* t$#"$#* p*#t$ !$ )* $nu'$#*n,+ (*! p_@&n*!.

. D$!pu ! ,$ $nu'$#*# $n "*,* (`n$*6 !$ p+n$ $( "*#*"t$# ["+(+n\ % - !$ ,$0* p+# (+ '$n+! $n un$!p*"&+ $n 5(*n"+.

:. En un* /(t&'* p_@&n* !$ )* * @$n$#*# un (&!t*,+ ,$ )*#&*5($! p+# +#,$n *( *5 t&"+.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 142/499

$8$-P!: #$ C:RR.#A

Ut&(&8*n,+ ,$ $0$'p(+ $( !&@u&$nt$ "7,&@+

P5K 56M newton -input, output/T

CKN;'

Epsilon % leD*T

Q65Number, root, s root: realT

>E 9N5EPE6'

writelnTwrite-^Enter new number -! to uit/: ^/Tread -number/T

9J number % ! 'LEN >E 9Nriteln-number:12:*, !&!:12:*/T

EN=E ;E 9J number V ! 'LEN >E 9N

riteln-^...E55K5: number V !_/T

EN=E ;E >E 9N

; root :% s rt-number/Twriteln-number: 12:*, s root: 12:*/TwritelnT

root :% 1T5EPE6'

root :%-numberAroot F root/A2Twriteln-root:2$:*,

1!!.abs-root ` s root/As root:12:2,^ _/

7N'9 abs-numberAs r-root/ ` 1/ VepsilonTEN=

7N'9 number % !EN=&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 143/499

S$ ,$5$ @$n$#*# $( !&@u&$nt$ (&!t*,+

neDton.pas at MaF 29G 1999 10#13#25 +age# 1

1: P5K 56M newton -input, output/T 2:

3: CKN;'$: Epsilon % leD*T":*: Q65<: Number, root, s root : realT:B: >E 9N

1!: 5EPE6' 11: writelnT

12: write-^Enter new number -! to uit/: ^/T 13: read-number/T 1$: 1": 9J number %! 'LEN >E 9N 1*: riteln-number:12:*, !&!:12:*/T 1<: EN= 1 : E ;E 9J number V! 'LEN >E 9N 1B: riteln-^...E55K5: number V!_/T 2!: EN= 21: E ;E >E 9N 22: ; root :%s rt-number/T

23: writeln-number:12:*, s root: 12:*/: 2$: writelnT 2": 2*: root :% 1T 2<: 5EPE6' 2 : root :% -numberAroot F root/A2T 2B: writeln-root:2$:*, 3!: 1!!.abs-root ` s root/As root:12:2, 31: ^ _/ 32: 7N'9 abs-numberAs r-root/ ` 1/ VepsilonT 33: EN= 3$: 7N'9 number % ! 3": EN=&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 144/499

Ne?ton4pas 0at -ay 'VJ &VVV &K(&=(' Page('CR:00 R$F$R$NC$

epsilon !!!$ !!32number !!!< !!13 !!1" !!1* !!1 !!22 !!23 !!2 !!32 !!3$root !!!< !!22 !!23 !!2* !!2 !!2 !!2 !!2B !!3! !!32s root !!!< !!3! !!3!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 145/499

Fecha 2 b M*-+ b 1 Nombre de la competencia lllllllllllllllllllllllll Categoría Int$#'$,&+ Universidad Un&). D$ Pu$#t+ R&"+6 R$"&nt+ ,$ B*-*'7nAutor I)_n H&' n$8 Tipo de competencia llllllllllllllllllllllllllllll Problema Algoritmos llllllllllllllllllllllllllllllllllllll

Telep one Direc!or% Searc

Problem #escription

S+'$ )+&"$ '*&( !-!t$'! *((+ u!$#! t+ !$*#" +# p +n$ nu'5$#! + +t $# #$@&!t$#$, u!$#! + !-!t$'. T+ ,+ !+6 +n$ 'u!t !p$(( t $ n*'$ +# * p#$ & + t $ n*'$ + t $ p$#!+n t+ "*((. T &! &*""+'p(&! $, 5- p#$!!&n@ t $ ?$- nu'5$# "+##$!p+n,&n@ t+ $*" ($tt$# + t $ p#$ & .

U!$ t $ +((+ &n@ ,&*@#*' t+ '*p nu'5$#! +n t $ ?$-p*, t+ ($tt$#!.

K#&t$ * p#+@#*' t *t &n,! *(( n*'$! &n t $ ,&#$"t+#- t *t '*t" * @&)$n n*'$ p#$ & . T $ p#&! @&)$n *! * !$ u$n"$ + ?$-p*, p#$!!$!. B$@&n 5- '*t" &n@ t $ (*!t n*'$ *n, t $n t $ &#!t n*'$.

T $ &nput &(( "+n!&!t +

• Nu'5$# + n*'$!b#$"+#,! &n t $ ,&"t&+n*#-• L&!t + n*'$! &n t $ ,&"t&+n*#-• Nu'5$# + ?$-p*, nu'$#&" !$ u$n"$!• Nu'$#&" !$ u$n"$! +n$ p$# (&n$%.

T $ &nput &(( "+n!&!t + * &($ n*'$,Tel4in

T $ +utput "+n!&!t + t $ 'u'$#&" !$ u$n"$ +((+ $, 5- t $ (&!t + n*'$! t *t '*t" $, t $ !$ u$n"$ +#t $ '$!!*@$ [N+ M*t" $! F+un,\.

1$!p*"&+

2ABC

3DEF

4GJI H L

:MNO

P RS TUV K;Y

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 146/499

0ample .nput

1<V$($86 C*#(+!T+##$!6 An*H+(&$6 An@$(&n*L+p$86 M*#&5$(L*@u$##$6 T+n-L+p$#$n*6 M*#t *S*nt+!6 B$n0*'`n+#@6 H*'$!(&n@$#6 J$&,&u$!t$((6 E,u*#,+4234:: 3

0ample :utput

S$ u$n"$ 234R$!u(t N+ M*t" $! F+un,

S$ u$n"$ :R$!u(t!L+p$86 M*#&5$(L+p$#$n*6 M*#t *+#@6 H*'$!

S$ u$n"$ : 3R$!u(t!L+p$#$n*6 M*#t *

S$ u$n"$ R$!u(t!H+(&$6 An@$(&n*L+p$86 M*#&5$(L*@u$##$6 T+n-L+p$#$n*6 M*#t *S*nt+!6 B$n0*'`n+#@6 H*'$!(&n@$#6 J$&,&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 147/499

C*t$@+#&* INTERMEDIO CUB P#+@#*''&n@ C+nt$!tP#+5($' !$t

Aut +# USACO M*- 2 61

Super Roman Numeral" ol"!ad B FGY+u )$ $*#, t $ !t+#- + R+'*n! (&?$ M&,*! + *, t $ gG+(,$n T+u" .M&,*! *! n+ ++(

*n, !+(, &! @+(, +# (+t! + '+n$-. T $ t#*,&t&+n*( R+'*n nu'$#*(! p#+)$, &n"+n)$n&$nt +#$ p#$!!&n@ t $ )*(u$ + &! +#tun$6 &" #*n@$, &nt+ t $ '&((&+n!. J$ &n)$nt$, Sup$# R+'*n Nu'$#*(!.

Sup$# R+'*n Nu'$#*(! +((+ t $ t#*,&t&+n*( #u($! +# R+'*n nu'$#*(! 5ut *)$ '*n- '+#$ !&n@($>" *#*"t$#)*(u$!. C+n!&,$# t $ t#*,&t&+n*( R+'*n nu'$#*( )*(u$!6 ! + n $#$ &t t $ !&n@($ ($tt$# *n, t $ ,$"&'*( nu'5$# &t#$p#$!$nt!

. 1 ! < - 1<<< / C 1<< O 1< # <<

A! '*n- *! t #$$ + t $ !*'$ '*#?! t *t #$p#$!$nt 1< n '*- 5$ p(*"$, "+n!$"ut&)$(-

... &! 3 CCC &! 3<<

M*#?! t *t *#$ e 1< n *#$ n$)$# u!$, "+n!$"ut&)$(-.G$n$#*((- &t t $ $ "$pt&+n + t $ n$ t #u($%6'*#?! *#$ "+nn$"t$, t+@$t $# *n, #&tt$n &n ,$!"$n,&n@ +#,$#

CC!O... X 1<< 1<< < 1< 1 1 1 X 2:3 S+'$t&'$!6 * '*#? t *t #$p#$!$nt! 1< n &! p(*"$, 5$ +#$ * '*#? + +n$ + t $ t + n$ t &@ $# )*(u$! . 5$ +#$/

+#OaO 5$ +#$! +#Ca $t".%. In t &! "*!$6 t $ )*(u$ + t $ !'*(($# '*#? &! SUBTRACTED #+' t $ '*#? &t p#$"$,$!

./ X 4 .O X O! X 4<

But "+'p+un, '*#?! (&?$O#6.C6 *n,O- *#$ n+t ($@*(6 !&n"$ t $ !'*(($# '*#? &! t++ 'u" !'*(($# t *n t $(*#@$# +n$. F+#O# #+n@ +# 4 <%6 +n$ +u(, u!$C#OCa +# IC #+n@ +# %6 +n$ +u(, u!$OC.Oa +#O-#+n@ +# <%6 +n$ +u(, u!$C-OC .

R$@#$tt*5(-6 &n !t*n,*#, R+'*n nu'$#*(!6 nu'5$#! (&?$ 1<6<<< *#$ #$p#$!$nt$, *!---------- . InSup$# R+'*n Nu'$#*(!6 t $ t*5($ + '*#?! &! $ t$n,$,

. 1 ! < - 16<<< R <6<<< U 16<<<6<<< N <6<<<6<<< / C 1<< P 6<<< 0 1<<6<<< B 6<<<6<<< 1<<6<<<6<<<

; &K D KK &KJKKK T KKJKKK K &KJKKKJKKKKKJKKKJKKK

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 148/499

Nu'5$#! @#$*t$# t *n 1<< '&((&+n *#$ n+ $*!&(- $ p#$!!&5($. K#&t$ * p#+@#*' t *t #$*,! n+,$"&'*( nu'5$#! +n$ p$# (&n$% #+' t $ &($.NPUT4#AT *n, p#&nt! t $ Sup$# R+'*n Nu'$#*($ u&)*($nt. It &! p#+'&!$, t *t t $ &nput ,*t* &(( #$ u&#$ *n *n! $# t *t &! #$p#$!$nt*5($ u!&n@#u($!. St+p -+u# p#+@#*' $n t $ &nput nu'5$# &! * <.

0:!UC.:N$0

0uper Roman Numerals [DolstadJ &VV \

SAMPLE INPUT &($ INPUT.DAT%

111234 :<

SAMPLE OUTPUT

1 ;VIII1 MCM;CVII1234 : KUUSSS RPDCL;;VIII

TEST DATA SET 1

11: 4321

11111<

>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 149/499

C*t$@+#&* INTERMEDIO CUB P#+@#*''&n@ C+P#+5($' !$t

Aut +# USACO M*- 2 61

*ACTORIA$S

T $ *"t+#&*( + *n &nt$@$# n6 #&tt$n nW6 &! t $ p#+,u"t + *(( t $ &nt$@$#! #+' 1 t #+u@ &n"(u!&)$u&"?(- 5$"+'$! )$#- (*#@$ 13W &! t++ (*#@$ t+ !t+#$ &n * 32>5&t &nt$@$# +n '+!t "+'put$#!6 *n, <W &! t++(+*t&n@>p+&nt )*#&*5($!. Y+u# t*!? &! t+ &n, t $ #&@ t'+!t n+n>8$#+ ,&@&t + nW. F+# $ *'p($6 W X 1 e 2!+ t $ #&@ t'+!t n+n>8$#+ ,&@&t + W &! 2. A(!+6 W X 1 e 2 e 3 e 4 e e : e X <4<6 !+ t $ #&@ t'+!t n+n>8$#&! 4.

Input

An &nt$@$# n6 5$t $$n 1 *n, 1<<< &n"(u!&)$.

Output

T $ #&@ t'+!t n+n>8$#+ ,&@&t + nW

TEST CASE 1

Input

Output2>TEST CASE 2Input

Output4

TEST CASE 3Input

1<<<Output2

T &! p#+@#*' '*- 5$ t$!t$, 5- $nt$#&n@ &n &nput #+' t $ ?$-5+*#,.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 150/499

C*t$@+#&* INTERMEDIO CUB P#+@#*''&n@ C+nt$!tP#+5($' !$t

Aut +# USACO M*- 2 61

PRIME PA$INDROMEST $ nu'5$# 1 1 &! * p#&'$ p*(&n,#+'$ 5$"*u!$ &t &! 5+t * p#&'$ nu'5$# *n, * p*(&n,#+'$ &t &! t $ !*'$

nu'5$# $n #$*, +# *#, *! 5*"? *#,%. K#&t$ * p#+@#*' t *t &n,! *(( p#&'$ p*(&n,#+'$! 5$t $$n t + nu'5$#! * *n, 5. Y+u '*- *!!u'$ t *t * *n, 5 *#$ 5$t $$n 1 *n, 326<<<.

T$!t -+u# p#+@#*' &t *65 X 16 1<<< *n, *65 X1<<<6 32<<<

Test Case

*65 X 161<<<

PR.-$ PA!.N#R:-$0 B$T@$$N & AN# &KKK

2 3 111<1 131 1 1 1 1 1 1

313 3 3 3 3 3 3 2 1 2

Test Case '

*65 X 1<<<<6 32<<<>

PR.-$ PA!.N#R:-$0 B$T@$$N &KKK AN# ='KKK

1<3<1 1< <1 1<:<1 11311 11411 12421 12 21 12 21 13331 13 31 13 3114341 14 41 1 4 1 1 1 1:<:1 1:3:1 1: :1 1:::1 1 4 1 1 1 1 1 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 151/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VVV;rincipiante

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 152/499

Categoría P#&n"&p&*nt$ CUB P#+@#*''&n@ C+nt$!tP#+5($' !$t

Autor P#+ . Hu*n M*nu$( S+(_ S(+*n M*- 2 6 1

Halidación de Tar e!a" de CrJdi!oT+,*! (*! t*#0$t*! ,$ "# ,&t+ t&$n$n un !&!t$'* ,$ )$#& &"*"&7n ,$ n/'$#+!. E!t+ !$ *"

)$#& &"*# (* *ut$nt&"&,*, ,$( n/'$#+ ,$ (* t*#0$t*. C*,* n/'$#+ t&$n$ un !&@n& &"*,+. L* '*)$"$! (+! p#&'$#+! n/'$#+! *@#up*,+! u$ !u$($n !$# ,$ "u*t#+% !&@n& &"*n $( t&p+ ,$ t*#0$tn/'$#+! !&@n& &"*n (* + &"&n* ,$( #$p#$!$nt*nt$ ,$ !$#)&"&+ - (+! n/'$#+! u$ &,$nt& &"*n */(t&'+! n/'$#+! !$ ut&(&8*n p*#* )$#& &"*# !& $( n/'$#+ ,$ t*#0$t* ,$ "# ,&t+ $! "+##$"t+. A "+n+"$n "+'+ (+!check di#its .

C+n!t#u-* un p#+@#*'* u$ ,*,* (* !&@u&$nt$ 7#'u(* )*(&,$ (+! n/'$#+! ,$ t*#0$t* ,$ "# ,&t+.

1. L+! n/'$#+! p*#$! !$ *"u'u(*n.2. C*,* n/'$#+ &'p*# !$ 'u(t&p(&"* p+# 2 - !$ *"u'u(*.3. L+!check di#its !$ "*("u(*n 5u!"*n,+ $( #$!&,u+ ,$ (+ *"u'u(*,+ ,$ n/'$#+! p*#$! $nt#$ $(

*"u'u(*,+ ,$ n/'$#+! &'p*#$!.

$%emplo deinput (

B!3 B "$ B B$ B!! $

2B$3 ""*$ * *$ <B1! 3<

11$1 ""*$ 1 *$ 1!!! 11

$%emplo de output(

B!3 B "$ B B$ B!! $ VD Q)lido

2B$3 ""*$ * *$ <B1! 3< VD Q)lido

11$1 ""*$ 1 *$ 1!!! 11 VD N(mero de tar8eta erroneo

N+t* Ut&(&8$ *#" &)+! p*#* $( &nput - +utput ""*#,.&n6 ""*#,.+ut%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 153/499

C*t$@+#`* PRINCIPIANTE

Aut +# P#+ . Ant+n&+ Ju$#t*!

CUB P#+@#*''&n@ C+nt$!tP#+5($' !$t

M*- 2 6 1

C=$C0$O DE *EC5AS

En 'u" *! *p(&"*"&+n$! $! n$"$!*#&+ ,$t$#'&n$# $" *! *nt$#&+#$! + p+!t$#&+#$! * un* $" * ,* p*#* ,$t$#'&n*# $( )$n"&'&$nt+ ,$ un* t*#0$t* ,$ "# ,&t+%. E!"#&5* un p#+@#*'* u$ #$"&5* u+#'*t+ -- b## bAAAA6 ,+n,$-- $! $( '$!6## $! $( ,`* -AAAA $! $( *9+%6 (* )*(&,$ - ,$t$#'&n$(* $" * ,$( ,`* *nt$#&+# - ,$( p#7 &'+ ,`*. R$"u$#,$ t+'*# $n "+n!&,$#*"&7n u$ n+ t+,+! (+! *9+ 5&!&$!t+! - u$ n+ t+,+! (+! '$!$! t&$n$n (* '&!'* "*nt&,*, ,$ ,`*!.

-es Cantidad de #ías -es Cantidad de #ías1. En$#+ 31 . Hu(&+ 31

2. F$5#$#+ 2 7 2 . A@+!t+ 313. M*#8+ 31 . S$pt&$'5#$ 3<4. A5#&( 3< 1<. O"tu5#$ 31. M*-+ 31 11. N+)&$'5#$ 3<:. Hun&+ 3< 12. D&"&$'5#$ 31

CA0:0 #$ PRU$BA.nput(< b2 b111b3 b1<1b<1b1

<2b2 b1<2b2 b1

:utput(Ant$#&+# * < b2 b1 $! < b2 b1 - p+!t$#&+# $! < b2 b1L* $" * $nt#*,* $! &n"+##$"t*. E( ,`* ,$5$ !$# un n/'$#+ $nt#$ 1 - 3< p*#* $!t$ '$!.Ant$#&+# * <1b<1b1 $! 12b31b1 - p+!t$#&+# $! <1b<2b1Ant$#&+# * <2b2 b1 $! <2b2 b1 - p+!t$#&+# $! <3b<1b1L* $" * $nt#*,* $! &n"+##$"t*. 1 n+ $! *9+ 5&!&$!t+.

%ota UT.!.C$ #$ $NTRA#A $! ARC;./: F$C;A04.N

J&nt L+! *9+! 5&!&$!t+! !+n ,&)&!&5($! $nt#$ 4. E0. 1 2 b 4 X 4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 154/499

C*t$@+#`* PRINCIPIANTE CUB P#+@#*''&n@ C+nt$!t

Problem setAut +# P#+ . Ant+n&+ Ju$#t*! M*-6 2 6 1

CONHERSION DE N0MEROS 5E-ADECIMA$ES

E( !&!t$'* $ *,$"&'*( $! ut&(&8*,+ "+'+ un* *(t$#n*t&)* *( !&!t$'* 5&n*#&+ 5&n*#&+ p*#* +5t#$p#$!$nt*"&7n ,$ (*! "*nt&,*,$! *('*"$n*,*! $n (* '$'+#&* ,$ un* "+'put*,+#*. E!t$ !&!t$'* p+!$$,&$"&!$`! 1:% ,`@&t+!. S$ pu$,$ $!t*5($"$# (* !&@u&$nt$ "+##$(*"&7n $nt#$ (+! ,`@&t+! $ *"*nt&,*,$! $ p#$!*,*! $n $( !&!t$'* ,$"&'*(.

#igito ;e5adecimal $Guivalente #ecimal #igito ;a5adecimal $Guialente #ecimal1 12 2 A 1<3 3 B 114 4 C 12

D 13: : E 14

F 1

T+,+ n/'$#+ #$p#$!$nt*,+ $n !&!t$'* ,$"&'*( !$ pu$,$ $ p#$!*# "+'+ un* !u'* ,$ p+t$n"&*! ,$ ,&$81<%. P+# $0$'p(+6 $( n/'$#+ 4 2 pu$,$ !$# $ p#$!*,+ "+'+ 4 e 1<2 % e 1<1 % 2 e 1<< %. D&@u*( +#'*6 un n/'$#+ #$p#$!$nt*,+ $n !&!t$'* $ *,$"&'*( pu$,$ !$# $ p#$!*,+ "+'+ (* !u'* ,$ p+t$n"&*! ,$ ,&$"&!$`! 1:%. P+# $0$'p(+6 $( n/'$#+ AD pu$,$ !$# $ p#$!*,+ "+'+ A e 1:2% D1:<% X 1< e 1:2% 13 e 1:1% e 1: <% X2 :< 2< X 2 :

U!t$, ,$!*##+((*#_ un p#+@#*'* u$ !+(&"&t$ un n/'$#+ $ *,$"&'*( "+n un '_ &'+ ,$ +" + % ,`@&

(+ )*(&,$ - u$ ,$t$#'&n$ !u $ u&)*($nt$ ,$"&'*(.Cota! i el n-mero entrado no es válido, se mostratá un mensa e de error * se indicará elprimer dígito inválido.

E/EMP0O

.nput(ADD G41<

FF3:utput(E( $ u&)*($nt$ ,$"&'*( ,$ AD $! 2 :D G4 n+ $! un* #$p#$!$nt*"&7n $ *,$"&'*(. D`@&t+ n+ )_(&,+ GE( $ u&)*($nt$ ,$"&'*( ,$ 1< $! 2:E( $ u&)*($nt$ ,$"&'*( ,$ FF3 $! 4< 3

Nota( UtiliQe de input el archivo de nombre ;$O4.N

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 155/499

C*t$@+#`* P#&n"&p&*nt$ CUB P#+@#*''&n@ C+ P#+5($' !$t

Aut +# P#+ . Hu*n S+(_ S(+*n M*-6 2 6 1

'D 0o7t?are 0olution

Da!e 6indoKing

E( *9+ 2<<< $n"*#* )*#&+! p#+5($'*! $n (*! "+'put*,+#*!. Un+ ,$ $((+! $n $( _#$* p#+@#*'*"&7n ,$ *p(&"*"&+n$!. A(@un*! *p(&"*"&+n$! "#$*,*! $n , "*,*! p*!*,*! ut&#$p#$!$nt*# $( *9+ $n un* $" * (+! /(t&'+! ,+! ,`@&t+! ,$( *9+. P+# $0$'p(+ p*#* $( *9+ $!"#&5$ : . P*#* #$!t*# 1 ,$ 1 !$ #$p#$!$nt*5* *!` > X3. C+'+ !$ +5)&*5*n (+! (+! p#&'$,`@&t+! ,$( *9+6 -* u$ n+ "*'5&*#`*n *!t* $( 2<<<6 'u" +! *#" &)+! n+ @u*#,*n $( *9+ $n p+!&"&+n$!. E!t$ $!t&(+ ,$ p#+@#*'*"&7n +5!+($t* <1> X > "u*n,+ ,$5$#`* !$# 2.

In@ n&$!$ un *(@+#&t'+ ,$ p#+@#*'*"&7n p*#* #$!t*# $" *! $nt#$ !&@(+!. E &!t$ un* t "n&"* u$ pu$,$ ut&(&8*# u$ !$ "+n+"$ "+'+ D*t$ K&un* )$nt*n* )&#tu*( $nt#$ !&@(+! "*,* *9+!. L* '&!'* pu$,$ !$# '+)&,* "*,* < *9+!. P+# $0$'p(+ S& $nt#+ u$ '& )$nt*n* "+'&$n8* $n $( *9+ )$nt*n* "+'&$n8* $n 1 21 - t$#'&n* $n $( *9+ 2<<<. S& $!"#&5+ 1 2< '& )$nt*n* "+'&$n8* $n 1 21 - t$#'&n*#_ $n $( 2<2<. L*! $" *! '*-+#$! ,$( t#*t*n "+'+ !& u$#*n '*-+#$! ,$( 1 2<. E( !&!t$'* !+(+ )$ un* )$nt*n* ,$ $" *!. S& $nt#+ un* $" * '$n+# ,$ 1 21 $( !&!t$'* "#$$#_ u$ $! '$n+# + &*( 2<2<.

.nput(

1B!! *B *1 "! 2" 222! !1 BB1 !! B! 1

:utput(

Qentana : 1B!1 al 2!!!, 1B*BD1B* %1Qentana: 1 "1 al 1B"!, 1B2"D1 %3<Qentana: 2221 al 232!, 23!1D22BB%2Qentana: 1 !1 al 1B!!, 1 B!D1 1%B

Nota( UtiliQe archivos de input y output para este problema 2llamarlos( 'D4 .N y 'D4 :UT6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 156/499

PRO+RAM $ISTIN+

Una cualidad que parece disminuir con el uso de los lenguajes de programaci6n en ambiente de PC es la

impresion en papel de un "source program" que pueda listar el codigo con enumeraci6n por linea yencabezamiento en cada prigina. Esta opci6n se usa mucho en ambientes de "Mainframe" con listados deprogramas largos que se imprimen con la opci6n "LISTING" para poder examinar detenidamente el programa, susvariables e incluso los mensajes de errores.

La opcion de "LISTING" no solo genera un listado con encabezamiento por pagina y enumeraci6n porlinea, sino que tambien lista los errores de sintaxis si es que existe alguno yen que linea se encuentra. Tambienpuede generar un listado de variables, en donde se definen, en donde se modifican yen donde se utilizan. Esto erade gran ayuda a los programadores de ambiente "Mainframe" y tambien considero que puede ser de ayuda a losprogramadores de ambiente PC.

PROBLEMA

Haga un programa que lea un programa de Pascal de entrada y genere de salida un encabezamiento porpagina y enumere cada linea de codigo que tenga el programa.

PUNTOS IMPORTANTES

Tenga en mente lo siguiente

1. El programa debe imprimir hasta 55 lineas por prigina.

2. En la primera parte del encabezamiento se utilizarfi el nombre del programa puesto despues de PROGRAMcon la extension PAS.

3. En la segunda parte se incluirfi la fecha y hora de la computadora y el dia de la semana.

4. Finalmente en la tercera parte se va enumerando las páginas.

5. Después de enumerar en cada línea, se pone el caracter "colon" ( : )y se deja por lo menos un espacio enblanco.

C*t$@+#`* PRINCIPIANTE CUB P#+@#*''&n@ C+nt$P#+5($' !$t

Aut +# N$((&u, T+##$! M*- 2 6 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 157/499

$8$-P!: #$ C:RR.#A

Utilizando de ejemplo el siguiente c6digo:

P5K 56M newton -input, output/T

CKN;'Epsilon % leD*T

Q65Number, root, s root: realT

>E 9N5EPE6'

write9nTwriteCEnter new number -! to uit/: /Tread-number/T

9J number % ! 'LEN >E 9Nritein-number: 12:*, !&!:12:*/T

EN=E ;E 9J number V ! 'LEN >E 9N

rite9n- ... E55K5: number V ! /TEN=E ;E >E 9N

; root :% s rt-number/Twritein-number: 12:*, s root: 12: */TwritelnT

root :% 1T

5EPE6'root :% -numberAroot F root/A2Twritein-root: 2$: *,

1!!.abs-root D s root/As root: 12: 2, ,,/

7N'9 abs-numberAs r-root/ D 1/ V epsilonTEN=

7N'9 number % !

EN=&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 158/499

S$ ,$5$ @$n$#*# $( !&@u&$nt$ (&!t*,+

neDton.pas at MaF 29G 1999 10#13#25 +age# 1

1: P5K 56M newton -input, output/T 2:

3: CKN;'$: Epsilon % leD*T":*: Q65<: Number, root, s root : realT:B: >E 9N

1!: 5EPE6' 11: writelnT 12: write-^Enter new number -! to uit/: ^/T 13: read-number/T

1$: 1": 9J number %! 'LEN >E 9N 1*: riteln-number:12:*, !&!:12:*/T 1<: EN= 1 : E ;E 9J number V! 'LEN >E 9N 1B: riteln-^...E55K5: number V!_/T 2!: EN= 21: E ;E >E 9N 22: ; root :%s rt-number/T 23: writeln-number:12:*, s root: 12:*/: 2$: writelnT

2": 2*: root :% 1T 2<: 5EPE6' 2 : root :% -numberAroot F root/A2T 2B: writeln-root:2$:*, 3!: 1!!.abs-root ` s root/As root:12:2, 31: ^ _/ 32: 7N'9 abs-numberAs r-root/ ` 1/ VepsilonT 33: EN= 3$: 7N'9 number % ! 3": EN=&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 159/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 160/499

CUTB Programming ContestProblem Set -Expert Division

March 6, 1999

Code +enera!ion

Your employer needs a backend for a translator for a very SIC machine (Simplified InstructionalComputer, apologies to Leiand Beck). Input to the translator will be arithmetic expressions in postfixform and the output will be assembly language code.

The target machine has a single register and the following instructions, where the operand is either anidentifier or a storage location.

LASMDN

STload the operand into the registeradd the operand to the contents of the register subtract the operand from the contents of theregister multiply the contents of the register by the operand divide the contents of the register bythe operand negate the contents of the register store the contents of the register in the operandlocation

An arithmetic operation replaces the contents of the register with the expression result. Temporarystorage locations are allocated by the assembler for an operand of the form OSnO where n is a singledigit.

Input and Output

The input file consists of several legitimate postfix expressions, each on a separate line. Expressionoperands are single letters and operators are the normal arithmetic operators (+, -, *,/) and unary negation

(@). Output must be assembly language code that meets the following requirements:

1. One instruction per line with the instruction mnemonic separated from the operand (if any) by oneblank.

2. One blank line must separate the assembly code for successive expressions.3. The original order of the operands must be preserved in the assembly code.4. Assembly code must be generated for each operator as soon as it is encountered.5. As few temporaries as possible should be used (given the above restrictions).6. For each operator in the expression, the minimum number of instructions must be generated (given

the above restrictions).

A sample input file and corrresponding correct output are on the reverse of this paper.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 161/499

CUTB Programming ContestProblem Set -Expert Division

March 6, 1999

Sample input Sample output

AB+CD+EF++GH+++ L AA BST $1L CA DST $2L EA FA $2ST $2L GA HA $2A $1

AB+CD+- L AA BST $1L CA DNA $1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 162/499

CUTB Programamng Contest Problem Set -Expert Division

March 6, 1999

CONHERSION

Convierta de palabra a número dejándose llevar de la siguiente tabla:

primero = 1 undecimo = 11 Vigesimo primero = 21 ducentesimo = 200segundo = 2 duodecimo = 12 trigesimo = 30 tricentesimo = 300

tercero = 3 decimotercero 6decimotercio = 13 trigesimo cuarto = 34 cuadrigentesimo = 400

cuarto = 4 decimocuarto = 14 cuadragesimo = 40 quingentesimo = 500quinto = 5 decimoquinto = 15 quincuagesimo = 50 sexcentesimo = 600sexto = 6 decimosexto = 16 sexagesimo = 60 septingentesimo = 700

septimo = 7 decimoseptimo = 17 septuagesimo = 70 octigentesimo = 800octavo = 8 decimoctavo = 18 octogesimo = 80 nonigentesimo = 900

noveno = 9decimonoveno 6decimonono = 19 nonagesimo = 90 milesimo = 1000

decimo = 10 vigesimo = 20 centesimo = 100

Se tomará 1o siguiente en mente:

1. Se omitirán los acentos en las palabras.2. Las cifras llegan hasta un máximo de cuatro (4) dígitos.3. El programa tiene que detectar errores de sintaxis.

Ejemplo de corrida:

Indique palabra (exit para salir): quincuagesimo segundoquincuagesimo seRundo = 52

Indique palabra (exit para salir): centesimo sexagesimo quintocentesimo sexagesimo quinto = 165

Indique palabra (exit para salir}: milesimo primeromilesimo primero = 1001

Indique palabra (exit para salir}: centesimo nonagesimocentesimo nona2esimo = 190

lndique palabra (exit para salir): septima***error de sintaxis ***

Indique palabra (exit para salir): exit

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 163/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 164/499

There will be only simple mathematics equotions like add, subtract, divide and multiply with a maximum ofthree (3) operators. The compare symbols like >, <, >=, <=, <> and = may also be used in the until clause.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 165/499

CUTB Programming ContestProblem Set -Expert Division

March 6, 1999

You can use the following assembly instructions:

1. JMP - Jump no matter what2. JZ - Jump if the result was Zero3. JNZ - Jump if the result was Not Zero4. JG - Jump if the result was Greater than zero5. JL - Jump if the result was Less than zero6. JGE - Jump if the result was Greater or equal than zero7. JLE - Jump if the result was Less or equal than zero8. DEC - Decrement (subtract one)9. INC - Increment (Add one)10. MOV - Move X,Y (X ("' Y)11. ADD - Add X,Y (X (- X +Y)12. SUB - Subtract X,Y (X (- X -Y)13. MUL- Multiply X,Y (X (- X *Y)14. DIV - Divide X,Y (X (-- X / Y)15. CMP - Compare

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 166/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VV23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 167/499

Fecha M*-+b<3b1 Nombre de la competencia CUTB P#+@#*''&@ C+nt$!tCategoría E p$#t+ Universidad lllllllllllllllllllllllllllllll Autor lllllllllllll Tipo de competencia lllllllllllllllllllllll Problema lllll Algoritmos llllllllllllllllllllllllllllllll

#INAR CA$C0$ATOR0ource File Name( OOOOOOOO4OOO.nput File Name( OOOOOOOO4OOO:utput File Name( OOOOOOOO4OOO

Problem &(

Y+u *#$ t+ #&t$ * p#+@#*' t *t "*n $)*(u*t$ !&'p($ $ p#$!!&+n! u!&n@ 5&n*#- nu'5$#!.T $ $ p#$!!&+n "*n *((+ t $ +((+ &n@ t+?$n!

Binary numbers(Opt&+n*( !&@n6 t $ " *#*"t$#!& *n, K:perators 6>6e6 +# bParenthesis( 2 +#6t+ !p$"& - p#$"$,$n"$ @#+up&n@.

Y+u 'u!t *!!u'$

1. T $ $ p#$!!&+n ! +u(, 5$ $)*(u*t$, #&@ t t+ ($ t $ "$pt $#$ p*#$nt $!&! @#+up&n@2. A(( &nput $ p#$!!&+n! *#$ !-nt*"t&"*((- "+##$"t.3. E*" t+?$n &! !$p*#*t$, 5- +n$ 5(*n? !p*"$.

4. A(( $ p#$!!&+n! &(( 5$ ($!! t *n < " *#*"t$#! &n ($n@t .. A(( +p$#*t&+n! &(( p#+,u"$ &nt$@$# #$!u(t! +n(- &@n+#$ ,$"&'*( p+!&t&+n!%.

K $n *n &nput $ p#$!!&+n &! #$*,6 -+u *#$ t+ p#&nt t *t $ p#$!!&+n *n, &t! "+##$"t )*(u$.:U CAN N:T C:N/$RT FR:- B.NAR T: #$C.-A! T: 0:!/$ T;.0 PR:B!$-4

$5amples(

ENTER E;PRESSIONZ&&K&]^]&&&&&&K&]^] &&&& &&&KK

ENTER E;PRESSIONZ&&K&]_]&&&&&&K&]_]&&&& &&KKKK&&

ENTER E;PRESSIONZ&K&]<]&K&K&]<]&K &K R &

ENTER E;PRESSIONZKM$O.T

Note that ] is eGuivalent to a space4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 168/499

Fecha M*-+b<3b1 Nombre de la competencia CUTB P#+@#*''&n@ C+nt$!tCategoría E p$#t+ Universidad lllllllllllllllllllllllllllllllllllll Autor lllllllllllll Tipo de competencia llllllllllllllllllllllllllllll Problema lllll Algoritmos llllllllllllllllllllllllllllllllllllll

Direc!or% $i"!ing Command Simula!or 0ource File Name( OOOOOOOO4OOO.nput File Name( OOOOOOOO4OOO:utput File Name( OOOOOOOO4OOO

Problem '(D$)$(+p * p#+@#*' t *t !&'u(*t$! * @$n$#&"#.R "+''*n,. T $ &nput &(( 5$ #$*, #+' *n &nput &($

n*'$, #.R4TOT. T $ " *#*"t$#! *((+ $, &n t *t &($ &(( 5$

1. A ,+t 246t+ !$p*#*t$ t $ &($ n*'$ *n, t $ $ t$n!&+n +pt&+n*(%.2. C *#*"t$#! #+'A t+" Upp$# *n, L+ $#"*!$ &(( 5$ *((+ $,%.3. Nu'5$#! #+' K t+V.

T $ p#+'pt "+''*n, &(( *((+ t $ +((+ &n@ " *#*"t$#!

1. A ,+t 246+pt&+n*(%2. An *!t$#&!?2_6t+ !u5!t&tut$ +n$ +# '+#$ " *#*"t$#!.3. A u$!t&+n '*#?2 6t+ !u5!t&tut$ +n(- +n$ " *#*"t$#.

T $ +((+ &n@ *#$ $ *'p($! + )*(&, "+''*n,!.

DIRe*.E;E6 DIR ABe.COM6 DIR AhBhCh.DAT6 DIR ABChJe.e6 DIR JELP6 DIR e.e6 DIR .hhh6 DIR eAhBe.e

T $ #u($! +# &($ n*'$! &(( 5$ t $ !*'$ u!$, +# MS>DOS. At t $ $n, + t $ p#+@#*' &(( ,&!p(t+t*(! + &($! ,&!p(*-$, +n !"#$$n *n, t $ t+t*( &($! #$*, +n t $ &($. R$'$'5$#6 t $ p#+@#*' "*!$ !$n!&t&)$.0ample output(

C:--AN# ZDIRe.E;EABC.E;EFINISJ.E;EPROGRAM.E;ETEST.E;E

T+t*( &($! #$*, 2 % T+t*( &($! !$($"t$, 4%.C:--AN# ZDIR eJ.eFINISJ.E;EASJ.T;T

T+t*( &($! #$*, 2 % T+t*( &($! !$($"t$, 2%.C:--AN# DIR AhBhCe.e

N+ &($! +un,T+t*( &($! #$*, 2 % T+t*( &($! !$($"t$, <%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 169/499

C:--AN# DIR AhCe.eABC.E;EA; TOT.BAT

T+t*( &($! #$*, 2 % T+t*( &($! !$($"t$, 2%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 170/499

;roblem 9: <OL ,"C= CON>2C/1?2

S+u#"$ F&($ N*'$ ED3.;;;Input F&($ N*'$ ED3.DATOutput F&($ N*'$ ED3.OUT

#e7ine(

T $ G+(,5*" "+n0$"tu#$ !t*t$! t *t *n- p+!&t&)$ $)$n nu'5$# @#$*t$# t *n 4 "*n 5$ $ p#$!!$,+ t + p#&'$ nu'5$#!. T &! "+n0$"tu#$ *! n$)$# 5$$n "+'p($t$(- p#+)$n6 5ut &t *! 5$$n ,$'+n!t"+'put$# t+ 5$ t#u$ +# * &,$ #*n@$ + $)$n nu'5$#!.

Problem(

G&)$n *n $)$n nu'5$# @#$*t$# t *n 46 &n, t + p#&'$ nu'5$#! &" !u' t+ &t. F+# pu#p+! p#+5($'6 1 &! n+t "+n!&,$#$, * p#&'$ nu'5$#.

.nput(

Input +# t &! p#+5($' "+n!&!t! + * (&!t + $)$n nu'5$#! @#$*t$# t *n 46 +n$ p$# (&n$. T $ n 5$ $ $# t *n 1< ,&@&t! &n ($n@t .

:utput(

E*" (&n$ + t $ p#+@#*' +utput "+n!&!t! + $ *"t(- t #$$ $nt&t&$! t $ +#&@&n*( &nput nu'5 p#&'$! &" !u' t+ t *t nu'5$#.

0ample #ata(

1<

0ample :utput(

O#&@&n*( P#&'$3

1<

$NT$R AN $/$N NU-B$R KfE;ITZ

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 171/499

$OP$RT #./.0.:N

$ON+ $ON+ DIHISION

Problem( +

Y+u *)$ 5$$n *!!&@n$, t+ * t$*' + !+ t *#$> *#, *#$ $n@&n$$#! +#?&n@ +n !up$# "+'put$#! Y+u# t*!? &! t+ #&t$ !+ t *#$ +# &'p($'$nt&n@ 'u(t&p($ ,&@&t ,&)&!&+n6 &" &! t+ ,&)&,$ $ $# ,&@&t! 5- *n- p+!&t&)$ ,&)&!+# ($!! t *n 1<<.

D*t* &n t $ &nput &($! "+'$! &n p*&#!6 &t t $ &#!t (&n$ "+nt*&n&n@ t $ ,&)&,$n, *n, t $ !$"t $ ,&)&!+#. Y+u# p#+@#*' &! t+ *""$pt +n(- "+##$"t ,&)&,$n,! *n, ,&)&!+#!. T u!6 & $&t $# ,&)&!+# "+nt*&n! *n- n+n>,&@&t6 &.$.6 * " *#*"t$# n+t &n Q<.. 6 +# t $ ,&)&!+# &! @#$*t$#$##+# '$!!*@$6 *! ! + n &n t $ !*'p($ +ut ! + n 5$(+ . I -+u #$*, &n t + )*(&, )*(u$!6 -+u *#$ t+ "+'put$ t $ u+t&$nt *n, #$'*&n,$# *n, +utput t $ #$!u(t!

+n t $ !*'p($ +utput ! + n 5$(+ . Y+u *#$ t+ u!$ n+#'*( $n,>+ > &($ '$t +,! t+ t$#'&n*t$ -+u# #$*,! #&nput ,*t* &($. A( *-! !?&p * (&n$6 *! ! + n 5$(+ &n t $ $ *'p($ ,*t*6 5$t $$n t $ ,&)&,$n,b,&)&!+

0ample #ata(

V==

0ample output(

$NT$R F.R0T NU-B$R V$NT$R 0$C:N# NU-B$R =

#ividend is V

#ivisor is =Euotient is =Remainder is K

$NT$R F.R0T NU-B$R =

$NT$R 0$C:N# NU-B$R #ividend is =#ivisor is Euotient is Remainder is +

$NT$R F.R0T NU-B$R KM$O.T CUTB P#+@#*''&n@ C+nt$!t

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 172/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VVIntermedio

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 173/499

CUTB P#+@#*'&n@ CP#+5($' !$M*- 361

.NT$R-$#.AT$ #./.0.:N

DEA$IN+ A DEC O* CARDS

P#+5($' 1

K#&t$ * p#+@#*' t *t6 @&)$n * (&!t + t $ &nt$@$#! 1 t+ 2 &n *n- +#,$# *t!+$)$#6 !&'u(*t$! t $ ,$+ "*#,!. Y+u 'u!t *!!&@n !+'$ "+##$!p+n,$n"$ 5$t $$n t $ nu'5$#! #+' t+ 1 t+ 2 *n, t $ "*#,! &n * !t*n,*#, ,$"2 "*#,!. On$ *- t+ ,+ t &! &! t+ ($t t $ &#!t 13 "*#,! 5$ $*#t!6 t $ n$ t 13 5$ ,&*'+n,!6 t $ n$ t 13 5$ "(u5!6 *(*!t 13 5$ !p*,$!. K&t &n $*" !u&t + 13 "*#,!6 t $ &#!t 1< "*#,! #$p#$!$nt t $ *"$ t #+u@ t $ t$n6 *n, t $ #$t #$$ "*#,! #$p#$!$nt t $ 0*"?6 t $ u$$n6 *n, t $ ?&n@ + t *t !u&t6 #$!p$"t&)$(-.

On t $ 5*!&! + t $ !" $'$ p#$!$nt$, *5+)$6 t $ nu'5$# 1 "+##$!p+n,! t+ t $ *"$ + $*#t!6 t $ nu'5$# 2"+##$!p+n,! t+ t $ t + + $*#t!6 t $ nu'5$# 2: "+##$!p+n, t+ t $ ?&n@ + ,&*'+n,!6 t $ nu'5$# 3 "+##$!p+n,! t+?&n@ + "(u5!6 *n, t $ nu'5$# 2 "+##$!p+n,! t+ t $ ?&n@ + !p*,$!.

Y+u 'u!t! *(!+ ,&!t#&5ut$ t $ ,$*($, "*#,! t+ 4 p(*-$#! 4 p$# p(*-$#% #+' t $ t+p *n, @&)&n@ +n$ "* p(*-$# +n$ *t * t&'$.

:U -U0T U0$ T;$ RA-#:- FUNCT.:N T: 0:!/$ T;.0 PR:B!$-HH

0ample :utput(

MUN#$A!.N91. *"$ + $*#t!2. t + + $*#t!3. t #$$ + $*#t!

4. +u# + $*#t!..2. &n@ + !p*,$!

f #$A!.N91. A"$ + C(u5! 14. N&n$ + D&*'+n,! 2 .F&)$ + J$*#t! 4<. F&)$ + C(u5!2. F+u# + J$*#t! 1 . T$n + Sp*,$! 2 .D$u"$ + D&*'+n,! 41. S& + J$*#t!3.N&n$ + Sp*,$! 1:. &n@ + C(u5! 2 . u$$n + Sp*,$! 42.N&n$ + J$*#t!4. A"$ + J$*#t! 1 . &n@ + Sp*,$! 3<. &n@ + J$*#t! 43.T$n + J$*#t!. E&@ t + D&*'+n,! 1 .S$)$n + C(u5! 31. F+u# + Sp*,$! 44.D$u"$ + C(u5!:. A"$ + D&*'+n,! 1 .S& + C(u5! 32.S& + D&*'+n,! 4 .T #$$ + J$*#t!. H*"? + J$*#t! . . .

. S$)$n + J$*#t! . . .. . . .13. u$$n + C(u5! 2:.D$u"$ + Sp*,$! .3 .H*"? + Sp*,$! 2. F&)$ + D&*'+n,!

P!A $R & P!A $R ' P!A $R = P!A $R +1. A"$ + C(u5! 1.F+u# + J$*#t! 1. N&n$ + Sp*,$! 1. A"$ + J$*#t!2. E&@ t + D&*'+n,! 2. A"$ + D&*'+n,! 2. H*"? + J$*#t! 2. S$)$n + J$*#t!3. . 3. . 3. . 3. .4. u$$n + C(u5! 4. N&n$ + D&*'+n,! 4. T$n + Sp*,$! 4. &n@ + C(u5!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 174/499

CUTB P#+@#*''&n@ C+P#+5($' !$

M*- 36 1

.NT$R-$#.AT$ #./.0.:N

*RACTIONS TO DECIMA$S

Problem '(

K#&t$ * p#+@#*' t *t &(( *""$pt * #*"t&+n + t $ +#' NbD6 $#$N &! t $ nu'$#*t+# *n,# &! t $ ,$n+'&n*t+#6 t *t p#&+ut t $ ,$"&'*( #$p#$!$nt*t&+n. I t $ ,$"&'*( #$p#$!$nt*t&+n *! * #$p$*t&n@ !$ u$n"$ + ,&@&t!6 &t ! +u(, 5$ &n,&&n 5#*"?$t!. F+# $ *'p($6 1b3 X.33333333 &! ,$n+t$, *! . 3%<6 *n, 41b333 .123123123 &! ,$n+t$, *!. 123%.

T-p&"*( "+n)$#!&+n! *#$

1b3 X . 3%22b X 4.41b X . 142 %3b X .34 b : X . <3 142 %

T$!t -+u# p#+@#*' &t t $ #*"t&+n! *5+)$ *n, t $ #*"t&+n 11b .

S*'p($ Run

$NT$R N &$NT$R #

1b X. 142 %

$NT$R N KM$O.T

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 175/499

CUTB P#+@#*''&n@ C+P#+5($' !$

M*- 36 1

.NT$R-$#.AT$ #./.0.:N

EI+5T L0EEN 6IT5 A T6IST

Problem =(

E&@ t u$$n! "*n 5$ *##*n@$, +n * " $!! 5+*#, !+ t *t n+ u$$n &! un,$# *tt*"? #+' *n- + t $&n +t $# +#,!6 !+ t *t n+ #+ +# "+(u'n +# ,&*@+n*( "+nt*&n! '+#$ t *n +n$ u$$n. K#&t$ * p#+@ p(*"$ t $ p+!&t&+n + u$$n! +n * " $!! 5+*#, *n, $n!u#$! t *t n+ u$$n! *#$ un,$# *tt*"?. Y+u# p#! +u(, &#!t ,#* t $ " $!! 5+*#, ,&!p(*-&n@ t $O '*t#& &t d! #$p#$!$nt&n@ t $ u$$n p+!&t&+n. T p#+@#*' 'u!t *(!+ !$*#" *n, ,&!p(*- *(( t $ !+(ut&+n! +# t &! p#+5($'. T $ *n! $#! ! +u(, ! + t $ "+#!+(ut&+n.

Note( N+ *#,> &#$, !+(ut&+n *#$ *((+ $,W.

0ample :utput(

& ' = + , L

& E

' E

= E

+ E

E

, E

E

L E

PR$00 $NT$R F:R N$OT 0:!UT.:N

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 176/499

.NT$R-$#.AT$ #./.0.:N

P077$E

Problem +(

Y+u *#$ t+ #&t$ * p#+@#*' &" &(( !"*n * 1< 1< " *#*"t$# @#&,6 *n, &n, t $ +""u##$n" p*#t&"u(*# +#, &n t $ @#&,. T $ +#, "*n 5$ +un, +#&8+nt*((-6 )$#t&"*((-6 ,&*@+n*((-:N AN#.R$CT.:N . T $ &nput &($n*'$ &(( 5$ PU LE.DAT.

F+# &n!t*n"$6 @&)$n * @#&, 4 4%

A B D ;O J P

J K U PP L U P

0ample :utput(

$NT$R @:R# 2+ characters long6Z BOKLBOKL &! &n p+!&t&+n!6 261%6 262%6 263%6 26 4%.

$NT$R @:R#2+ characters long6 PULPPULP &! &n p+!&t&+n!6 44%6 34%6 26 4%6 164%.

$NT$R @:R# 2+ characters long6 PULLT $ +#, PULL &! n+t &n t $ @#&,.

$NT$R @:R# 2+ characters long6 <fE;ITZ

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 177/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VV;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 178/499

CUTB Programming ContestProblem setMay 3, 1997

BEGINNERS DIVISION

E-PONENTIATION

Problem 1:

Write a program that implemems exponentiation. The following rules must be observed.

1. For the following expression: N e, where N and e are integers.When e > 0, N e = (N * .... N) e timesWhene=0, N e =1

When e < 0, N e = 1/(N * ....... N) e times

2. DO NOT USE ANY MATHEMATICAL BUILT-IN FUNCTION to solve thisproblem, other than +, -, * and/.

Sample Data:

ENTER NUMBER>5ENTER EXPONENT>3

Sample Output:

RESULT = 125

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 179/499

CUTB Programming ContestProblem setMay 3, 1997

BEGINNERS DIVISION

DEA$IN+ A DEC O* CARDS

Problem 2:

Write a program that e-iven a list of the integers 1 to 52 in any order whatsoever, simulates the dealingof a d, of cards. You must assign some correspondence between the numbers from 1 to 52 and the cards in astandard deck of 52 cards. One way to do this is to let the first 13 cards be hearts, the next 13 be diamonds, then,-xt 13 be clubs, and the last 13 be spades. Within each suit of 13 cards, the first 10 cards represent the acethrough the ten, and the remaining three cards represent the jack, the queen, and the king of that suit,respectively.

On the basis of the scheme presented above, the number 1 corresponds to the ace of hearts, the number 2corresponds to the two of hearts, the number l0 corresponds to the ten of hearts, the number 13 correspond tothe king of hearts, the number 26 correspond to the king of diamonds, the number 39 corresponds to the king ofclubs, and the number 52 corresponds to the king of spades.

YOU MUST USE THE RANDOM FUNCTION TO SOLVE THIS PROBLEM!!

Sample Output:

<UNDEALING>1. ace of hearts2. two of hearts3. three of hearts4. four of hearts...52. King of spades

<DEALING>1. Ace of Clubs2. Four of Hearts3. Nine of Spades4. Ace of Hearts5. Eight of Diamonds6. Ace of Diamonds...52. Queen of Clubs

PRESS ENTER TO EXIT>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 180/499

CUTB Programming ContestProblem set

May 3, 1997

BEGINNERS DIVISION

S0#TRACTIN+ #I+ N0M#ERS

Problem 3:

Write a program that subtract two numbers up to 32 characters long. Both numbers must be included inthe same line and they will be separated by a blank space. Also assume both numbers are integers and positives.

Example Output:

ENTER NUMBERS> 400 321400 - 321 = 79

ENTER NUMBERS> 1000 20011000- 2001 =-1001

ENTER NUMBERS> 0 <EXIT>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 181/499

CUTB Programming ContestProblem set May 3, 1997

BEGINNERS DIVISION

*ACE O* T5E C$OC

Problem 4:

Write a program that inputs a time such as 11:35 (35 minutes after the hour 11), and then draws the faceof a clock with the hour and minute hands positioned to indicate the time. The program needs to validate inputtime. You have free format to design the clock (in CHARACTER environment only), but the time must belegible to the user. You can use the full screen to display time if you want.

Example Output:

ENTER TIME> 11:35

/ 11 12 1 \ / * \

/ 10 * 2 \ / * \ 9 3

\ , / \8 * 4/ \ * / \ 7 * 5 / \ 6 /

PRESS ENTER TO EXIT>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 182/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 183/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VV,23perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 184/499

CUTB Programming ContestProblem Set

April 27, 1996

EXPERT DIVISION

CA#RA COMPI$ERoblem 3:

Input File Name:Output File Name:CABRA. SRC CABRA. OUT

Definition:A string is any combination of blank, letters, digits and special characters. Words are groups of

characters separated by blanks.

Problem:Develop a CABRA language parser/compiler. The CABRA (Compiler And Basic Reference

Assembler) language has the following features:

1. Can handle up to 20 variables, all of which are global.2. Variables can be up to 6 characters long.3. Only strings (up to 40) can be assigned to variables.4. A variable can store strings up to 40 characters.

A CABRA programmer can use:

1. A COUNT function, which will count, the amount of characters whitin a string(one argument).

2. A PRINT function, which will print, the value for a variable (one argument).3. A BEGIN symbol, which is used to mark the beginning of a program.4. An END symbol, which is used to mark the end of a program.5. An assignment symbol (=), which is used to assign strings to variables.

All functions are reserved symbols. The CABRA compiler should print, an error if.'

1. Any function name is used as a symbol.2. Any unassigned symbol is used in a function.

3. Any undefined function is used.4. Any syntax error. (DO NOT DESCRIBE THE I~RROR!!!)

Additional information:

1. No nested functions are allowed.2. No need to check for case sensitivity.3. THE COMPILER MUST READ UP TO 5 PROGRAMS AS DATA.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 185/499

A sample CABRA program is:

BEGINA1 = "VACA";A2 = "CABALLO";A3 = "GALLINA";C1 = COUNT (A1)',

C2 = COUNT (A2);C3 = COUNT (A3)PRINT (A1);PRINT (C1);PRINT (A2);PRINT (C2);PRINT (A3);PRINT (C3);END

BEGINNING

CABRA- "YES";PRINT (CABRA),END

And its output will be:

Program # 1:VACA4CABALLO7

GALLINA7

Program #2:Syntax Error at Line 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 186/499

Universidad de Puerto RicoBayamónJ Puerto Rico

Competencias de Programación &VV,;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 187/499

Fecha Ap#&( 2 1 : Nombre de la competencia P#+@#*''&n@ C+nt$!tCategoría B$@$nn$#! D&)$!&+n Universidad U P R BAutor Tipo de competenciaProblema <1 Algoritmos

MORSE CODE

0ource File Name( -:R0$4 .N

.nput File Name( -:R0$4 C:#

-:R0$4 #$C Definition:

Perhaps the most famous of all coding schemes is the Morse code, developed by Samuel Morse in 1873for use with the telegraph system. The Morse code assigns a series of dots and dashes to each letter ofthe alphabet, each digit, and a few special characters (such as the period, comma, colon and semicolon).In sound-oriented systems, the dot represents a short sound and the dash represents a long sound. Otherrepresentations of dots and dashes are used with light-oriented systems and signal flag systems.

Separation between words is indicated by a space, or, quite simply, the absence of a dot or dash. In a sound-oriented system,

a space is indicated by a short period of time during which no sound is transmitted. The international version of' the Morse

code is the following table:

-:R0$ C:#$

A ,) ( ,))) S ,,,# ),,, ),) T )C ),), $ ,),, 0 ,,)D ),, M )) H ,,,)E , N ), 6 ,))* ,,), O ))) - ),,)

+ )), P ,)), ),))5 ,,, L )),) 7 )),,I .. R .-.

Problem:

Write a program that reads several lines of text ( MORSE.IN ) and then create a new one using theMorse code ( MORSE.COD ). Read the new file and decodeit to text again ( MORSE.DEC ). Assume4 characters of Morse code per character.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 188/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 189/499

S*'p($ D*t*

0$!$CT$# C:!:R0 R#J @J :RJ BN

ENTER COLORS &Z R#J BUJ BNJ @ MATCJ BDJ @;J @;J N:

ENTER COLORS ' Z R#J :RJ BNJ @ MATCJ BDJ @;J @;J @;

ENTER COLORS =Z R#J @J BNJ :RMATCJ BDJ BDJ @;J @;

ENTER COLORS +Z R#J @J :RJ BN MATCJ BDJ BDJ BDJ BD

YOU KIN WWWWW

SECOND GAME%

0$!$CT$# C:!:R0 R#J @J R#J @ENTER COLORS &Z R#J BUJ BNJ @ MATCJ BDJ BDJ N:J N:

ENTER COLORS ' Z @J BUJ BNJ R# MATCJ @;J @;J N:J N:

ENTER COLORS =Z R#J BUJ BNJ @ MATCJ BDJ BDJ N:J N:

ENTER COLORS +Z R#J :RJ :RJ @

MATCJ BDJ BDJ N:J N:ENTER COLORS Z R#J 9NJ 9NJ @ MATCJ BDJ BDJ N:J N:

ENTER COLORS , Z R#J R#J R#J @ MATCJ BDJ BDJ BDJ N:YOU LOSEWWWWW

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 190/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 191/499

Fecha Ap#&( 2 1 : Nombre de la competencia P#+@#*''&n@ C+nt$!tCategoría BEGINNERS DIVISION Universidad U.P.R.B.Autor Tipo de competenciaProblema <3 Algoritmos

MEAS0REMENT AND 0NIT CONHERSION

Problem:

Write a MENU-DRIVEN program that allows the user the following options:

1) Convert measurements from minutes to hours (two decimal places).2% Convert feet to meters ( 1 foot = 0.3048 meter, two decimal places)3% Convert from degrees Fahrenheit to degrees Celsius ( F = 1.8 C + 32).4) Exit Program.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 192/499

UNIVERSIDAD DE PUERTO RICO

RECINTO DE MAYA UE1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 193/499

University of Puerto RicoMayaguez Campus

ICO- C*allen%e Expert Division

Sponsored by

AEICand Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 194/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 195/499

Fecha l<4lb<3b2<<< Nombre de la competencia l ICOM ChallengeCategoría llE p$#t+ l Universidad Un&)$#!&,*, ,$ Pu$#t+ R&"+6 M*-*@u$8Autor lllllllllllll Tipo de competencia llllllllllllllllllllllllllllll Problema lllll Algoritmos llllllllllllllllllllllllllllllllllllll

Input File : huffman.in

Output File : huffman.outS+u#"$ F&($u '*n.

Hariable Radi9 5uffman Encoding

Problem Description

Huffman encoding is a method of developing an optimal encoding of the symbols in asource alphabet using symbols from a target alphabet when the frequencies of each of the

symbols in the source alphabet are known. Optimal means the average length of anencoded message will be minimized. In this problem you are to determine an encoding ofthe first N uppercase letters (the source alphabet, S 1 through S N, with frequencies f 1 through

f n) into the first R decimal digits (the target alphabet, T 1 through T R).

Consider determining the encoding when R=2. Encoding proceeds in several passes. Ineach pass the two source symbols with the lowest frequencies, say S 1 and S 2, are groupedto form a new "combination letter" whose frequency is the sum of f 1 and f 2. If there is a tiefor the lowest or second lowest frequency, the letter occurring earlier in the alphabet isselected. After some number of passes only two letters remain to be combined. The letterscombined in each pass are assigned one of the symbols from the target alphabet.

The letter with the lower frequency is assigned the code 0, and the other letter is assignedthe code 1. (If each letter in a combined group has the same frequency, then 0 is assignedto the one earliest in the alphabet. For the purpose of comparisons, the value of a"combination letter" is the value of the earliest letter in the combination.) The final codesequence for a source symbol is formed by concatenating the target alphabet symbolsassigned as each combination letter using the source symbol is formed.

The target symbols are concatenated in the reverse order that they are assigned so that thefirst symbol in the final code sequence is the last target symbol assigned to a combinationletter.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 196/499

The two illustrations below demonstrate the process for R-2.

Symbol Frequency Symbol FrequencyA 5 A 7B 7 B 7C ' 8 C 7D 15 D 7

Pass 1: A and B grouped Pass 1: A and B groupedPass 2: {A.B} and C grouped Pass 2: C and D grouped

Pass 3: {A,B,C} and D grouped Pass 3: {A,B} and {C,D} groupedResulting codes: A=110, B=1 l 1, C=10, D=10 Resulting codes: A=00, B=01, C=10, D=11

Avg. Length=(3*5+3*7+2*8+l*15)/35-1.91 Avg. Length=(2*7+2*7+2*7+2*7)/28=2.00

When R is larger than 2, R symbols are grouped in each pass. Since each pass effectivelyreplaces R letters or combination letters by 1 combination letter, and the last pass mustcombine R letters or combination letters, the source alphabet must contain k*(R-1)+Rletters, for some integer k .

Since N may not be this large, an appropriate number of fictitious letters with zerofrequencies must be included. These fictitious letters are not to be included in the output.

In making comparisons, the fictitious letters are later than any of the letters in the alphabet.

Now the basic process of determining the Huffman encoding is the same as for the R= 2case. In each pass, the R letters with the lowest frequencies are grouped, forming a newcombination letter with a frequency equal to the sum of the letters included in the group.The letters that were grouped are assigned the target alphabet symbols 0 through R-1. 0 isassigned to the letter in the combination with the lowest frequency, 1 to the next lowestfrequency, and so forth. If several of the letters in the group have the same frequency, theone earliest in the alphabet is assigned the smaller target symbol, and so forth.

The illustration below demonstrates the process for R=.3.

Symbol FrequencyA 5B 7C 8D 15

Pass 1: ? (fictitious symbol), A and B are groupedPass 2: {?,A,B ), C and D are grouped

Resulting codes: A=I I, B=12, C=0, D=2Avg. Length=(2*5+2*7+ 1*8+ 1*15)/35=1.34

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 197/499

Input

The input will contain one or more data sets, one per line. Each data set consists of aninteger value for R (between 2 and 10), an integer value for N (between 2 and 26), and theinteger frequencies f 1 through f N, each of which is between 1 and 999.

The end of data for the entire input is the number 0 for R; it is not considered to be aseparate data set.

For each data set, display its number (numbering is sequential starting with 1) and theaverage target symbol length (rounded to two decimal places) on one line. Then display the

N letters of the source alphabet and the corresponding Huffman codes, one letter and codeper line. The examples below illustrate the required output format.

Sample Input

2 5 5 10 20 25 402 5 4 2 2 1 13 7 20 5 8 5 12 6 9

4 6 10 23 18 25 9 120

Sample Output

Set 1; average length 2.10A: 1100B: 1101C: 111D: 10E: 0

Set 2; average length 2.20A: 11B: 00C: 01D: 100E: 101

Set 3; average length 1.69A: 1B: 00C: 20D: 01E: 22F: 02G: 21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 198/499

Set 4; average length 1.32A: 32B: 1C: 0D: 2E: 31F: 33

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 199/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 200/499

F+# t +!$ un *'&(&*# &t P*!"*( !-nt* 6 t $ $ *'p($ *t t $ $n, + t &! p#+5($' "+'p($t$(- ,$ &n$! t $ !'*(( !u5!$t +! P*!"*( n$$,$,.

.nput

T $ &nput &! t $ !&n@($ &nt$@$#n +n * (&n$ 5- &t!$( &t 1 ≤ n ≤ :.

:utput

T $ +utpu &! * "+'p*t&5($ !t*n,*#, P*!"*( p#+@#*' '$$t&n@ t $ "#&t$#&* !p$"& &$, *5+)$.

0ample .nput

3

0ample :utput

pro ram sort -input,output /Tvara,b,c : inte erTbe in

readln -a,b,c/Tif a V b t4en

if b V c t4enwriteln -a,b,c/

else if a V c t4enwriteln -a,c,b/

elsewriteln -c,a,b/

elseif a V c t4en

wirteln -b,a,c/else if b V c t4en

writeln -b,c,a/else

writeln -c,b,a/end&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 201/499

(nput F&($ u*,t#$$!.&nOutput F&($ u*,t#$$!.+utS+u#"$ F&($ u*,t#$$!.

Luad!ree"

Problem #escription A u*,t#$$ &! * #$p#$!$nt*t&+n +#'*t u!$, t+ $n"+,$ &'*@$!. T $ un,*'$nt*( &,$* 5$ &n, t&! t *t *n- &'*@$ "*n 5$ !p(&t &nt+ +u# u*,#*nt!. E*" u*,#*nt '*- *@*&n 5$ !p(&u*,#*nt!6 $t". In t $ u*,t#$$6 t $ &'*@$ &! #$p#$!$nt$, 5- * p*#$nt n+,$6 &($ t $ +u# u*,#*n#$p#$!$nt$, 5- +u# " &(, n+,$!6 &n * p#$,$t$#'&n$, +#,$#.

O "+u#!$6 & t $ +($ &'*@$ &! * !&n@($ "+(+#6 &t "*n 5$ #$p#$!$nt$, 5- * u*,t#$$ "+n!

n+,$. In @$n$#*(6 * u*,#*nt n$$,! +n(- t+ 5$ !u5,&)&,$, & &t "+n!&!t! + p& $(! + ,& $##$!u(t6 t $ u*,t#$$ n$$, n+t 5$ + un& +#' ,$pt .

A '+,$#n "+'put$# *#t&!t +#?! &t 5(*"?>*n,> &t$ &'*@$! + 32 32 un&t!6 +# * t+t*( + 1<24 p$# &'*@$. On$ + t $ +p$#*t&+n! $ p$# +#'! &! *,,&n@ t + &'*@$! t+@$t $#6 t+ +#' * n$#$!u(t&n@ &'*@$ * p& $( &! 5(*"? & &t *! 5(*"? &n *t ($*!t +n$ + t $ "+'p+n$t &'*@$&t$.

T &! p*#t&"u(*# *#t&!t 5$(&$)$! &n *t $ "*((! t $ preferred fullness +# *n &'*@$ t+ 5$ &nt$#$!t&t+ !$(( +# 5&@ 5u"?!% t $ #n+!t &'p+#t*nt p#+p$#t- &! t $ nu'5$# + &(($, 5(*"?% p& $(! 5$ +#$ *,,&n@ t + &'*@$! t+@$t $#6 $ +u(, (&?$ t+ ?n+ + '*n- p& $(! &(( 5$ 5(*"? &n

#$!u(t&n@ &'*@$. Y+u# 0+5 &! t+ #&t$ * p#+@#*' t *t6 @&)$n t $ u*,t#$$ #$p#$!$nt*"*("u(*t$! t $ nu'5$# + p& $(! t *t *#$ 5(*"? &n t $ &'*@$6 &" &! t $ #$!tu(t + *,,&n@ t $t+@$t $#.

In t $ &@u#$6 t $ &#!t $ *'p($ &! ! + n #+' t+p t+ 5+tt+'% *! &'*@$6 u*,t#$$6 p#$+#,$# !t,$ &n$, 5$(+ % *n, nu'5$# + p& $(!. T $ u*,#*nt nu'5$#&n@ &! ! + n *t t $ t+p + t $ &@u#

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 202/499

2 13 4

X

X

pp$$$ p $$ $ p$ $p$$ $ X pp$$$ p$$ $

44 32< X :4<

.nput

T $ &#!t (&n$ + &nput !p$"& &$! t $ nu'5$# + t$!t "*!$! % % -+u# p#+@#*' *! t+ p#+"$!!. T $ &n$*" t$!t "*!$ &! t + !t#&n@!6 $*" !t#&n@ +n &t! + n (&n$. T $ !t#&n@ &! t $ p#$>+#,$#u*,t#$$6 &n &" t $ ($tt$# dpd &n,&"*t$! * p*#$nt n+,$6 t $ ($tt$# d d u((% * 5(*"? u*,#*d$d $'t-% * &t$ u*,#*nt. It &! @u*#*nt$$, t *t $*" !t#&n@ #$p#$!$nt! * )*(&, u*,t#$$6 + t $ t#$$ &! n+t '+#$ t *n 5$"*u!$ $*" p& $( *! +n(- +n$ "+(+#%.

:utputF+# $*" t$!t "*!$6 p#&nt +n +n$ (&n$ t $ t$ t T $#$ *#$ 5 5(*"? p& $(!.d6 $#$ 5 &! t $ nu'5$# + 5(* p& $(! &n t $ #$!u(t&n@ &'*@$.

0ample .nput

3ppeeefpffeefepefepeefepeeef

peefepeeefpeepefefe

0ample .nput

'4ere are *$! blac pixels&

'4ere are "12 blac pixels&

'4ere are 3 $ blac pixels .

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 203/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 204/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e ' Intermediate Division

Sponsored by

AEICand Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 205/499

Table of Contents

Problem Page

1. Packets .......................................................................................................................3

2. Telephone Tangles .....................................................................................................4

3. Variable Radix Huffman Encoding ............................................................................6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 206/499

ICOM Challenge Programming ContestMarch 4, 2000

Intermediate Division

Input File: packets.inOutput File: packets.outSource File: packets.xxx

Packe!"

Problem Description

A factory produces products packed in square packets of the same height h and of the sizes 1x1, 2x2,3x3, 4x4, 5x5, 6x6. These products are always delivered to customers in the square parcels of the sameheight h as the products have and of the size 6x6. Because of the expenses it is the interest of thefactory as well as of the customer to minimize the number of parcels necessary to deliver the orderedproducts from the factory to the customer. A good program solving the problem of finding the minimal

number of parcels necessary to deliver the given products according to an order would save a lot ofmoney. You are asked to make such a program.

Input

T $ &nput &($ "+n!&!t! + !$)$#*( (&n$! !p$"& -&n@ +#,$#!. E*" (&n$ !p$"& &$! +n$ +#,$#. O#,$#! *#$ ,$!"#&5

!$p*#*t$, 5- +n$ !p*"$ #$p#$!$nt&n@ !u""$!!&)$(- t $ nu'5$# + p*"?$t! + &n,&)&,u*( !&8$ #+' t $ !'*(($!t !&8$ 1

5&@@$!t !&8$ : :. T $ $n, + t $ &nput &($ &! &n,&"*t$, 5- t $ (&n$ "+nt*&n&n@ !& 8$#+!.

Output

The output file contains one line for each line in the input file. This line contains the minimal numberof parcels into which the order from the corresponding line of the input file can be packed. There is noline in the output file corresponding to the last "null" line of the input file.

Sample Input

! ! $ ! ! 1< " 1 ! ! !

! ! ! ! ! !

Sample Output21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 207/499

ICOM Challenge Programming ContestMarch 4, 2000

Intermediate Division

Input File: tangle.inOutput File: tangle.outSource File: tangle.xxx

Telep one Tangle"

Problem Description

A large company wishes to monitor the cost of phone calls made by its personnel. To achieve this thePABX (Private Automatic Branch Exchange) logs, for each call, the number called (a string of up to15 digits) and the duration in minutes. Write a program to process this data and produce a reportspecifying each call and its cost, based on standard Telecom charges.

International (IDD) numbers start with two zeroes (00) followed by a country code (1-3 digits)followed by a subscriber's number (4-10 digits). National (STD) calls start with one zero (0) followedby an area code (1-5 digits) followed by the subscriber's number (4-7 digits). The price of a call isdetermined by its destination and its duration. Local calls start with any digit other than 0 and are free.

Input

Input will be in two parts. The first part will be a table of IDD and STD codes, localities and prices asfollows:

Code Locality nameSprice in cents per minute

where represents a space. Locality names are 25 characters or less. This section is terminated by aline containing 6 zeroes (000000).

The second part contains the log and will consist of a series of lines, one for each call, containing thenumber dialled and the duration. The file will be terminated a line containing a single #. The numberswill not necessarily be tabulated, although there will be at least one space between them. Telephonenumbers will not be ambiguous.

Output

Output will consist of the called number, the country or area called, the subscriber's number, theduration, the cost per minute and the total cost of the call, as shown below.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 208/499

Local calls are costed at zero. 6f the number has an invalid code, list the area as DUnEnoFnDand the cost as G'.00.

Sample Input

! B2" >roadwood 1!3 6rrowtown 3!!*1 6ustralia 1$!!!!!!!!31"2* 22!!*1 "32<B 3! B2"*2 <213 122<<B<*! 1!!2 32<*B "?

Sample Output

!31"2* 6rrowtown 1"2* 22 !&3 &3*!!*1 "32<B 6ustralia "32<B 3 1&$! $&2!! B2"*2 <213 >roadwood *2 <213 122 !& 1 B & 2<<B<*! ocal <<B*<! 1 !&!! !&!!!!2 32<*B 7n nown " D1&!!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 209/499

ICOM Challenge ProgrammingContest March 4, 2000Intermediate Division

Input File: huffman.inOutput File: huffman.out

Source File: huffman.xxx

Hariable Radi9 5uffman Encoding

Problem Description

Huffman encoding is a method of developing an optimal encoding of the symbols in a source alphabet usingsymbols from a target alphabet when the frequencies of each of the symbols in the source alphabet are known.Optimal means the average length of an encoded message will be minimized. In this problem you are todetermine an encoding of the first N uppercase letters (the source alphabet, S 1 through S N , with frequencies f 1

through f n) into the first R decimal digits (the target alphabet, T 1 through T R).Consider determining the encoding when R=2. Encoding proceeds in several passes. In each pass the two sourcesymbols with the lowest frequencies, say S 1 and S 2, are grouped to form a new "combination letter" whosefrequency is the sum of f 1 and f 2. If there is a tie for the lowest or second lowest frequency, the letter occurringearlier in the alphabet is selected. After some number of passes only two letters remain to be combined. Theletters combined in each pass are assigned one of the symbols from the target alphabet.

The letter with the lower frequency is assigned the code 0, and the other letter is assigned the code 1. (If eachletter in a combined group has the same frequency, then 0 is assigned to the one earliest in the alphabet. For thepurpose of comparisons, the value of a "combination letter" is the value of the earliest letter in the combination.)

The final code sequence for a source symbol is formed by concatenating the target alphabet symbols assigned aseach combination letter using the source symbol is formed.

The target symbols are concatenated in the reverse order that they are assigned so that the first symbol in thefinal code sequence is the last target symbol assigned to a combination letter.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 210/499

The two illustrations below demonstrate the process for R=2 .

Symbol FrequencyA 5B 7C 8D 15

Pass 1: A and B grouped

Pass 2: (A,B) and C groupedPass 3: (A,B,C) and D groupedResulting codes: A=110, B=111, C=10, D=10Avg. Length=(3*5+3*7+2*8+ 1*15)/35=1.91

Symbol FrequencyA 7B 7C 7D 7

Pass 1: A and B grouped

Pass 2: C and D groupedPass 3: {A,B} and {C,D} groupedResulting codes: A=00, B=01, C=10, D=11Avg. Length=(2*7+2*7+2*7+2*7)/28=2.00

When R is larger than 2, R symbols are grouped in each pass. Since each pass effectively replaces R letters orcombination letters by 1 combination letter, and the last pass must combine R letters or combination letters, thesource alphabet must contain k*(R-1)+R letters, for some integer k.

Since N may not be this large, an appropriate number of fictitious letters with zero frequencies must beincluded. These fictitious letters are not to be included in the output. In making comparisons, the fictitious

letters are later than any of the letters in the alphabet.

Now the basic process of determining the Huffman encoding is the same as for the R=2 case. In each pass, the R letters with the lowest frequencies are grouped, forming a new combination letter with a frequency equal tothe sum of the letters included in the group. The letters that were grouped are assigned the target alphabetsymbols 0 through R-1.0 is assigned to the letter in the combination with the lowest frequency, 1 to the nextlowest frequency, and so forth. If several of the letters in the group have the same frequency, the one earliest inthe alphabet is assigned the smaller target symbol, and so forth.

The illustration below demonstrates the process for R=3.

Symbol FrequencyA 5B 7C 8D 15

Pass 1: ? (fictitious symbol), A and B are groupedPass 2: (?,A,B}, C and D are groupedResulting codes: A=1 1, B=12, C=0, D=2Avg. Length=(2*5+2*7+ 1 *8+1 *15)/35=1.34

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 211/499

Input

The input will contain one or more data sets, one per line. Each data set consists of an integer value for R(between 2 and 10), an integer value for N (between 2 and 26), and the integer frequencies f 1 through f N, each ofwhich is between 1 and 999.

The end of data for the entire input is the number 0 for R; it is not considered to be a separate data set.

Output

For each data set, display its number (numbering is sequential starting with 1) and the average target symbollength (rounded to two decimal places) on one line. Then display the N letters of the source alphabet and thecorresponding Huffman codes, one letter and code per line. The examples below illustrate the required outputformat.

Sample Input

2 5 5 10 20 25 402 5 4 2 2 1 13 7 20 5 8 5 12 6 94 6 10 23 18 25 9 120

Sample Output

Set 1; average lengthA: 1100B: 1101C: 111D: 10

E: 0

2.10

Set 2; average lengthA: 11B: 00C: 01D: 100E: 101

2.20

Set 3; average length 1.69A: 1B: 00C: 20D: 01E: 22F: 02G: 21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 212/499

Set 4; average length 1.32A: 32B: 1C: 0D: 2E: 31F: 33

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 213/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 214/499

Table of Contents

Problem Page

1. MasterMind Hints ......................................................................................................3

2. Recognizing Good ISBNs ..........................................................................................6

3. Packets........................................................................................................................8

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 215/499

ICOM Challenge Programming ContestMarch 4, 2000

Beginner Division

Input File: master, inOutput File: master.outSource File: master.xxx

Ma"!er)Mind 5in!"

Problem Description

MasterMind is a game for two players. One of them, Designer, selects a secret code. The other, Breaker, triesto break it. A code is no more than a row of colored dots. At the beginning of a game, the players agree uponthe length N that a code must have and upon the colors that may occur in a code.

In order to break the code, Breaker makes a number of guesses, each guess itself being a code. After each

guess Designer gives a hint, stating to what extent the guess matches his secret code.In t &! p#+5($' -+u &(( 5$ @&)$n * !$"#$t "+,$ !1 sn *n, * @u$!! # 1 # n6 *n, *#$ t+ ,$t$#'&n$ t $ &nt. A &consists of a pair of numbers determined as follows.

A match is a pair (i,j), 1 < i < n and 1 < j< n, such that si = g j. Match (i,j) is called strong when i = j, and iscalled weak otherwise. Two matches (i,j) and (p,q) are called independent when i = p if and only if j = q. A setof matches is called independent when all of its members are pairwise independent. The following table is anexample of how a match pair is given by the Designer of the secret code to the Breaker.

Brea3er9uessNumber

Breaker GuessCode

Match Pair ( i,j)

1 1123 (1,1)2 4335 (2,0)3 6551 (1,2)4 6135 (1,2)5 1355 (4,0)

D$!&@n$# " ++!$! *n &n,$p$n,$nt !$t M + '*t" $! +# &" t $ t+t*( nu'5$# + '*t" $! *n, t $ nu'5$!t#+n@ '*t" $! *#$ 5+t '* &'*(. T $ &nt t $n "+n!&!t! + t $ nu'5$# + !t#+n@ +((+ $, 5- t $ nu'5$$*? '*t" $! &n . N+t$ t *t t $!$ nu'5$#! *#$ un& u$(- ,$t$#'&n$, 5- t $ !$"#$t "+,$ *n, t $ @u$!!.&nt tu#n! +ut t+ 5$ n6<%6 t $n t $ @u$!! &! &,$nt&"*( t+ t $ !$"#$t "+,$.

T*5($ 1 D$!&@n$# C+,$ 13 .

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 216/499

Input

The input will consist of data for a number of games. The input for each game begins with an integerspecifying N (the length of the code). Following these will be the secret code, represented as N integers, whichwe will limit to the range 1 to 9. There will then follow an arbitrary number of guesses, each also representedas N integers, each in the range 1 to 9. Following the last guess in each game will be N zeroes, these zeroes arenot to be considered as a guess. Following the data for the first game will appear data for the second game (ifany) beginning with a new value for N . The last game in the input will be followed by a single zero (when avalue for N would normally be specified). The maximum value for N will be 1000.

Output

The output for each game should list the hints that would be generated for each guess, in order, one hint perline. Each hint should be represented as a pair of integers enclosed in parentheses and separated by a comma.The entire list of hints for each game should be prefixed by a heading indicating the game number; games arenumbered sequentially starting with 1. Look at the samples below for the exact format.

0ample .nput

$1 3 " "1 1 2 3$ 3 3 "* " " 1* 1 3 "1 3 " "! ! ! !1!1 2 2 2 $ " * * * B1 2 3 $ " * < B 1

1 1 2 2 3 3 $ $ " "1 2 1 3 1 " 1 * 1 B1 2 2 " " " * * * <! ! ! ! ! ! ! ! ! !!

0ample :utput

ame 1:-1,1/-2,!/

-1,2/-1,2/-$,!/

ame 2:-2,$/-3,2/-",!/-<,!/

ICOM Challenge Programming Contest

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 217/499

March 4, 2000Beginner Division

Input File: isbn.inOutput File: isbn.outSource File: isbn.xxx

Recogni1ing +ood IS#N"

Problem Description

Most books now published are assigned a code which uniquely identifies the book. The International Standard BookNumber, or ISBN, is normally a sequence of 10 decimal digits, but in some cases, the capital letter X may also appear asthe tenth digit. Hyphens are included at various places in the ISBN to make them easier to read, but have no othersignificance. The sample input and expected output shown below illustrate many valid, and a few invalid, forms forISBNs.

Actually, only the first nine digits in an ISBN are used to identify a book. The tenth character serves as a check digit toverify that the preceding 9 digits are correctly formed. This check digit is selected so that the value computed as shown inthe following algorithm is evenly divisible by 11. Since the check digit may sometimes need to be as large as 10 toguarantee divisibility by 11, a special symbol was selected by the ISBN designers to represent 10, and that is the roleplayed by X.

The algorithm used to check an ISBN is relatively simple. Two sums, sl and s2, are computed over the digits of the ISBN,with s2 being the sum of the partial sums in sl after each digit of the ISBN is added to it. The ISBN is correct if the finalvalue of s2 is evenly divisible by 11.

An example will clarify the procedure: Consider the (correct) ISBN 0-13-162959-X (for Tanenbaum's ComputerNetworks). First look at the calculation of sl:

Digits in the ISBN 0 1 3 1 6 2 9 5 9 10 (X)

sl (partial sums) 0 1 4 5 11 13 22 27 36 46

The calculation of s2 is done by computing the total of the partial sums in the calculation of s1:

s2 (running totals) 0 1 5 10 21 3 4 5 6 8 3 119 16 5

We now verify the correctness of the ISBN by noting that 165 is, indeed, evenly divisible by 11.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 218/499

Input

The input data for this problem will contain one candidate ISBN per line of input, perhaps preceded and/orfollowed by additional spaces. No line will contain more than 80 characters, but the candidate ISBN maycontain illegal characters, and more or fewer than the required 10 digits. Valid ISBNs may include hyphens atarbitrary locations. The end of file marks the end of the input data.

Output

The output should include a display of the candidate ISBN and a statement of whether it is legal or illegal. Theexpected output shown below illustrates the expected form.

Sample Input

0-89237-010-60-8306-3637-4

0-06-017758-6This_is_garbage

1-56884-030-60-8230-2571-3

0-345-31386-00-671-88858-70-8104-5687-70-671-74119-50-812-52030-00-345-24865-1-150

0-452-26740-40-13-139072-40-1315-2447-X

Sample Output

!D B23<D!1!D* is correct&!D 3!*D3*3<D$ is correct&!D!*D!1<<" D* is correct&'4isSisS arba e is incorrect&1D"* $D!3!D* is correct&!D 3!*D3*3<D$ is correct&!D!*D!1<<" D* is correct&1D"* $D!3!D* is correct&!D 23!D2"<1D3 is correct&!D3$"D313 *D! is correct&!D*<1D " D< is correct&!D 1!$D"* <D< is correct&!D*<1D<$11BD" is correct&!D 12D"2!3!D! is correct&!D3$"D2$ *"D1D1"! is incorrect&!D$"2D2*<$!D$ is correct&!D13D13B!<2D$ is correct&!D131"D2$$<D# is correct&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 219/499

ICOM Challenge Programming ContestMarch4, 2000

Beginner Division

Input File: packets.inOutput File: packets.outSource File: packets.xxx

Packe!"

Problem Description

A factory produces products packed in square packets of the same height h and of the sizes 1x1, 2x2, 3x3, 4×4,5x5, 6x6. These products are always delivered to customers in the square parcels of the same height h as theproducts have and of the size 6x6. Because of the expenses it is the interest of the factory as well as of thecustomer to minimize the number of parcels necessary to deliver the ordered products from the factory to thecustomer. A good program solving the problem of finding the minimal number of parcels necessary to deliver the

given products according to an order would save a lot of money. You are asked to make such a program.

Input

The input file consists of several lines specifying orders. Each line specifies one order. Orders are described bysix integers separated by one space representing successively the number of packets of individual size from thesmallest size 1x1 to the biggest size 6x6. The end of the input file is indicated by the line containing six zeros.

Output

The output file contains one line for each line in the input file. This line contains the minimal number of parcelsinto which the order from the corresponding line of the input file can be packed. There is no line in the output filecorresponding to the last "null" line of the input file.

Sample Input

! ! $ ! ! 1< " 1 ! ! !! ! ! ! ! !

Sample Output

21

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 220/499

University o7 Puerto Rico-ayagueQ Campus

!"#$ "%allen&e **

+ pert -ivision

Sponsored by

AAAEICand Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 221/499

Table of Contents

Problem Page

AWESOME DECIMALS ...................................................................................................................3

TO CACHE OR NOT TO CACHE ....................................................................................................4OBSTACLES ...................................................................................................................................'7

A SIMPLE INTERPRETER .............................................................................................................l0

STRONGLY CONNECTED COMPONENTS ................................................................................13

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 222/499

ICOM C allenge Programming Con!e"!

@arch '", ')))

>pert 9ivision

Inpu! *ile: decimal",in

Butput ;ile! decimals.out

Source *ile: decimal",>999?

AKe"ome Decimal"

Problem Description

D*#$ t+ &n, * !t#&n@ t *t *,,! up t+ * @&)$n nu'5$#. T $ !t#&n@ &(( "+n!&!t + t $ ,&@&t! <> % &t +pt&+n*( p(u! % *n, '&nu! >% !&@n! 5$t $$n t $'. D&@&t! 5$t $$n t + !&!&n@($ ,$"&'*( nu'5$#. K *t ! t $ "*t" h Y+u *)$ t+ u!$ *(( ,$"&'*( ,&@&t!6 &n *!"$n,&n@ +#,t $ !*'p($ &nput *n, -+u &(( !$$.

Y+u# p#+@#*' &(( #$*, !$)$#*( &nt$@$#! #+' t $ &nput &($6 +n$ nu'5$# p$# (&n$. T $&(( *)$ +n$ (&n$ p$# $*" (&n$ + t $ &nput &($. F+# $*" nu'5$# &t * )*(&, !+(ut&+n6 t $*)$ t $ !+(ut&+n !t#&n@ +((+ $, 5- * !p*"$6 *n $ u*( X% !&@n6 *n+t $# !p*"$ *n, t $ nu'5$# t $#$ &! n+ !+(ut&+n +# t *t nu'5$#6 t $ (&n$ &(( *)$ t $ !t#&n@ T $#$ &! n+ !+(ut&+n +# +t $ nu'5$#. R$'$'5$# t+ p#&nt t $ !&@n *t t $ 5$@&nn&n@ $n #$ u&#$,.

Sample Input

23$"*<B $3"<$$"<*

Sample Output

D!1F23$"*< B % 23$"*<'4ere is no solution for B $3"<$F!1D23F$"D*<F B % $"D!1D2F3$F"*F< B % <*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 223/499

.C:- Challenge Programming Contest

M*#" 136 1

E p$#t D&)&!&+n

.nput File( cache4in

:utput File( cache4outS+u#"$ F&($ "*" $.f Z

To Cac e or no! !o Cac e , , ,

Problem #escription

Y+u# 0+5 &! t+ '*?$ * !&'u(*t&+n + * '$'+#- !-!t$'6 *n, t+ @*t $# !t*t&!t&"! +n &t! p$# +&(( u!$ *"tu*( '$'+#- t#*"$! #+' t $ !+ t *#$ t *t &(( #un +n t $ !-!t$'. T $ !-!t$' *! * #$(*t&)$(- !'*

5ut *!t "*" $ '$'+#- *n, * (*#@$ 5ut !(+ RAM. T $ *,,#$!! !p*"$ &! 32 5&t! &,$6 *(( + &" *,,#$!!*5($. T $ "*" $ &! * ,&#$"t '*pp$, "*" $.

T $ &nput &($ &(( *)$ t $ +((+ &n@ &n +#'*t&+n

] Nu'5$# + 5-t$! &n n+#'*( '$'+#-] Nu'5$# + 5-t$! &n "*" $ '$'+#-] Nu'5$# + 5-t$! p$# "*" $ (&n$] M$'+#- *""$!!$! + * p+#t&+n + t $ "+,$

Y+u "*n *!!u'$ t $ +((+ &n@ *5+ut t $ &nput ,*t*

] A(( '$*!u#$! + t $ "*" $ *n, '$'+#- &#!t +u# &nput!% *#$ p+ $#! + t +] I f "*" $ !&8$ f M$'+#- !&8$ f 4GB] T $ "*" $ "*n +(, *t ($*!t +n$ "+'p($t$ !$t + (&n$!.] On(- +n$ p#+"$!!+# 5u! '*!t$#% *! *""$!! t+ t &! '$'+#- !-!t$'.

T $ +utput &(( *)$ * (&n$ p$# '$'+#- *""$!! &n"(u,$, &n t $ &nput &($. Y+u# p#+@#*' ! **""$!! #$!u(t$, +n * '&!! +# * &t6 *n, *t (&n$ + t $ "*" $ *! *""$!!$,.

;ints(

• S$$ t $ (*!t p*@$ + t &! p#+5($' +# * #$ #$! $# "+u#!$ +n "*" $!

0ample .nput

$23 2 1 3 ! $ $ $ " " * 3 3 3 " * < $ 3 < * " 1 1 $ " $ * <

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 224/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 225/499

Knowing what's in a cache line

A t*@ &! ?$pt +# $*" (&n$ !*)$, &n t $ "*" $. E*" t*@ &(( !$#)$ t+ ,$t$#'&n$ & t $ RAM"u##$nt *""$!! &! p*#t + &t! "+##$!p+n,&n@ (&n$. T*@! *#$ "+n!t#u"t$, 5- !*)&n@ t $ '+!t !*,,#$!!$! + t $ (+"*t&+n! + * (&n$. A(( (+"*t&+n! &n * (&n$ &(( ! *#$ t $ !*'$ *,,#$!! p#$ & . T $ 5&t! + t $ *,,#$!! ,$t$#'&n$ t $ + !$t + $*" (+"*t&+n #+' t $ !t*#t + t $ (&n$.

Associativity

T $ "*" $ '*- 5$ ,&)&,$, u#t $# &nt+ @#+up! + (&n$! "*(($, !$t!. E)$#- !$t *! t $ !*'$ !&8"+##$!p+n,! t+ * @#+up + (&n$! + RAM. E*" (&n$ +n t &! @#+up "*n 5$ p(*"$, &n *n- "+##$!p+n,&n@ !$t.

• D&#$"t '*pp$, "*" $ > K $n $*" !$t *! +n(- +n$ (&n$. T $#$ &! +n(- +n$ p+!!&5($ "*" $ (&n$ +# $*" (+"*t&+n + '$'+#-.

• Fu((- *!!+"&*t&)$ "*" $ > T $ +($ "*" $ &! +#'$, 5- * !&n@($ !$t. D*t* #+' RAM '*- 5$ +(&n$ + t $ "*" $.

• S$t *!!+"&*t&)$ "*" $ > T $#$ &! '+#$ t *n +n$ !$t &n t $ "*" $6 *n, $*" !$t *! n (&n$!. A (&n$ #+' RAM '

*n- + t $ n (&n$! + t $ "+##$!p+n,&n@ !$t. T &! "*" $ &! !*&, t+ 5$ n> *- !$t *!!+"&*t&)$.

N+t$ t *t $ &#!t t + t-p$! + "*" $! *#$ !p$"&*( "*!$! + !$t *!!+"&*t&)$ "*" $!.

Computing set number and tags

T $ &@u#$ 5$(+ ! + ! * *,,#$!!$! *#$ ,$"+'p+!$, t+ @&)$ t $&# "+##$!p+n,&n@ t*@6+ !$t. N+t$ t *t

• Nu'5$# + 5&t! n$$,$, +# 5(+"? + !$t X I+@2 "*" $ (&n$ !&8$%• Nu'5$# + 5&t! n$$,$, +# !$t nu'5$# X I+@2 nu'5$# + !$t!%• T $ #$!t + t $ *,,#$!! '*- 5$ u!$, +# t $ t*@

'>5&t *,,#$!!

T*@ S$t B(+"? O !$t

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 226/499

.C:- Challenge Programming Contest-arch &=J &VVV$5pert #ivision

Input F&($ +5!t*"($.&nOutput F&($ +5!t*"($.+ut

S+u#"$ F&($ +5!t*"($.f Z

Ob"!acle"

Problem #escription

A #+5+t '+)$! &n * #++' u(( + +5!t*"($!. G&)$n t $ p#$!$nt p+!&t&+n + t $ #+5+t6 &n, t+ * @&)$n ,$!t&n*t&+n6 *)+&,&n@ *n- +5!t*"($!. Y+u '*- *!!u'$ t $ +((+ &n@

• T $ #+5+t *n, t $ ,$!t&n*t&+n *)$ n+ !&8$.• A(( +5!t*"($! *#$ #$"t*n@u(*#.• T $#$ &! +n$ *n, +n(- +n$ ! +#t$!t )*(&, #+ut$ t+ t $ ,$!t&n*t&+n.• T $ #++' &! * ! u*#$ + '* &'u' !&8$ 4<• O5!t*"($! ,+ n+t t+u" +n$ *n+t $# • A(( "++#,&n*t$! *#$ @&)$n &n &nt$@$# nu'5$#!• T $#$ &(( 5$ n+ '+#$ t *n t$n 1<% +5!t*"($! &n *n- &nput !$t.

T $ &nput &($ "+nt*&n! !$ u$n"$ + &n,$p$n,$nt &nput !$t!. E*" !$t *! t $ +((+ &n@ &n +#

• T $ &n&t&*( p+!&t&+n + t $ #+5+t >- "++#,&n*t$!%• T $ ,$!t&n*t&+n p+&nt >- "++#,&n*t$!%•

T $ nu'5$# + +5!t*"($!• F+# $*" +5!t*"($ +n$ (&n$ p$# +5!t*"($%• T $ >"++#,&n*t$ + t $ ($ t !&,$• T $ >"++#,&n*t$ + t $ #&@ t !&,$• T $ ->"++#,&n*t$ + t $ t+p !&,$• T $ ->"++#,&n*t$ + t $ 5+tt+' !&,$

T $ +utput "+n!&!t! + * !$ u$n"$ + >- "++#,&n*t$! t *t #$p#$!$nt !u""$!!&)$ p+!&t& 5$t $$n !t#*&@ t>(&n$ '+)$!6 +((+ $, 5- t $ ,&!t*n"$ t#*)$($, 5- t $ #+5+t +)$# t $ ! +#t$!t p*t'+#$ t *n +n$ p*t &t t $ !*'$ ! +#t$!t ,&!t*n"$6 " +!$ t $ +n$ &t t $ (+ $!t nu'5$# + '+)$!. Y p#+@#*' ! +u(, &n, t $ *n! $# &n * #$*!+n*5($ *'+unt + t&'$. A!? t $ 0u,@$! +# &n!t#u"t&+n

t&'$ &! #$*!+n*5($.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 227/499

0ample .nput

1 1B B1!1 2 $ 33 $ 3

" 1! 3 1B 1! " $" 1! < ** B 1! 11 B 1! 11 11 1!B 11 1!3 $ 1! B

0ample :utput

-1, 1/, -$, 3/, -", </, - , /, -B, B/=: 12&3!"1

;ints(

• C+n!&,$# #$p#$!$nt&n@ $*" +5!t*"($ 5- * !-!t$' + +u# &n$ u*(&t&$!. E*" '+)$#$p#$!$nt$, *! * !$@'$nt. I *n- p+&nt + t $ !$@'$nt !*t&! &$! t $ &n$ u*(&t&$!6 t $n)*(&,6 5$"*u!$ &t "#+!!$! *n +5!t*"($.

• An *(t$#n*t&)$ +u(, 5$ t+ #$p#$!$nt t $ p#+5($' !p*"$ u!&n@ * ,&#$"t$, @#*p 6 *n, ?n+ n *(@+#&t ' +# &n,&n@ t $ !&n@($>!+u#"$ ! +#t$!t p*t +n t $ ,&#$"t$, @#*p .

• N+t$ t *t t &! p#+5($' 5$"+'$! unt#*"t*5($ 5- u!&n@ +n(- 5#ut$ +#"$% +# '+#$ t *n *

+5!t*"($! O n 4%W%6 +#n +5!t*"($!%. A t$# *)&n@ -+u# p#+@#*' +#? +# * $ +5!t*"($&'p($'$nt * !&'p($ $u#&!t&" t+ p#un$ t $ !$*#" t#$$a &. $. ,u#&n@ t $ !$*#" 6 $(&'&n*+5)&+u!(- n+t 5$tt$# t *n t $ 5$!t p*t !+ *#.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 228/499

Notes(

;ere is a picture 7or the sample input and output sho?n above4

0 1 2 3 4 5 6 7 8 9 10 11

11 11

10 10

9 9

8 8

7 7

6 6

5 5

4 4

3 3

2

1 1

0 0

0 1 2 3 4 5 6 7 8 9 10 11

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 229/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 230/499

(&n$ < &(( #$ $#$n"$ t $ &n,$ + t $ (++p t *t !t*#t! &n (&n$ <36 &($ (&n$ < &(( #$ $#$n"$(++p t *t !t*#t! &n (&n$ <:. L&n$ < &(( #$ $#$n"$ t $ &n,$ + t $ (++p t *t !t*#t! &n (&n$ <3.

K#&t$ * p#+@#*' t *t &(( &nt$#p#$t p#+@#*'! #&tt$n &n t $ n$ (*n@u*@$. Y+u# &nt$#t $ +((+ &n@ $##+#!

• An &n,$ + !$t +ut + 5+un,! t $#$ $ &!t! n+ (++p &n,$ *t t $ n$!t&n@ ($)$(!p$"& &$,% P#&nt O !$t +ut + 5+un,! +n * !&n@($ (&n$.

• In)*(&, (&t$#*( *(( (&t$#*(! ! +u(, 5$ un!&@n$, &nt$@$#! f 216 >1% P#&nt In)*(&, (&t$#*( !p$"& &!&n@($ (&n$.

• In)*(&, !-nt* . P#&nt S-nt* $##+# +n * !&n@($ (&n$.I *n $##+# &! ,$t$"t$,6 -+u# &nt$#p#$t$# ! +u(, *!!u'$ t *t t $ #$!t + t $ p#+@#*' &! * )*(&

&t! + n.

0ample .nput

pus4 1pus4 1!!mult 3$pus4pus4 **"3Bpus4 1pus4 1!for

pus4 1pus4 1pus4 "for

pus4 1pus4 !for

pus4 1pus4 !multprint

nextnext

Sample OutputS-nt* $##+# In)*(&, (&t$#*( !p$"& &$,O !$t +ut + 5+un,!1243:

4

121:

1<1

S&nt* E##+# #$!t*#t &t n$ t(&n$

In)*(&, L&t$#*( #$!t*#t &t n$ t (&n$

O !$t +ut + 5+un,! #$!t*#t &tn$ t (&n$

T &! !$@'$nt &! * "+'p($t$ p#+@#*'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 231/499

2<2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 232/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 233/499

Sample Input

1415522165

62326776733487438488

Sample Output12"3$*<8

Note:This input sample has only one set. Your program must accept multiple input sets

from the same file.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 234/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 235/499

Table of Contents

Problem Page

DATABASE LOGGING TABLES ................................................................................................... 3

SUBSETS ......................................................................................................................................5WORD PUZZLE ++ .......................................................................................................................6

TELEPHONE DIRECTORY SEARCH ..........................................................................................8

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 236/499

ICOM Challenge Programming ContestMarch 13, 1999

Intermediate Division

Input File: dblog.inOutput File: dblog.out

Source File: dblog.<xxx>

Da!aba"e $ogging Table"

Problem Description

Most databases have a logging system that keeps track of all datamodifications. The log generated by this system aids in the recovery of the databaseafter a crash.

The data modifications are made through concurrent transactions that affect thedatabase. A transaction reads data, UPDATEs the data and saves it in a space intemporary memory, called a page. The transaction requests that all data updates it hasmade are COMMITted (i.e. written to disk). When all that data is written to disk, thetransaction has ENDed. In case of a database, system or disk error it is possible toABORT a transaction. The logging system keeps a chronological list of these actions.Each list record is of the form:

LSN Type TranslD PageID

Each record has a unique log sequence number (LSN). The type is the actionbeing executed by the transaction (update, commit, end or abort). The transID is the

identification number for the transaction. The pageID is the identification number for thepage being modified.

To provide a static image of the database state before a crash, the logging systemalso keeps track of active transactions and modified pages. Two tables are used forthis purpose:

• A dirty page table (DPT) keeps track of the pages in use. It stores the pageID of themodified page and the LSN, called recLSN, of the first log record that caused thepage to become dirty. Once the transaction that causes the page to become dirtyends or is aborted, the page record in the table is erased.

A transaction table (TT) contains one entry for each active transaction. The entrycontains the transID, the LSN of the most recent log record for this transaction(called lastLSN) and the status of the transaction that is in process (active,aborted or commited). Once the transaction is ended or aborted its record inthe table is erased.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 237/499

G&)$n t $ (+@ #$"+#,!6 #$"+n!t#u"t t $ ,&#t- p*@$ *n, t#*n!*"t&+n t*5($!.S + t $ p#+"$!! t *t #$"+n!t#u"t! t $ t*5($!. Input &($ ,5(+@.&n "+nt*&n! t $ (+@#$"+#,! &n t $ +#'*t

LSN type: transID pageID

The output file dblog.out should contain the dirty page table and transactiontable in the format:

LSN: DPT=[pageID,recLSN),...],TT=[(transID,lastLSN,status),..]

Notes

• A transaction is active if it has made an update and is not committed,aborted or ended.

• Only update records require pageID S .• A page is not taken off the dirty page table until all transactions that modifiedit are either committed/ended or aborted.

Sample Input

10 update: T1 P120 commit: TI30 end: TI

40 update: T2 P250 update: T3 P360 update: T2 P370 abort: T280 update: T4 P590 update: T4 P4100 commit: T3

S*'p($ Output

10: DPT=[(P1,10)], TT=[(T1, 10, a)]

20: DPT=[(P1,10)], TT=[(T1, 20, c)]30: DPT=[], TT=[]40: DPT=[(P2,40)], TT=[(T2, 40, a)]50: DPT=[(P2,40), (P3,50)], TT=[(T2, 40, a), (T3,50,a)]60: DPT=[(P2,40), (P3,50)], TT=[(T2, 60, a), (T3,50,a)]70: DPT=[(P2,40), (P3,50)], TT=[(T2, 60, b), (T3,50,a)]80: DPT=[(P3,50), (P5,80)], TT=[(T3,50,a), (T4,80,a)]90: DPT=[(P3,50), (P5,80), (P4, 90)], TT=[(T3,50,a), (T4,90,a)]100: DPT=[(P3,50), (P5,80), (P4, 90)], TT=[(T3,100,c), T4,90,a)]

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 238/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 239/499

ICOM Challenge Programming ContestMarch 13, 1999

Intermediate Division

@ord PuQQle ^^

Input File: puzzle2.inOutput file: puzzle2.outSource File: puzzle2.<xxx>

Puzzle Description

In a word puzzle you are given a list of words and a grid of letters. Theobjective of the game is to find all listed words embedded in the grid of letters.The words can be found horizontally, vertically or diagonally. In this variation ofthe game, words can also appear twisted (see figure below).

Make a program that will solve a word puzzle. Your program must find allwords present and output the position of each letter of the word on the grid. Theinput file consists of the dimension of the grid, the grid of letters and a list ofwords to find.

The output file will be the list of letters, followed by the coordinate of everyletter of the word, or the string "not found".

t c n j 1 p

g w i s u r

o e o z t g

o b z r e h

d l m h d i

e h e l l o

Sample Input

*'CLN P9;75

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 240/499

OEOZTGOBZREH DLMHDIEHELLOpuzzlewordproblem

hellotwistedarrayinputoutput

ample Butput

puzzle (0, 5) (1, 4) (2, 3) (3, 2) (4, 1) (5, 0)word (1, 1) (2, 2) (3, 3) (4, 4)problem not foundhello (5, 1) (5, 2) (5, 3) (5, 4)twisted (0, 0) (1, 1) (1, 2) (1, 3) (2, 4) (3, 4) (4, 4)array not foundinput not foundoutput not found

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 241/499

AEIC Challenge Programming ContestMarch 13, 1999

Intermediate Division

Input File: teldir. inOutput File: teldir. out

Source File: teldir.<xxx>

Telep one Direc!or% Searc

Problem Description

Some voice mail systems allow users to search for phone numbers of otherregistered users of the system. To do so, one must spell the name or a. prefix of thename of the person to call. This is accomplished by pressing the key numbercorresponding to each letter of the prefix.

Use the following diagram to map numbers on the keypad to letters.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 242/499

Write a program that finds all names in the directory that match a given nameprefix. The prefix is given as a sequence of keypad presses. Begin by matching the lastname and then the first name.

The input will consist of:

• Number of names/records in the dictionary• List of names in the dictionary• Number of keypad numeric sequences• Numeric sequences (one per line).

The maximum number of characters in the number sequence is 11. Allow 32bytes for names.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 243/499

The output file consists of the numeric sequence followed by the list ofnames that matched the sequence or the message "No Matches Found".

Sample Input

10Velez, Carlos

Torres, AnaJolie, AngelinaLopez, MaribelLaguerre, TonyLoperena, MarthaSantos, BenjaminKorg, JamesKlinger, HeidiQuestell, Eduardo42345

567567375

Sample Output

Sequence: 2345Result:No Matches Found

Sequence: 567Results:Lopez, MaribelLoperena, MarthaKorg, James

Sequence: 56737Results:Loperena, Martha

Sequence: 5Results:Jolie, Angelina

Lopez, MaribelLaguerre, TonyLoperena, MarthaKorg, JamesKlinger, Heidi

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 244/499

0ni.er"i!% of Puer!o RicoMa%ague1 Campu"

!"#$ "%allen&e ** Beginner Division

Sponsored by

AEICand Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 245/499

Table of Con!en!"

Problem Page

PARITY BIT………..…………………………………………………………………….…..3

XMORSE………………………………………………………….………………..……......6

Y2K PROBLEM….………………………………………………………………………..…8

THE BART CHALLENGE…………………………………………………………………10

WORD PUZZLE……………………………………………………………………………11

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 246/499

Input File: parity.inOutput File: parity.out

Source File: parity.<xxx>

Pari!% C ecking

Problem #escription

P$# *p! t $ !&'p($!t +#' + t#*n!'&!!&+n $##+# ,$t$"t&+n &! p*#&t- " $"?&n@ p*#&t- + * !$t + ,*t* &! t $ p*#&t- + t $ nu'5$# + 5&t! &t )*(u$ + 1 &n t $ ,*t*F+# $ *'p($6 t $ ,*t* <<11<<1< *! *n +,, p*#&t-6 &($ <111<<1< *! *n $)$n p*#&t-.

In * t#*n!'&!!&+n !-!t$'6 t $ !$n,$# + t $ ,*t* &(( 5un,($ $*" ,*t* p*"?$t&t *n *,,&t&+n*( 5&t t *t &(( +#"$ t $ p*#&t- + t $ +($ t+ 5$ $)$n +# +,,6

,$p$n,&n@ +n *t p*#&t- t $ #$"$&)$# *n, !$n,$# *)$ *@#$$, up+n. T $ #$"$&)$# t $n *!!u'$ t *t *(( "+##$"t p*"?$t! *)$ t *t p*#&t-. An- p*"?$t! &t &n"+##$"t p*#&&(( 5$ ,&!"*#,$, *n, #$!$nt.

T $ ,#* 5*"? + t &! '$t +, &! t *t n+ '+#$ t *n +n$ $##+# '*- 5$ ,$t$"t$,.Fu#t $#'+#$6 $n t $ $##+# &! ,$t$"t$,6 t $ ,*t* "*nn+t 5$ "+##$"t$,. T $ p*"?$t *! t+ 5$ #$!$nt #+' t $ +t $# !&,$ + t $ t#*n!'&!!&+n " *nn$(.

B- u!&n@ t +>,&'$n!&+n*( p*#&t- " $"?&n@6 '+#$ t *n +n$ $##+# '*- ,$t$"t$,. I t $#$ &! +n(- +n$ $##+#6 t $ ,*t* '*- 5$ "+##$"t$,6 *)+&,&n@ #$!$n,!. In t,&'$n!&+n*( p*#&t- " $"?&n@6 * @#+up + ,*t* *n, p*#&t- 5&t p*"?$t! *#$ 5un,($, t*n, *n *,,&t&+n*( p*#&t- p*"?$t &! @$n$#*t$, u!&n@ $*" + t $ p*"?$t! &n t $ @#*,,&t&+n*( p*"?$t *! p*#&t- 5&t! +# $*" "+(u'n 5&t p+!&t&+n% + t $ ,*t* p*"?$t $&# "+##$!p+n,&n@ p*#&t- 5&t!. T $ +((+ &n@ &! * @#+up + ,*t* *n, p*#&t- 5+((+ $, 5- * p*#&t- p*"?$t.

PacketNumber

Data (four bits) ParityBit

0 0 0 1 1 01 1 0 1 0 0234

001

101

011

001

110

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 247/499

Y+u# p#+@#*' &(( ,$t$"t $##+#! &n * !$t + p*"?$t!. I t $#$ &! +n(- +n$ $##+#6 &t &(t $ $##+# *n, ! + $#$ t $ $##+# +""u##$,. Y+u '*- *!!u'$ t $ p*#&t- p*"?$t &((

n$)$# 5$ "+##upt$,.

T $ &nput &(( "+n!&!t + * !$ u$n"$ + &nput !$t!. E*" &nput !$t &(( "+##$!p+n, !$t + p*"?$t!. F+# $*" &nput !$t6 -+u# p#+@#*' &(( #$*,

• T $ nu'5$# + p*"?$t! n% +n t &! !$t• T $ ($n@t &n 5&t!% + t $ p*"?$t!• N p*"?$t!

F+# $*" &nput !$t6 -+u# p#+@#*' &(( ! + t $ +((+ &n@

• T $ !$ u$n"$ + p*"?$t! +n t $ !$t & t $#$ *! +n(- +n$ $##+#6 t $"+##$!p+n,&n@ 5&t 'u!t 5$ "+##$"t$, *n, ! + n "+##$"t$,%

• I '+#$ t *n +n$ $##+# &! ,$t$"t$,6 '*#? t $ #+ ! *n, "+(u'n! $#$ t $ $##+#*#$ &t *n *!t$#&!? t+ t $ #&@ t +# 5+tt+'6 #$!p$"t&)$(-.

0ample .nput

"*!!11!!111!1!!1!!1!!!1!1!1111!!3$!!11!1!1!11!$3!1111111!!!!

0ample :utput

!!11!!111!1!!1!!1!!!1!1!1111!! = =!!11!1!1!11!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 248/499

!111!111!!!!Error corrected in pac et 1, bit 1&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 249/499

Input File: xmorse.inOutput File: xmorse.out

Source File: xmorse.<xxx>

-Mor"e

Problem Description

FBI A@$nt! F+ Mu(,$# *n, D*n* S"u((- *#$ +((+ &n@ * n$ ($*, &n t $&# '+#$"$nt ;>F&($! "*!$. T $- 0u!t #$"$&)$, * t+p !$"#$t ,*t* &($ t #+u@ un+ &"&*( " *t *t "*n p#+)&,$ t $' &t )$#- )*(u*5($ &n +#'*t&+n *5+ut t $ "*!$ t $- *#$ +#?&n@+n. T $ &n +#'*t&+n &n t $ &($ *pp$*#! t+ 5$ $n"#-pt$, &t * !$#&$! + . *n, >A@$nt! 5$(&$)$ t *t t $ '$!!*@$ &! $n"+,$, u!&n@ * @#*p &"*( #$p#$!$nt*t&+n +"+,$. M+#!$ "+,$ #$p#$!$nt! " *#*"t$#! + *n *(p *5$t *! !$ u$n"$! + ,&t! ! +#t ?$-"(+!u#$!% *n, ,* ! (+n@$# ?$- "(+!u#$!%. I $ ($t * p$#&+, .% #$p#$!$nt * ,&t *n, *>% #$p#$!$nt * ,* 6 t $n t $ M+#!$ "+,$ )$#!&+n + t $ En@(&! *(p *5$t "*n

#$p#$!$nt$, *!

A .> N >.B >... O >>>C >.>. P .>>.D >.. >>.>E . R .>.F ..>. S ...G >>. T >J . U ..>I .. V ...>H .>>> K .>>

>.> ; >..>L .>.. Y >.>>M >> >>..

J$(p A@$nt! Mu(,$# *n, S"u((- t+ ,$"+,$ t $ !$"#$t '$!!*@$ 5- #&t&n@ * p#+@#*' t *t &(( &nt$#p#$t t $ &n +#'*t&+n &n M+#!$ "+,$ *! En@(&! .

T $ &nput &($ "+nt*&n! p$#&+,! *n, ,*! $! #$p#$!$nt&n@ * '$!!*@$ "+'p++n(- + t $ En@(&! *(p *5$t *! !p$"& &$, *5+)$. On$ 5(*n? !p*"$ &! u!$, t+ !$p*#($tt$#! *n, t #$$ 5(*n?! *#$ u!$, t+ !$p*#*t$ +#,!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 250/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 251/499

Input File: y2k.inOutput File: y2k.out

Source File: y2k.<xxx>

4 Problem

Problem Description

The Year 2000 problem stems from the fact that, in many computer systemsand databases, the year component of the date is represented by two decimal digits. Ifa person's date of birth (in months/day/year format) is 04/25/92, the apparent age ofthe person would be 6 years old. But was the person born in 1892 or 1992?

Here are some rules that can be used to determine a person's age:

Rule 1 : All persons in the input data will have been born on or before the date of thiscontest (March 13, 1999), this means:

• If the last two digits of the year of birth are 99 and the date within that yearis in the range from March 14 through December 31 1999, then the year ofbirth is 1899.

Rule 2 : If the apparent age is 20 or more, the first two digits of the year of birth are 19.

Rule 3 : If the apparent age is in the range of 7-19, then the existence of school recordswill determine the first two digits of the year. If the person attended school during thepast ten years, then the first two digits of the year of birth are 19, otherwise they are18.

Rule 4 : If the apparent age is 6 or less, then the existence of tax records will determinethe first two digits of the year of birth. If there is a tax record for the person, the first twodigits of the year of birth are 18; otherwise they are 19.

You may assume that all cases that arise in the input data will be covered bythe rules just stated.

Each line of the input consists of seven fields. Adjacent fields are separated byone blank space. The meaning of each field of the seven fields of inputs follows:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 252/499

C+(u'n! 1>2 t $ p$#!+nd! n*'$

C+(u'n! 2 >3 t $ p$#!+n !+"&*( !$"u#&t- nu'5$#

C+(u'n! 3 >4< * 4 " *#*"t$# "+,$ &" ,$!&@n*t$! t $ (*!t ?n+ n

!" ++( *tt$n,$, 5- t $ p$#!+n ,u#&n@ t $ p*!t t$n

-$*#!. T $ "+,$ [>>>>[ '$*n! t *t t $ p$#!+n ,&, n+t *tt$n, !" ++(

,u#&n@ t *t p$#&+,.

C+(u'n! 42>43 t $ (*!t t + ,&@&t! + t $ '+!t #$"$nt -$*# &n &"

t $ p$#!+n &($, * t* #$tu#n6 & * t* #$tu#n &! ?n+ n

t+ *)$ 5$$n &($, !&n"$ 1 <. Ot $# &!$6 t $#$ &! n+ t* #$"+#, +# t &!

p$#!+n6 "+(u'n 42 &(( 5$ 5(*n? *n, "+(u'n 43 &(( "+nt*&n t $ !&n@($

,&@&t <.

C+(u'n! 4 >4: t $ p$#!+nd! '+nt + 5&#t

C+(u'n! 4 >4 t $ ,*- + t $ '+nt + t $ p$#!+nd! ,*t$ + 5&#t

C+(u'n! 1> 2 t $ (*!t t + ,&@&t! + t $ p$#!+nd! -$*# + 5&#t +#

0u!t t $ (*!t t + ,&@&t!6 & t $ p$#!+n *! 5+#n &n t $

p$#&+, 1 <<>1 < %

If the data in columns 45-46, or columns 48-49, or columns 51-52 requires onlyone digit, it will be right-justified in the stated columns. Your program will write itsoutput to the file y2k.out Each line in the input will give rise to an almost identical line ofoutput, the only differences been that the two-digit year of birth from columns 51-52 willbe replaced by a four-digit year of birth in columns 51-54. The first two digits of theyear of birth will be 18 or 19, determined by the set of rules provided.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 253/499

Sample Input

=i8 stra, Ed ar *!3 $B"*2 DDDD ! B 1 BB

Lopper, race Murray 23$2" !3! DDDD B< 2 12 !

Lollerit4, Lerman *!23$ <$ J ;L B< " 2! <<

;4annon, Claude "<1 3B$ ! J OL B* 1! 2 <B

ovelace, 6da 1 3!BB 31 >6M; ! * 3! B2

>abba e, C4arles $1B3!B 23 DDDD ! 31 B2

Sample Output

=i8 stra, Ed ar *!3 $B"*2 ! B 1 1 BBLopper, race Murray 23$2" !3! B< 2 12 1B!!Lollerit4, Lerman *!23$ <$ J ;L B< " 2! 1B<<

;4annon, Claude "<1 3B$ ! J OL B* 1! 2 1B<Bovelace, 6da 1 3!BB 31 >6M; ! * 3! 1BB2>abba e, C4arles $1B3!B 23 ! 31 1 B2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 254/499

Input File: bart.inOutput File: bart.out

Source File: bart.<xxx>

T e #ar! C allengeProblem Description

A t$# '*?&n@ * pu#" *!$ *t t $ "+'&" 5++? !t+#$6 B*#t S&'p!+n " *n@$ *! 1 "$nt!. J$ #$"$&)$, 1

,&'$6 1 n&"?$(6 *n, 2 p$nn&$!. L*t$# t *t ,*-6 J$ *! ! +pp&n@ *t * "+n)$n&$n"$ !t+#$. A@*&n &

" *n@$ *! 1 "$nt!. T &! t&'$ $ #$"$&)$, 2 n&"?$(! *n, p$nn&$!. J$ 5$@*n t+ +n,$# J+

'*n- !t+#$! "*n I ! +p &n *n, #$"$&)$ 1 "$nt! " *n@$ &n * ,& $#$nt "+n &@u#*t&+n + "+&n!h A

!u&t*5($ '$nt*( !t#u@@($6 $ ,$"&,$, t $ *n! $# *! :. J$ t $n " *(($n@$, -+u t+ "+n!&,$# t $

@$n$#*( p#+5($'.

K#&t$ * p#+@#*' t *t &(( ,$t$#'&n$ t $ nu'5$# + ,& $#$nt "+'5&n*t&+n! + U"+&n! p$nn-6 n&"?$(6 ,&'$6 u*#t$#6 *( >,+((*#% &" '*- 5$ u!$, t+ p#+,u"$ * @&*'+unt + '+n$-.

T $ &nput &(( "+n!&!t + * !$t + nu'5$#! 5$t $$n < *n, 6 &n"(u!&)$a +n$ p$(&n$ &n t $ &nput &($.

T $ +utput &(( "+n!&!t + t $ *pp#+p#&*t$ !t*t$'$nt #+' t $ !$($"t&+n 5$(+ a +n* !&n@($ (&n$ &n t $ +utput &($ +# $*" &nput )*(u$. T $ nu'5$#m &! t $ nu'5$# -+u#

p#+@#*' "+'put$!6n &! t $ &nput )*(u$.'4ere are m ways to produce n cents c4an e&'4ere is only 1 way to produce n cents c4an e&

S*'p($ Input

17114

S*'p($ OutputThere are 6 ways to produce 17 cents change.There are 4 ways to produce 11 cents change.There is only 1 way to produce 4 cents change.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 255/499

Input File: puzzle.inOutput file: puzzle.out

Source File: puzzle.<xxx>

6ord Pu11le

Puzzle Description

In a word puzzle you are given a list of words and a grid of letters. Theobjective of the game is to find all listed words embedded in the grid of letters.The words can be found horizontally, vertically or diagonally.

Make a program that will solve a word puzzle. Your program must find allwords present and output the position of the first and last letters of the word onthe grid. The input file consists of the dimension of the grid, the grid of lettersand a list of words to find.

The output file will be the list of letters, followed by the starting coordinateand ending coordinate, or the string "not found".

h c n j 1 p

g w f k u r

o e o z c g

o b z r k h

d 1 m h d i

e h e 1 1 o

The following figure depicts the grid used in the example below.

Sample Input

*6CNO P

J 75

KEK C

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 256/499

K> 5 L= ML=9ELE KpuHHlewordproblem4elloarray

inputoutput

Sample Output

puzzle (0, 5) (5, O)word (1, 1) (4, 4)problem not foundhello (5, 1) (5, 5)array not foundinput not found

output not found

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 257/499

University of Puerto Rico Mayaguez Campus

!"#$ "%allen&e *

Expert Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 258/499

Contents

1. Problem # 1 Code Generator2. Problem # 2 Knight Tour3. Problem # 3 DNA translation4. Problem # 4 Etruscan Calculator5. Problem # 5 Cybervision

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 259/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 260/499

5. As few temporaries as possible should be used(given the aboverestrictions).

:. F+# $*" +p$#*t+# &n t $ $ p#$!!&+n6 t $ '&n&'u' nu'5$# + &n!t#u"t&+n! 'u!t 5$@$n$#*t$, @&)$n t $ *5+)$ #$!t#&"t&+n!%.

7. The last instruction will leave the result of the expression on theregister.

Sample Input

AB+CD+EF++GH+++AB+CD+-AB/CD//

Sample Output

load Aadd Bstr $1load C

add Dstr $2load Eadd Fadd $2str $2load Gadd Hadd $2add $1

load Aadd Bstr $1load Cadd Dnegadd $1

load Adiv Bstr $1load Cdiv Dstr $2load $1div $2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 261/499

Input File: knight.inOutput File: knight.out

Source File: knight.[xxx]

nig ! Tour

Problem Description

On chess, the knight piece has one of the most complicated moves. Youcan think of the Knight's move as an "L". It moves two squares eitherhorizontally or vertically and then makes a right angle turn for one more square.It can also move one square either horizontally or vertically and then make aright angle turn for two more squares. In the figure below, the knight ( K), canmove to any of the squares occupied by the pawns( P ).

T $ +50$t&)$ + t &! p#+5($' &!6 @&)$n * !t*#t&n@ "++#,&n*t$ +# t $ ?n&@ t6 t+ '+)$ &t*(( t $ ! u*#$! &n t $ 5+*#,6 )&!&t&n@ $*" ! u*#$ +n(- +n"$. A ! u*#$ &! &,$nt& &$, 5- &t! "++#F+# $ *'p($ t $ ! u*#$ +n t $ t+p #&@ t "+#n$# &! 161%. T $ +n$ n$ t t+ &t &! 162%. Output #+' t $ p#+@#*' ! +u(, 5$ * !$ u$n"$ + :4 "++#,&n*t$!. T $#$ &(( 5$ $&@ t "++#,&n*t$! p$# (&n$. E*""++#,&n*t$ !$p*#*t$, #+' t $ n$ t 5- * 5(*n? !p*"$.

Notes:

There is more than one correct answer for each input. Your programmust print only oneNote that brute force will not achieve a correct answer in areasonable time. You should use the knowledge about themovement of the Knight to limit the search. Your solution shouldattain a correct answer in a reasonable time.

Sample Input

1 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 262/499

Sample Output

1 12 33 11 22 41 62 84 76 88 77 58 37 15 27 38 16 24 12 21 42 61 83 75 87 78 56 67 88 6

42

: 14 22 11 33 2 14 33 43 321 3 4 : 4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 263/499

:4 4: 3 4 2 3: 4 :3 4124 3 : : :

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 264/499

Input File: dna.inOutput File: dna.out

Source File: dna.[xxx]

DNA Tran"la!ion

Problem Description

Deoxyribonucleic acid (DNA) is composed of a sequence of nucleotide basespaired together to form a double-stranded helix structure. Through a series of complexbiochemical processes the nucleotide sequences in an organism's DNA are translatedinto proteins it requires for life. The object of this problem is to write a computerprogram which accepts a DNA strand and reports the protein generated, if any, fromthe DNA strand.

The nucleotide bases from which DNA is built are adenine, cytosine, guanineand thymine (hereafter referred to as A, C, G and T, respectively). These bases bondtogether in a chain to form half of a DNA strand. The other half of the DNA strand is asimilar chain, but each nucleotide is replaced by its complementary base. The bases Aand T are complementary, as are the bases C and G. These two "half-strands" of DNAare then bonded by pairing of the complementary bases to form a strand of DNA.

Typically a DNA strand is listed by simply writing down the bases which formthe primary strand (the complementary strand can always be created by writing thecomplements of the bases in the primary strand). For example, the sequenceTACTCGTAATTCACT represents a DNA strand whose complement would beATGAGCATTAAGTGA. Note that A is always paired with T, and C us always pairedwith G.

From a primary strand of DNA, a strand of ribonucleic acid (RNA) known asmessenger RNA (mRNA for short) is produced in a process known as transcription. Thetranscribed mRNA is identical to the complementary DNA strand with the exception thatthymine is replaced by a nucleotide known as uracil (hereafter referred as ti U). Forexample, the mRNA strand for the DNA in the previous paragraph would beAUGAGCAUUAAGUGA.

It is the sequence of bases in-the mRNA which determines the protein that willbe synthesized. The bases in the mRNA can be viewed as a collection codons, eachcodon having exactly three bases. The codon AUG marks the start of a proteinsequence, and any of the condons UAA, UAG or UGA marks the end of sequence. The

one or more condons between the start and termination codons represent thesequence of amino acids to be s*nthesized to form a protein. ;or e>ample, them3C8 codon 8I4 corresponds to the amino acid serine + er , 8UUcorresponds to isoleucine +6Le , and 88I corresponds to l*sine +L*s . o, theprotein formed from the e>ample m3C8 in the previous paragraph is, in itsabbreviated form erGlLeGL*s.

The complete genetic code from which codons are translated into amino acidsis shown in the table below (note that only the amino acid abbreviations areshown). It should also be noted that the sequence AUG, which has already

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 265/499

been identified as the start sequence, can also correspond to the amino acidmethionine (Met), So, the first AUG in a mRNA strand is the start sequence, butsubsequent AUG codons are translated normally into Met amino acid.

First base in codon Second base in codon........ .. ..Third base in codon U C A GU Phe Ser Tyr Cys............................U

Phe Ser Tyr Cys............................CLeu Ser --- --- ALeu Ser --- Trp............................G

C Leu Pro His Arg............................ULeu Pro His Arg............................CLeu Pro Gin Arg............................ALeu Pro Gin Arg............................G

A lie Thr Asn Ser............................Ulie Thr Asn Ser............................Clie Thr Lys Arg............................AMet Thr Lys Arg............................G

G Val Ala Asp Gly............................UVal Ala Asp Gly............................CVal Ala Glu Gly............................AVal Ala Glu Gly............................G

The input for this program consists of strands of DNA sequences, one strandper line, from which the protein it generates, if any, should be determined andoutput. The given DNA strand may be either the primary or the complimentaryDNA strand, and it may appear in either forward or reverse order, and the startand termination sequences do not necessarily appear at the ends of the strand.For example, a given input DNA strand to form the protein Ser-iLe-Lys could beany of ATACTCGTAATTCACTCC, CCTCACTTAATGCTCATA,TATGAGCATTAAGTGAGG or GGAGTGAATTACGAGTAT. The input file willbe determined by a line containing a single asterisk character.

You may assume the input to contain only valid, upper-case, DNA nucleotidebase letters (A, C, G and T). No input line will exceed 255 characters in length.There will be no blank lines or spaces in the input. Some sequences, thoughvalid DNA strands, do not produce valid protein sequences; the string "*** Notranslatable DNA found ***" should be output when an input DNA strand doesnot translate into a valid protein.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 266/499

0ample .nput

ATACTC9TAATTCACTCC

CACCTGTACACAGAGGTAACTTAG

Sample Output

0er>.le>!ys

Cys>!eu>;is

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 267/499

ICOM Challenge Programming ContestMarch 28, 1998 Expert Division

Input File: calc.inOutput File: calc.out

. Source File: calc.[cpf]

T e E!ru"can Calcula!or

Problem Description

The two properties of arithmetic operators which determine the order inwhich they are executed in an expression are their precedence level and theirassociativity. Precedence levels determine the order in which differentoperatom are executed. Associativities determine the order in which a repeatedoperator is executed. Left associative operators are evaluated left to right whileright associative operators are evaluated right to left. Different operators withequal precedence levels are evaluated left to right. For example:

· If the precedence level of * is higher than that of +, the expression5*3+4 would evaluate to 19.

· If the precedence level of + is higher than that of *, the expression5' 3 + 4 would evaluate to 3 5.

· Left-associativity of - would cause the expression 3-2-1 to beinterpreted as (3-2)-1 which evaluates to o.

· Right-associativity of - would cause 3-2-1 to be interpreted as 3-(2-

1) which evaluates to 2.

Archaeologists have unearthed new evidence that indicates theEtruscans, ancient inhabitants of what we now call Italy, had a fairly complexarithmetic system. The operations used where the usual binary operations, butthe symbols used, their precedence and their associativities, vary widely acrossthe region. Your team is to write a program that will implement a simple integerEtruscan calculator with operations +, -, *, and /, where / denotes integerdivision. The catch is, your calculator has to deal with all of the local dialects.

The input file will contain 4 lines that describe the rules of precedenceand associativity for each symbol, followed by one or more lines eachcontaining an expression using the new symbol set to be evaluated. The firstfour lines each contain a four character string c 1c2c3c4 beginning in column one,where:

C 1 denotes the standard operator that is being described

C 2 denotes the local symbol being used for that operator

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 268/499

C 3 is a digit denoting the local precedence of the operator (higher digit meanshigher precedence)

C 4 is a single letter denoting the Joeal associativity of the operator (L for leftassociativity, R for right).

The line

-@1R

means that the symbol @ will be used to denote minus which will be right associativeand have precedence 1. The expression 5@3@1 under these circumstances willevaluate to 3.

For each input expression, your program must print one line containing theexpression with standard operators followed by a space, an equal sign, and the result.

Sample Input

+@1L-+3R*-2R//2R1@15@5+42@3@1 2/6/5+3

Sample Output

1+1=25+5-4 = 62+3*12/6/5-3= 14

Notes: The last expression, parenthesized to show you the order of execution is (2+((3*12) / (6/(5-3) ) ) ).Although the Etruscan civilization existed, little is known about their arithmetic systemand its written form. The characteristics we attribute to their system in this problem arepurely fictional.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 269/499

Input File: vision.inOutput File: vision.outS+u#"$ F&($ )&!&+n.Q"p

C%ber.i"ion

Problem Description

Jayuya Robotics Inc., a local robot manufacturer, has asked for your helpto develop the software for the automatic recognition feature of their robot visionsystem. Their robots have cameras that capture images of the working space,and moving arms that can lift and move objects to and from any point inside theworking space. Your module must recognize objects on an image grabbed bythe camera, and report their position to a higher-level module.

An image can be represented by a 2-dimensional matrix of pixels. Thecamera captures pictorial information using a 2-dimensional grid of sensors ,such that each sensor has a corresponding pixel in the image. Light intensityinformation gets digitally coded into pixels according to an intensity scale. In abinary image, the scale has only two possible codes: 1 for high intensity and 0for Iow intensity.

Jayuya's robots capture binary images only. Objects to be recognizedare dark (Iow intensity) and the background is bright (high intensity), as permanufacturer's specifications.

Your job is to develop a program that takes a binary image, finds anyobjects in it, and outputs their position (2-dimensional center of mass) relative tothe pixel in the upper-left corner of the image. The coordinates for the pixel onthe upper-left corner are (0,0). The center of mass C(x~,yc) should be computedusing the equations:

where np is the number of pixels that belong to the object.

Objects can have any shape and size. The following rules may be usedto identify objects:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 270/499

(1) If a pixel is 0 (dark), then it belongs to an object. If a pixel is I (bright)it belongs to the background.

(2) Pixels on the border of the image cannot be dark.(3) Objects are formed by one or more connected dark pixels. Two dark

pixels are connected if their x and y coordinates differ by at most 1(i.e. For all 1 < i < n ,1 < j < m , where n is the height and m is thewidth of the image, If pixel P(i,j) is dark, then all dark pixels P(p,q),such that i-1 < p < i + 1 and j - 1< q < j + 1, belong to the sameobject).

Hint: First, use the rules above to find out what object each pixel belongs to,and then compute the center of mass for each object using the coordinates ofeach pixel of that object.

0ample .nput

The first line contains the height and width of the image, in that order.This is followed by the matrix of pixels. Each row is in a new line. There are nospaces between column pixels. Your program must handle image up to 50x50in size.

10 201111111111111111111111111111111111111111111001110011100011111110010100110010011111100000001001110011

1110000000101101101111111000111001110011111111011111001001111111111111111000111111111111111111111111

Sample Output

The input image contains 3 objects.(6.000,4.111)(14.000,5.000)(14.000,5.000)

Centers of mass must be sorted by increasing x (column) coordinate. Incase there are centers of mass with equal x coordinates, they must be orderedfurther by increasing y (row) coordinate. Note that the coordinates are roundedto the nearest thousandth.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 271/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e * Intermediate Division

Sponsored by AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 272/499

Contents

1. Problem#1 Egyptian Multiplication2. Problem#2 Queen Tour3. Problem#3 On the Sidewalk4. Problem#4 Game of Life5. Problem#5 Galactic Import

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 273/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 274/499

ou are to Frite a program to perform this g*ptian multiplication. 6nput Fillconsist of several pairs of nonzero numbers Fritten in g*ptian s*stem described above.Jhere Fill be one number per lineM each number Fill consist of groups of s*mbols, andeach group is terminated b* a single space +including the last group .

;or each pair of numbers, *our program should print the steps described aboveused in g*ptian multiplication. Cumbers in the left column should be in line Fith the leftmargin. ach number in the left and right column Fill be represented b* groups ofs*mbols, and each group is terminated b* a single space +including the last group . 6fthere is an asterisE in the left column, it should be separated from the end of the leftnumber b* a single space. Up to the #0 th character position should then be filled Fithspaces. Cumbers in the right column should begin at the #' st character position on theline and end Fith a neFline character.

Jest data Fill be chosen to ensure that no overlap can occur betFeen columns. 8fter shoFing each of the doubling steps, *our program should print the string! / Jhesolution is! / folloFed b* the product of the tFo numbers in g*ptian notation.

NeloF Fe shoF the steps corresponding to the multiplication of #%" b* 2(.

0ample .nput

I I I n n n n n n n n I I I I I I I n n

0ample :utput

I e I I I n n n n n n n n I I e I I I I I I n n n n n n I I I I I I n n n I I I I I I I I e I I I I n n n n n n I I I I I I n e I I I I I I I I n n Jhe solution is! I n n n n #

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 275/499

6nput ;ile! queen.inButput ;ile! queen.outource ;ile! queen.O>>><

Lueen Tour

Problem De"crip!ion

In c e"" ! e 3ueen i" ! e mo"! poKerful pice on ! e board, I! can a!!ackan% piece ! a! i" loca!ed ori1on!all% .er!icall% or diagonall% independen! of ! enumber of "3uare" form er, In ! e pic!ure belloK all ! e paKn" &P' are undera!!ack b% ! e 3ueen &L',

P P P

P EP

P

P P

Jhe ob ective of this problem is to place % queens in a chessboard in such a Fa* that none of the

queens are under attacE b* each other. our program Fill read the position of one queen, and output the

positions of the rest of the queens as shoFn beloF. Jhe are no restrictions on Fhere to place an* of each

input. Pust output one of the solutions. Left corner is +',' . ou can assume there is at least one valid

arrangement given the position of the first queen.

No!e":• Cote that brute force ma* not achieve a correct ansFer in a reasonable time.

ou should use the EnoFledge about the movement of the queen to limit thesearch. our solution should attain a correct ansFer in a reasonable time.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 276/499

Sample Inpu!

1 2 Sample Ou!pu!

1 22 3 4 1

3:

:4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 277/499

Input F&($ !&,$ (?.&nOutput F&($ !&,$ (?.+ut

S+u#"$ F&($ !&,$ (?.Q

On ! e SideKalk

Problem #escription

4onsider an arra* of floor tiles covering a sideFalE. ver* floor tile is numberedfrom 0 to C in ascending order. C is a positive nonGzero integer smaller than #0.

Jhere are children pla*ing on the sideFalE. 4hildren start to pla* at tile number 0.4hildren move forFard in steps of either one or tFo tiles. Jhere are no bacEFardmoves alloFed. 8ll children continue to move until the* reach tile C, Fhere the* stopand Fait for the rest of the children to arrive.

Jhe path folloFed b* a child ma* be represented b* a sequence of tile numbers,resembling the tiles the child stopped at. Iiven C, *our program Fill calculate thenumber of possible paths a child folloFed to reach tile C.

Jhe input file consists of a series of integers, one number per line. ach numberis a neF value for C for Fhich *our program Fill output the correct ansFer, as shoFnbeloF.

0ample .nput'"(%

0ample :utput

'"2'"#

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 278/499

.C:- Challenge Programming Contest-arch 'LJ &VVL

.ntermediate #ivision

Input F&($ (& $.&nOutput F&($ (& $.+ut

S+u#"$ F&($ (& $.Q

(o n ConKa% " +ame of $ife

Problem #escription

T $ G*'$ + L& $ *! &n)$nt$, 5- H+ n C+n *-. T $ @*'$ &! p(*-$, +n * &$(, + "$((!6$*" + &" *! $&@ t n$&@ 5+#! *,0*"$nt "$((!%. A "$(( &! $&t $# +""up&$, 5- *n +#@*nn+t. T $ #u($! +# ,$#&)&n@ * @$n$#*t&+n #+' t $ p#$)&+u! +n$ *#$ t $!$

#eath(

I *n +""up&$, "$(( *! <61646 6:6 6 +# +""up&$, n$&@ 5+#!6 t $ +#@*n&!' ,&$!(+n$(&n$!!a 4 t #u + +)$#"#+ ,&n@%.

0urvival(I *n +""up&$, "$(( *! t + +# t #$$ n$&@ 5+#!6 t $ +#@*n&!' !u#)&)$! t+ t $ n$ t

@$n$#*t&+n.

Birth(I *n un+""up&$, "$(( *! $ *"t(- t #$$ +""up&$, n$&@ 5+#!6 &t 5$"+'$! +""up&$,.

Y+u# p#+@#*' &! t+ !&'u(*t$ t $ @*'$ + (& $ +n * 1 1 @#&, +# * @&)$n nu'5@$n$#*t&+n!6 u!&n@ *n &nput @#&, *! @$n$#*t&+n <. T $ &nput &($ &(( "+n!&!t + t $ nu'5$# +@$n$#*t&+n! t+ 5$ ,&!p(*-$, *n, * (&!t + "++#,&n*t$! +# +#@*n&!'! &n @$n$#*t"++#,&n*t$! &(( 5$ + t $ +#' - $#$ &! t $ #+ *n, - &! t $ "+(u'n. T $ #*n@$ +# *n,- &(( 5$ #+' < t+ 14. T $ upp$#>($ t "+#n$# &! <6<%. Y+u '*- *!!u'$ p#+p$# "++#,&n*t$! &&nput.

Y+u# p#+@#*' 'u!t +utput * @#&, +# $*" @$n$# .t&+n &n"(u,&n@ @$n$#*t&+n < 5- * (&n$ +# t $ n*'$ + t $ @$n$#*t&+n6 *! ! + n 5$(+ . An $'pt- "$(( &(( 5$ #$p#$!$nt$, t $ +utput 5- > 6 *n, * (&)&n@ "$(( &(( 5$ #$p#$!$nt$, 5- .

S$$ !*'p($ &nput *n, +utput +n t $ n$ t p*@$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 279/499

0ample .nput

4: <: 1: 2: 3 4 4

0ample :utput

9eneration K>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>; >>>>>>>>>>;;; X----------->>>>; >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>G$n$#*t&+n 1>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>;;; >>>>>>>>>>>>;;;; >>>>>>>>>>>;;; >>>>>>>>>>>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 280/499

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>G$n$#*t&+n 2>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>; >>>>>>>>>>>>>; >>; >>>>>>>>>>; >>>; >>>>>>>>>>>; >>; >>>>>>>>>>>>; >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>G$n$#*t&+n 3>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>; >; >>>>>>>>>>>;; >;;; >>>>>>>>>>; >; >>>>>>>>>>>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 281/499

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>G$n$#*t&+n 4>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>;; >; >>>>>>>>>>>;; >; >>>>>>>>>>>;; >; >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 282/499

6nput ;ile! galac.inButput ;ile! galac.outource ;ile! galac.O>>><

+alac!ic Impor!

Problem De"crip!ion

K&t t $ &nt#+,u"t&+n + t $ n$ T #u!t+ ++' @&@*,&'$n!&+n*( ,#&)$#6 &t *! 5$"+'$ p+!!&5($ +#

J-p$#C+''+,&t&$!6 t $ &'p+#tb$ p+#t "+n@(+'$#*t$ #+' C &"*@+6 t+ 5$@&n t#*,&n@ &t $)$n t $ '+!t #$

@*(* &$! &n t $ un&)$#!$. J-p$#C+''+,&t&$! *nt! t+ &'p+#t @++,! #+' !+'$ + t $ @*(* &$! &n t $ P(u#*(

!$"t+#. P(*n$t! &t &n t $!$ @*(* &$! $ p+#t )*(u*5($ p#+,u"t! *n, #* '*t$#&*(! (&?$ )*"uu!$*(6 t#*n!p*#$

*(u'&n&u'6 ,&@#*p &t$ *n, u*ntu' !t$$(. P#$(&'&n*#- #$p+#t! *)$ #$)$*($, t $ +((+ &n@ *"t!

/ +ac% &ala y contains at least one and at most '6 planets. +ac% planet 0it%ina &ala y is identified by a uni1ue letter from 2 to 3.

/ +ac% planet specializes in t%e production and e port of one &ood. -ifferent planets 0it%in t%e same &ala y e port disfferent &oods.

; Some pairs of planets are connected by hyperspace shippin# lines, f planets A and $ are connected, they cantrade #oods freely f planet C is connected to $ but not to A, then A and C can still trade #oods !ith eachother throu#h $, but $ keeps < = of the shipment as a shippin# fee ("hus A only recei'es >< = of !hat C

shipped, and C recei'es only >< = of !hat A shipped ) n #eneral, any t!o planets can trade #oods as lon# asthey are connected by some set of shippin# lines, but each intermediate planet alon# the shippin# route keeps< = of !hat it shipped (!hich is not necessarily e?ual to <= of the ori#inal shipment)

; At least one planet in each #ala&y is !illin# to open a "hrusto@oom shippin# line to Earth A "hrusto@oom lineis the same as any other shippin# line !ithin the #ala&y, as far as business is concerned For e&ample, if planet

opens a "hrusto@oom line to Earth, then the Earth can trade #oods freely !ith , or it can trade #oods !ithany planet connected to , subect to usual shippin# fees

A*per4ommodities has assigned a relative value +a positive real numberless than '0 to each planet:s chief e>port. Jhe higher the number, the morevaluable the product. @ore valuable products can be resold Fith a higher profitmargin in domestic marEets. Jhe problem is to determine Fhich planet has themost valuable e>port Fhen shipping fees are taEen into account.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 283/499

Jhe input consists of one or more gala>* descriptions. ach gala>* description begins Fith aline containing an integer C Fhich specifies the number of planets in the gala>*. Jhe ne>t 4 linescontain descriptions of each planet, Fhich consist of!

'. Jhe letter use to represent the planet.2. 8 space". Jhe relative value of the planet:s e>port, in the form d.dd.#. 8 space&. 8 string containing letters andQor character a letter indicates a shipping line to that planet, and a R

indicates a Fillingness to open a JhrustoSoom shipping line to arth.

;or each gala>* description, output a single line Fhich reads /6mport from 71 Fhere 7 is theletter of the planet Fith the most valuable e>port, once shipping fees have been taEen into account. +6fmore than one planet have the same most valuable e>port value then output the planet Fhich isalphabeticall* first.

0ample .nput1J !& 1 ."E !&!1 .6= !&!1 6.C !&!1 .66 1&!! E=C>> !&!1 6.1!; 2&23 0.6 B&<* C "& M9E <&"$ CM "&!1 K <&$3 9E9 *&!B C &$2 E6K $&"" 0M0 3&21 ;K

0ample :utput9mport from J9mport from 69mport from 6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 284/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e * ,e%inner ivision

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 285/499

Contents

1. Problem #1 Combinations2. Problem #2 Maya Calendar3. Problem #3 Palindrome4. Problem #4 Compression5. Problem #5 Sorting

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 286/499

Output F&#$ "+#n5&n +utS+u'$ F&L$ "+nn5&n.E;;;

Combina!ion"

Problem #escription

G&)$# *n *##*- + &nt$@$#! A *#, * !$p*#*t$ &nt$@$# N. ,$t$#'&n$ & t $#$ &! * !u5!$tt *t t $ !u' + &t! $($'$nt! &! $ u*( t+ N.

T $ &nput &(( *)$ t $ nu'5$# N &n * !$p*#*t$ (&n$6 +((+ $, 5- t $ $($'$nt! + A. $*" &n *!$p*#*t$ (&n$ T $ $n, + t $ *##*- &(( 5$ '*#?$, 5- t $ $n, + &($. T $ '* t u' !&8$ + t $ *##*-&! 1<<.

T $ &#!t (&n$ + * )*(&, +utput ! +u(, !t*t$ & t $ #$!u(t *! p+!&t&)$ +# n$@*t&)$ &.$. T&! *t ($*!t +n+ )*(&, "+'5&n*t&+nW. +# N+ )*(&, "+'5&n*t&+n *! "un,. %. I * )*(&, "+'5&n*t&+un, p#&nt t $ nu'5$#! t *t *#$ p*#t + &t

0ample .nput

1<23124

121:32:3:4122 :121<242<4

0ample :utput

T $#$ &! *t ($*!t +n$ )*(&" 8+'Z&#W" t+ (L

:3 :4 12 2 : 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 287/499

.C:- Challenge Programming Contest-arch'LJ &VVL

Beginner #ivision

Input F&($ '*-*.&nOutput F&($ '*-*.+ut

S+u#"$ F&($ '*-*.Q

Ma%a Calendar

Problem Description

During his last sabbatical, professor M.A .Ya made Surprising discovery about oldMaya calendar. From and old knotted message, professor discover that the Maya civilizationused a 365 .day long year, called Haab , which has 19 months. Each of the first 18 monthswas 20 days long , and the names of the months were pop no , zip , zotz ,

tzec , xul , yoxkin , mol , chen yax , zac ceh mac , kannin, muan, pax , koyab, cumhu. Instead of having names , the days in themonths were denoted by numbers starting , from 0 to 19. The last month of Haab wascalled uayet and had 5 days denoted by numbers O, 1, 2, 3, The Maya believed that thismonth was unlucky, the courtof justice was not in session, the trade stopped, people did noteven sweep the floor.

For religious purposes, the Maya used another calendar in which the yearwas called Tzolkin (holly year). The year was divided into:thirteen periods,each 20 days long. Each day was denoted by a pair consisting of a number and

the name of the day. They used 20 names: imix , ik , akbal , kan , chicchan, cimi,manik, lamat, muluk , ok, chuen, eb , ben, ix, mem, cibcaban eznab, canac , ahau , and 13 numbers; both in cycles.

Notice t*at eac* da *as an ambi description. For e3ample4 at t*e be%innin%+ t $ -$*# t $ ,*-! $#$ ,$!"#&5$, *! +((+ !

1 imix, 2 ik, 3 akbal, 4 kan, 5 chicchan, 6 cimi, 7

manik , 8 lamat , 9 muluk , 10 ok , 11 chuen, 12 eb, 13 ben,1 ix, 2, mem, 3 cib, 4 caban , 5 eznab , 6 canac , 7 ahau ,andagain in the next period 8 imix D ik , 10 akbal ...

Years (both Haab and Tzolkin) were denoted by numbers O, 1……….thenu'5$# < *! t $ 5$@&nn&n@ + t $ +#(,. T u! t $ &#!t ,*- *!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 288/499

5aab: O, pop Tzolkin: 1 imixO

Help professor M.A. Ya and write a program for him to convert the dates from the Haab calendar to theTzolkin calendar.

Sample Input

The date in Haab is given in the following format:

NurnberOfTheDay. Month Year:

The first line in the file contains the number of the input dates in the file. The next n lines contain n dates in theHaab calendar format, each in a separate line. The year is smaller than 5000.

110. zac 0

Sample Output

The date in Tzolkin should be in the following format:

Number NameOfDay Year The first line of the output file contains the number of the output dates. In the next n lines, there are dates inthe Tzoikin calendar format, in the order corresponding to the input dates.

13 chuen 0

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 289/499

Input File: pall.inOutput File: pall.out

Source File: pali.[xxx]

Palindrome De!ec!ion 0"ing Recur"ion

Problem DescriptionThe goal of this problem is to write a program that will accept a string with a maximum length

of 50 and determine if it is a palindrome. A palindrome is a word or string which is spelled the sameforwards and backwards. The function you create to solve this problem must be recursive.

Your solution to the palindrome problem must have only one call in the main() function and itmust call itself successively thereafter, until an answer is returned. Furthermore your entire programshould only take into account numbers and letters when determining if a string is a palindrome, but itshould print out the entire string as entered when displaying the answer. The program should not becase sensitive; 'A' and 'a' are equivalent.

Sample InputA data file with several strings, one string per tine, each string no longer than 50 characters.

Abba 8 ab’BAAbbcb Bb

Sample Output

A file displaying the string and whether or not the string is considered a palindrome.

"Abba 8 ab’BA" is a palindrome."Abbcb Bb" is not a palindrome.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 290/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*

Beginner Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 291/499

.C:- Challenge Programming ContestMarch 28, 1998

Beginner DivisionInput File: comp.in

Output File: comp.outSource File: comp.[xxx]

Compre""ion

Problem Description

In Telephony applications, we often receive messages which contain a stream of digits to bemanipulated, stored, or otherwise passed to other applications. In a particular example, we canreceive up to 15 digits, with values ranging from 0 to 9, inclusive. These digits arrive to our system ina stream of bytes characters ,one digit per byte. Our system needs to store these digits into anexisting structure; however, we only have 8 bytes of free space available. Write a program thatcompresses up to 15 digits into an array of 8 bytes. The compressed array should contain 2 digits perbyte. The following is a memory layout of the arrays.

Note that empty slots in the compressed structure contain the hexadecimal value f. This helps determine the endof the stored digits.

Input

The input file contains rows of digits separated a by spaces.

5551212121

Output

The output of your program should contain:

· The number of digits in the row.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 292/499

• The digits on the uncompressed stream represented as a two digit Hexadecimal value up to the number of digits in the row.• The entire compressed structure (including empty slots)• S$p*#*t$ $*" !t#$*' +utput * 5(*n? (&n$

705050501020102551512f2ffffffff

301020121 f 1 ffffffffffff

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 293/499

ICOM C allenge Programming Con!e"!Marc 4 B

#eginner Di.i"ion

6nput ;ile! sort.inButput ;ile! sort.outource ;ile! sort.O>>><

Sor!ing Problem

Problem De"crip!ion

Iiven tFo arra*s 8 and N of sorted positive integers!

• ver* element in the arra* is greater or equal to 0• Cumber of elements in each arra* = 2&• Bne or more occurred of the same number arra*s.

4ode a program that produce a sorted list of elements after combining the elements of arra* 8 and N Fithout using a thirdarra* or list to perform the sorting and Fithout repeating numbers in the output.

Sample Inpu!

• JFo lines of positive integers! first line corresponds to arra* 8, second one corresponds to arra* N.• ach arra* element is separated b* space.

' # & ( % "2 #& &( $& $( (%0 # ( % '' '& 2' 2( "# #& &(

Sample Ou!pu!

orted list of elements

0 ' # & ( % '' '& 2' 2( "2 "# #& &( $& $( (%

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 294/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*

Expert Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 295/499

ICOM Challenge 1997 Programming ContestMarch 15, 1997

$OP$RT #./.0.:N

Problem: 5TM$ Table"

Write a program that given an HTML source code displays the table included in the document. The displayshould include borders and the table's content.

HTML (HyperText Markup Language) is a markup language which consists of tags embedded in the text of adocument. The browser reading the document interprets these markup tags to help format the document forsubsequent display to a reader.

• · A table is created using the <TABLE> markup tag. The simplest table consists of a single data cell.• ·BORDER

• Specifies that a border is to be placed around the table cells. The width of the border is optionally specifiedwith BORDER--n.

• The markup <TD> defines the start and </TD> defines the termination of a table data cell.• To form a table of many rows, the markup tag <TR> is inserted where each new row in the table

starts. The termination tag for the row is </TR>.• The tag <TH> may be used instead of <TD> if the cell is a header to a column of cells.

Example:

T $ !+u#"$ "+,$ +# * t*5($ (++?! (&?$

fTABLE BORDERXIZfTRZfTJZN*'$fbTJZfTJZT$($p +n$ Nu'5$#fbTJZ fbTRZfTRZfTDZHu*nfbTDZfTDZ > fbTDZfbTRZfTRZfTDZM*#&*fbTDZ fTDZ > fbTDZfbTRZfbTABLEZ

T $ t*5($ &(( (++? (&?$

Name Telephone NumberHu*n >M*#&* >

T $ !+u#"$ "+,$ +# t &! p#+@#*' &! $ *'p($. t'(.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 296/499

roblem- AEIC Words

Design a word processor that reads a file and allows the following commands:

col N - sets the number of columns to display data.

replace <word>-<newword>- replaces all occurrences of <word>with <newword>.Erase <word>-erases all occurrences of <word>.save <filename>- save changes to disk. If no argument is

given, changes will be saved to the same input file.load <filename>- opens the file.Quit- exits tke program

Note: By default the word processor will display the data in ! columns" Itis not case sensiti#e" If a word e$ceeds the limit of columns it is mo#ed to

the ne$t line" %he commands are not case sensiti#e"

%he input file will be called filename"t$t"

Sample run:

................... FILENAME.TXT .......................................This book provides a comprehensive and unified introduction to operating systems. The book emphasizes bothfundamental principles and design .issues in contemporary systems. Thus it is both a basic reference and up-to-date survey of the state of the art.

cmd:> load filename.txt

................... FILENAME.TXT ........................................This book provides a comprehensive and unified introduction to operating systems. The book emphasizes bothfundamental principles and design issues in contemporary systems. Thus it is both a basic reference and up-to-date survey of the state of the art.

cmd:> col 67

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 297/499

................... FILENAME.TXT ........................................This book provides a dull and unified introduction to operating systems. The book emphasizes both fundamentalprinciples and design issues in contemporary systems. Thus it is both a basic reference and up-to-date survey ofthe state of the art.

cmd:> replace comprehensive dull

................... FI[.ENAME.TXT .......................................This provides a dull and unified introduction to operating systems. The emphasizes both fundamental principlesand design issues in contemporary systems. Thus it is both a basic reference and up-to-date survey of the state ofthe art.

crnd:> erase book

.............................. OS.TXT ....................................This provides a dull and unified introduction to operating systems. The emphasizes both fundamental principlesand design issues in contemporary systems. Thus it is both a basic reference and up-to-date survey of the state ofthe art.

crud:> save oS.txt

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 298/499

7roblem : Na.iga!ion of a Simple Ma1e

Jhe goal of the program is given a start location Fithin the maze, to find the e>it point andprint out the optimal solution. Nefore Fe start letHs looE at a simple maze and transform it to atree structure.

Te have labeled each position Fithin the maze Fith numeric labels to aid the

transformation to a tree structure. Jhe transformafion *ields!

earching such a maze reduces to vieFing the maze as a tree structure and using an

appropriate algorithm. uch an algorithm is the preorder search. Jhe preorder searchDtravelsD around a tree structure, alFa*s taEing the left branch if possible, and DlooEsD at eachnode as it is encountered. 6n our situation, Fe are looEing for the BUJ node. Iiven the ma ebeloFM Frite a program to implement the preorder algorithm +hint! itHs recursive to find thesolution to the maze.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 299/499

our program should prompt for starting coordinates, search the maze, then print thesolution. 8 sample run might looE liEe this!

THE AMAZING MAZE PROGRAM

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 300/499

Jhe solution to the maze is!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 301/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*

Intermediate Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 302/499

.NT$R-$#.AT$ #./.0.:N

Problem: 6ord Morp ing

In t &! p#+5($' -+u &(( t#*n! +#' +#,! &nt+ +t $# +#,!6 +n$ " *#*"t$# *t * t&'$.

PROBLEM STATEMENT

1. 1>'+#p ! T $ !$t + 1>'+#p ! + * +#, &! t $ !$t + +#,! &n &" +n$ ($tt$# &! " *n@$,*n, + ($tt$#! *#$ #$*##*n@$,. K#&t$ t $ p#+@#*' $ &" p#&nt! * (&!t +! *(( t $ 1>'+#p+#,. Y+u &(( 5$ p#+)&,$, &t * ,&"t+n*#- &($ n*'$, KORDS + *""$pt*5($ +#,! &n*(p *5$t&"*( +#,$#6 +n$ +#, t+ * (&n$.

2. L*,,$#@#*'! A (*,,$#@#*'!&! * " *&n + 1>'+#p ! &" t#*n! +#' * !t*t&n@ +#, &nt+ *n$n,&n@ +#,. F+# $ *'p($6 t $ ! +#t$!t (*,,$#@#*' " *n@&n@ t $ +#, [($*,\ &nt+ t $+#, [@+(,\ &! ($*, (+*, @+*, @+(,. K#&t$ * p#+@#*' &" &n,! *n, p#&nt! * (*,,$#@#+ ! +#t$!t ($n@t 5$t $$n t $ !upp(&$, !t*#t&n@ *n, $n,&n@ +#,! u!&n@ t $ !*'$ !upp(&,&"t&+n*#-%.

TECJNICAL CONSTRAINS

T $ ,&"t&+n*#- &($ &! ,&"t.&n.

SAMPLE RUNS

P*#t 1

T $ 1>'+#p ! + TIMES *#$T&'$# t&'$, t&#$! t&($! t&,$! t*'$! (&'$! ,&'$!

P*#t 2

J$#$ *#$ !+'$ ! +#t$!t !+(ut&+n! -+u "*n u!$ t+ t$!t -+u# p#+@#*'

LOVE t+ JATE (+)$ (+n$ (*n$ (*t$ *t$BRAIN t+ TJIN 5#*&n t#*&n t#*&t t#*"t t#*"? t#&"? t &"? t &n? KJITE t+ BLAC &t$ &n$ ! &n$ !p&n$ !p&"$ !(&"$ !(&"? !(*"? 5(*"?

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 303/499

7roblem! Cr%p!ari! me!ic

Write a program that solves a cryptarithmetic problem. In cryptarithmetic problems, letters stand for digits andthe aim is to find a substitution of digits for letter such that the resulting sum is arithmetically correct.

TECHNICAL CONSTRAINS:

1. Each letter must stand for a different digit.SAMPLE RUNS:

FORTY + TEN

+ TEN-----------SIXTY

olution!

29786 850850

---------- 31486

F=20=9R=7T=8Y=6E=5N=0

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 304/499

7roblem : Na.iga!ion of a Simple Ma1e

Jhe goal of the program is given a start location Fithin the maze, to find the e>it point andprint out the optimal solution. Nefore Fe start letHs looE at a simple maze and transform it to atree structure.

Te have labeled each position Fithin the maze Fith numeric labels to aid thetransformation to a tree structure. Jhe transformafion *ields!

earching such a maze reduces to vieFing the maze as a tree structure and using anappropriate algorithm. uch an algorithm is the preorder search. Jhe preorder searchDtravelsD around a tree structure, alFa*s taEing the left branch if possible, and DlooEsD at eachnode as it is encountered. 6n our situation, Fe are looEing for the BUJ node. Iiven the ma ebeloFM Frite a program to implement the preorder algorithm +hint! itHs recursive to find thesolution to the maze.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 305/499

our program should prompt for starting coordinates, search the maze, then print thesolution. 8 sample run might looE liEe this!

THE AMAZING MAZE PROGRAM

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 306/499

Jhe solution to the maze is!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 307/499

7roblem : Da!e!ime

K#&t$ * p#+@#*' t *t #$*,! * !t#&n@ #$p#$!$nt&n@ * ,*t$t&'$6 &n t $ ----'',, ''!!. K $#$ ---- &! t $ -$*#6 '' &! t $ '+nt 6 ,, &! t $ ,*-6 &! t $ +u#)*(&, )*(u$! *#$ << t+ 24%6 '' *#$ t $ '&nut$! << = :<%6 *n, !! *#$ t $ !$"+n,! << = :<%. T

p#+@#*' *(!+ #$*,! * !t#&n@ #$p#$!$nt&n@ * t&'$ &n t $ +((+ &n@ +#'*t ''!!. T $ p#+@

'u!t t $n !u5t#*"t t $ t&'$ #+' t $ ,*t$t&'$ *n, ,&!p(*- t $ #$!u(t. Y+u# p#+@#*' 'u!t *n,($($*p -$*#!. A -$*# &! * ($*p -$*# & &t &! ,&)&!&5($ 5- 46 5ut n+t 5- * 1<<6 +# & t $ -$*# 5- 4<<.

TECJNICAL CONSTRAINS

1. Input *n, +utput 'u!t 5$ ,+n$ &nt$#*"t&)$(-.2. T $ &nput &! +n$ !t#&n@ + ($n@t 14 #$p#$!$nt&n@ t $ ,*t$t&'$6 *n, +n$

!t#&n@ + ($n@t : #$p#$!$nt&n@ * t&'$. Y+u# p#+@#*' ! +u(, )*(&,*t$ t *tt $ u!$# $nt$#$, )*(&, )*(u$! *n, ,&!p(*- *n, $##+# [In)*(&, ,*t$t&'$.\ O#[In)*(&, t&'$.\ I n+t.

SAMPLE RUN

,*t$t&'$ 1 <3111<4<33t&'$ 233<1#$!u(t 1 <3111<11

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 308/499

ICOM C *(($n@$ 1P#+@#*''&n@ C+nt$!tM*#" 1 6 1

B$9.NN$R #./.0.:N

P#+5($' O#,$#$, F#*"t&+n!

C+n!&,$# t $ !$t + *(( #$,u"$, #*t&+n*( nu'5$#! 5$t $$n < *n, 1 &n"(u!&)$ &t ,$n+'&n*t+#! +# $ u*( t+ N.

J$#$ &! t $ !$t $n NX

K#&t$ * p#+@#*' t *t6 @&)$n *n &nt$@$# N 5$t $$n 1 *n, 1<< &n"(u!&)$6 p#&nt! t $ #*"t&&n"#$*!&n@ '*@n&tu,$. Y+u ! +u(, *(!+ p#&nt t $ t+t*( nu'5$# + #*"t&+n!. P#&nt * t*5 * t$#*"t&+n !+ t $- ,+ndt #un t++ *# + t $ !"#$$n ,u#&n@ 0u,@&n@.

TECJNICAL CONSTRAINS

1. P#+@#*'! 'u!t #$0$"t &nput! $#$ N &! ($!! t *t 1 +# @#$*t$# t *n 1<<.

SAMPLE RUN

Ent$# t $ '* &'u' ,$n+'&n*t+#

<b1 1b 1b4 1b3 2b 1b2 3b 2b3 3b4 4b 1b1

T $#$ $#$ 11 #*"t&+n!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 309/499

7roblem! Magic Number

K#&t$ * p#+@#*' t *t "#$*t$! * t +>,&'$n!&+n*( *##*- nen% &t nu'5$#! 1 t #+u@ n2. T $ nu'5$# n&! $nt$#$, 5- "+''*n, (&n$. T $ nu'5$#! *#$ p(*"$, &n !u" * *- t *t &t! "+(u'n !u'!6 #+ !u'!*n, ,&*@+n*( !u'! *#$ $ u*(. T $ nu'5$# n 'u!t 5$ +,,.

TECJNICAL CONSTRAINS

1. T $ p#+@#*' 'u!t #$0$"t &nput! $#$ n &! $)$n.

SAMPLE RUN

Ent$# '*@&" nu'5$# n 3

3 &! t $ ,&'$n!&+n + t $ nen '*t#& *n, &! *n +,, nu'5$#.

1 :34 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 310/499

7roblem! A Talk Packe! Sniffer

Sutano's conversation in "talk" was recorded in a log file by the System Administrator. The log files consistsof a series of integers and separated by white spaces or carriage returns. The file has the following format:

Message-type Data- type Datasize Data...

Message type: 0 for received message 1 for sent message

Datatype: 0 indicates that the data field consists of ASCII values 1 indicates that the data field consists of integers

Datasize: Nmber of integers to be read.

Data: the message in the form of integers

Given the log file, decode the message and write on the screen with the following format:

(sent): messagel(received) :message2.

7roblem! Dic!ionar%

Given a text input file build a database that contains the words used in the text file. You can't repeat wordsand the output file must be in alphabetical order.

Source file = Dict.txt

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 311/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*7

Expert Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 312/499

ICOM Challenge 1995Programming Contest

March 11, 1995

$OP$RT #./.0.:N

ProblemB, Da!e!ime

0ource File Name $# .4OOO

Problem(K#&t$ * p#+@#*' t *t #$*,! * !t#&n@ #$p#$!$nt&n@ * ,*t$t&'$6 In

--@-'',, ''!!6 $#$ YYY@ I! t $ -$*#6 '' &! t $ '+nt 6 ,, &! t $ ,*-6 &! t $ +u# u*(&,)*(u$! *#$ t 24%6 '' *#$ t $ '&nut$! > : %6 *n, !! *#$ t $ !$"+n,! m > : %. T $ p#+@#*' *#$*,! * !t#&n@ #$p#$!$nt&n@ * t&'$ &n t $ +((+ &n@ +#'*t ''!!. T $ p#+@#*' 'u!t t $n !ut $ t&'$ #+' t $ ,*t$t&'$ *n, ,&!p(*- t $ #$!u(t. Y+u# p#+@#*' 'u!t *n,($ ($*p -$*#!. A -$*#

($*p -$*# & &t &! ,&)&!&5($ 5- 46 Gu& 6$t 5 * & 6 +# & t $ -$*# &! ,&)&!&D&$ 5- 4&&Input *n, +utput 'u!t 5$ ,+n$ &nt$#*"t&)$(-.

Input:On$ !t#&n@ + ($n@t 14 #$p#$!$nt&n@ t $ ,*t$t&'$6 *n, +n$ !t#&n@ + ($n@t : #$p#$!$nt&n@ * t&'$. Y+u# p

)*(&,*t$ t *t t $ u!$# $nt$#$, )*(&, )*(u$! *n, ,&!p(*- *n, $##+# &n)*(&, ,*t$t&'$. +# &n)*(&, t&'$. & n+t.

E *'p($

.nput,*t$t&'$ 3>11t&'$ 233 1

Butput!result! '))&0"'''0'%

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 313/499

T.TU!: #$! PR:B!$-A

7roblem 2. C ri"!ma" Tree

ource ;ile Came! 892.VVV

P#+5($' K#&t$ * p#+@#*' t+ ,#* *n, ,&!p(*- * C #&!t'*! t#$$ +n t $ !"#$$n. N+t$ T &! p#+@#*' &(( 5$ 0u,@$, *""+#,&n@ t+ + $(*5+#*t$ *n, L&)$(- -+u

*n, n+t &n t $ t&'$ &t t++?. B$ "#$*t&)$6 &'p#$!! t $ 0u,@$!. T&'$ &(( 5$ u!$, +n"*!$ + * t&$. O "+u#!$6 t $ #$!t + t $ p#+5($'! &(( 5$ 0u,@$, 5- t&'$6 !+ & -+ut++ 'u" t&'$ +n t &! +n$6 -+u &(( *)$ ($!! t&'$ +# t $ +t $#!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 314/499

Pa"cal !o C Mini)6 ile) Con.er!er

0ource File Name( A#=4OOO.nput File Name( A#=4Pas:utput File Name( A#=4C

#e7ine( The ?hile statement in the Pascal language has the 7ollo?ing 7ormat(

?hile boolean-expression do program-statement;

e54?hile n M &K do

n( n^5`

The ?hile statement in the C language has the 7ollo?ing 7ormat(

?hile (boolean expression) program-statement;

e54?hile 2n M &K6

n( n^5`

The assignment statement in Pascal has the 7orm

variable := expression;

?here e5pression may be a constantJ another variableJ or a7ormula to be evaluated4

.n CJ the assignment statement has the 7ollo?ing 7orm(

variable = expression ;

The begin and end statements .n Pascal translate to open 2 6 and close 2 6 brac3ets in CThe end in Pascal is 7ollo?ed by a semicolon 2 ` 6J but the close brac3et in C is not4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 315/499

ICOM Challenge 1995Programming Contest

March 11, 1995

T $ f6 Z6f>>6 Z> (+@&"*( +p$#*t+#! *#$ t $ !*'$ &n 5+t C *n, P*!"*(. T $!$ *#$ t $ +n(--+u# p#+@#*' n$$,! t+ !upp+#t. In +t $# +#,!6 t $ P*!"*( &($ 5++($*n $ p#$!!&+n! t *t p#+@#*' n$$,! t+ t#*n!(*t$ *#$6 +# $ *'p($ nfX1 6 "nt Z 6 "+unt ( ZX "+unt26 t f 2.

P#+5($'K#&t$ * P#+@#*' t+ t#*n!(*t$ )*(&, &($ !t*t$'$nt! &n P*!"*( t+ t $ C (*n@u*@

p#+@#*' &(( #$*, * P*!"*( &($ !t*t$'$nt #+' t $ &($ AD3.p*!6 *n, &(( #&t$ t $ $ u&u*(!t*t$'$nt &nt+ t $ &($ AD3.". Y+u# t#*n!(*t+# p#+@#*' 'u!t "+n!&,$# t $ "*!$ + *!!&@n'$nt !t*t$'$nt! &t &n t $ !&n@($ &($ !t*t$'$nt 5$@&n *n, $n,. Y+u ,+ n+t *U$ t+ +*5+ut n$!t$, &($ !t*t$'$nt!. Y+u ,+ n+t n$$, t+ +##- *5+ut *##*-! $&t $#. R! '$nt&+n$, *5-+u# p#+@#*' +n(- n$$,! t+ !upp+#t t $ f6 Z6 f>6 Z> &" *#$ t $ !*'$ &n 5+t C *n, P*!"*(.

S*'p($ InputbOutput

Input&($ ;Z. 1 ,+

5$@&nn >3a 0 Xn> a

$n,a

Output

&($ Z> I %mn>3a 0>n> a

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 316/499

ICOM C *(($n@$ 1P#+@#*''&n@ C+n

M*#" 116 1

Re"!auran! Da!aba"e

S+u#"$ F&($ N*'$ RD4.;;;

InputbOutput F&($ N*'$ RD4.DB

P#+5($'

T $ D$p*#t*'$nt+ ,$ Tu#&!'+ ,$ Pu$#t+ R&"+ *! &#$, -+u t+ #&t$ * p#+@#*' t *t &(( #$!t*u#*nt ,*t*5*!$ t *t t+u#&!t! "*n u!$ t+ ,$"&,$ $#$ t+ @+ +# ,&nn$#. T $ ,*t*5*!$ &(+((+ &n@ &n +#'*t&+n +n #$!t*u#*nt! n*'$6 *,,#$!!6 p +n$ nu'5$#6 t-p$ + #$!t*u#*nt C &It*(&*n6 Sp*n&! 6 $t". %6 *n, t $ t*((#&@ m L+ stars)

T $ p#+@#*' 'u!t ,&!p(*- * '$nu t *t *((+ ! t $ u!$# t+ p$# +#' t $ +((+ &n@ +p$#*t&+n!I% *,, * #$!t*u#*nt t+ t $ ,*t*5*!$2% ,$($t$ * #$!t*u#*nt #+' t $ ,*t*5*!$3% up,*t$ * #$!t*u#*nt ! ,*t*4% &n, * #$!t*u#*nt ITU t $ t-p$. I t $ u!$# *nt! C &n$!$ #$!t*u#*nt!6 @&u$ * (&!t + *(( C#$!t*u#*nt! &n t $ ,*t*5*!$.% $ &t t $ p#+@#*'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 317/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*7

Intermediate Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 318/499

.NT$R-$#.AT$ #./.0.:N

7roblem ' , +rea!e"! Common Di.i"or

S+u#"$ F&($ n*'$ ID1.D$ &n&t&+n

T $ @#$*t$!t "+''+n ,&)&!+# + t + &nt$@$#! * *n, 56 GCD *65% n+t 5+t + &" *#$ 8(*#@$!t p+!&t&)$ &nt$@$# t *t ,&)&,$! 5+t * *n, B.

T $ ($*!t "+''+n 'u(t&p($ + * *n, 56 LCM *65% &! t $ !'*(($!t n+nn$@*t&)$ &nt$@$# 'u(t&p($ + 5+t * *n, 5 *n, "*n 5$ "*("u(*t$, u!&n@.

LCM *6 5% X b*5b ______

GCD *6 5%

P#+5($'K#&t$ * p#+@#*' t *t #$*,! t + &nt$@$#!6 *n, ,&!p(*-! t $&# GCD *n, t $ LCM. Input

! *(( 5$ ,+n$ &nt$#*"t&)$(-.

S*'p($ Inputb Output

Input12:<1

OutputGCM X 1LCM X 13 :<

7roblem 2. Mea"uremen! and 0ni! Con.er"ion

S+u#"$ F&($ N*'$ ID2.

P#+5($'K#&t$ * '$nu>,#&)$n p#+@#*' t *t *((+ ! t $ u!$# t $ +((+ &n@ +pt&+n!

1% t+ "+n)$#t '$*!u#$'$nt! #+' '&nut$! t+ +u#!2% t+ "+n)$#t $$t t+ '$t$#! 1 ++t X <.3<4 '$t$#%3% t+ "+n)$#t #+' ,$@#$$! F* #$n $&t t+ ,$@#$$! C$(!&u! F X 1. C 32%.4% T+ $ &t t $ p#+@#*'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 319/499

Problem 2, S!ack Manipula!ion

0ource 7ile name( .#=4555

P#+5($'K#&t$ * p#+@#*' t+ "+n)$#t *n $ p#$!!&+n &n &n & n+t*t&+n t+ p+!t & *n, p#$ & n

*n, +utput ! *(( 5$ ,+n$ &nt$#*"t&)$(-.

InputA !t#&n@ n+ (+n@$# t *n < " *#*"t$##$p#$!$nt&n@ t $ $ p#$!!&+n &n &n & n+t*t&

S*'p($ Input b Output

Input2 e 3 4%

OutputP+!t & n+t*t&+n 2 3 4 eP#$ & n+t*t&+n e 2 3 4

7roblem #. #inar% !o decimal oc!al and e9 con.er"ion

S+u#"$ F&($ N*'$ ID4. ;;;

P#+5($' K#&t$ * p#+@#*' t *t "+n)$#t! * !t#&n@ + 5&n*#- ,&@&t! <! *n, 1!% t+ &t! ,$"&'*(6$ *,$"&'*( #$p#$!$nt*t&+n. T $ '* &'u' nu'5$# + 5&n*#- ,&@&t! t*?$n *! &nput &! 24.

S*'p($ InputbOutput

Input <<11<1<1<<<11<1<

OutputJ$ *,$"&'*( 3 1AO"t*( 32432=ecimal: $*3*2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 320/499

.C:N Challenge &VV

Problem B Pre.iou" Da!e

P#+5($' K #&t$ * p#+@#*' t+ ,$t$#'&n$ t $ ,*t$ + t $ p#$)&+u! ,*- +# *n- ,*t$ @&)$n 5- t $ u!$nu'5$# + ,*-! &n $*" '+nt &! *! +((+ !

H*n > 31 M*- > 31 S$pt. > 3<F$5. > 2 +# 2 e Hun$ > 3< O"t. > 31M*#" > 31 Hu(- > 31 N+). > 3<Ap#&( > 3< Au@. > 31 D$". = 31

eF$5#u*#- *! 2 ,*-! n+#'*((-6 $ "$pt &n ($*p -$*#! $n &t *! 2 ,*-!. A -$*# &! * ($*pt&t &! ,&)&!&5($ 5- 4<<.

Input

A !t#&n@ + ($n@t #$p#$!$nt&n@ * ,*t$ &n t $ +#' ----'',, $#$ --- &! t $ -$*#6 '' &! '+nt 6 *n, ,, &! t $ ,*-.

T $ &nput 'u!t 5$ )*(&,*t$, *n, t $ $##+# [In)*(&, D*t$\ 'u!t 5$ @&)$n & t $ ,*t$ $nt$#$)*(&,.

OutputA !t#&n@ + ($n@t #$p#$!$nt&n@ t $ p#$)&+u! ,*t$6 &n t $ +((+ &n@ +#'*t ----'',,

N+t$Input *n, +utput 'u!t 5$ ,+n$ &nt$#*"t&)$(-.

;ample: Input 1 <311Output 1 <31<

Input 1 :Output In)*(&, D*t$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 321/499

ICOM Challenge 1995Programming Contest

March 11, 1995

Problem 4, Di"!ance Midpoin! and Slope

S+u#"$ F&($ N*'$ BD2.;;;D$ &n&t&+n

D&!t*n"$ F+#'u(*T $ ,&!t*n"$ , P(6 P2% 5$t $$n *n- t + p+&nt! PI 16 Y(% *n, P2 26 Y2% &n *

p(*n$ &!

, P(6 P2% X ;( > 2%2 Y( > Y2%2

;( 2 Y( Y2H

2 2

S(+p$L$t I 5$ * (&n$ t *t &! n+t p*#*(($( t+ t $ - * &! *n, ($t P(&;(6

Y(% *n, P2 26 Y2% 5$ ,&!t&n"t p+&nt! +n I6 t $ !(+p$ ' + I &!Y2 > Y(

' >>2 > I

I I &! p*#*(($( t+ t $ - * &!6 t $n t $ !(+p$ &! n+t ,$ &n$,.

ProblemK#&t$ * p#+@#*' t *t t*?$! t + p+&nt! PW u!$#6 *n, &n, t $

*n, P2 #+' *

*% ,&!t*n"$ 5$t $$n t $ p+&nt!5% t $ '&,p+&nt + t $ (&n$ !$@'$nt #+' PI t+ P2"% t $ !(+p$ + t $ (&n$ t *t p*!!$! t #+u@ PI *n, P2. I n+t ,$ &n$,6 &n,&"*t$ !+.

Input *n, +utput 'u!t 5$ ,+n$ &nt$#*"t&)$(-.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 322/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 323/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 324/499

S*'p($ InputbOutput

Input

;( X Y( X3 2 X > Y2X

Output

d2P iJ P'6 &=4KK'&,p+&nt X >I.<<6 . <% !(+p$ X ><.42

M&,p+&nt F+#'u(*T $ '&,p+&nt + t $ (&n$ !$@'$nt #+' P 6 -% t+ P2 6 -%

&!:

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 325/499

ICOM Challenge 1995Programming Contest

March 11, 1995

7roblem ". C ange

S+u#"$ F&($ N*'$ BD3.;;;

P#+5($'K#&t$ * p#+@#*' t *t6 @&)$n *(( *'+unt + '+n$- *! &nput6 &(( #$tu#n t $ nu'5$# + u*#t,&'p. !6 n&"?$(!6 *n, p$nn&$! t *t *,, up t+ t $ *'+unt $nt$#$, u!&n@ t $ '&n&'u' nu'5$#+ "+&n!.Input *n, +utput ! *(( 5$ ,+n$ &nt$#*"t&)$(-.

0ample .nput<:utput(

Input 2.1

Output

D 1 N 1P 2

Problem Q, Te9! Edi!ing

S+u#"$ F&($ N*'$ BD4.;;;

P#+5($'

K#&t$ * p#+@#*' t *t p$#'&t! t $ &nput + * n*'$ "+n!&!t&n@ + * &#!t n*'$6 * '&,,($ n*&n&t&*(6 *n, * (*!t n*'$6 &n t *t +#,$# 6 *n, t $n p#&nt! t $ (*!t n*'$6 +((+ $, 5- * "+''* 6 *n,t $n&#!t *n, '&,,($ &n&t&*(6 $*" +((+ $, 5- * p$#&+,. T $&nput *n, +utput ! *(( 5$ ,+n$ &nt$#*"t&

S*'p($ InputbOutput

T $ &nput [ H+ n J. D+$ [ ! +u(, p#+,u"$ [ D+$6 H. J. [

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 326/499

University of Puerto Rico

Mayaguez Campus

!"#$ "%allen&e 5*8

Expert Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 327/499

$OP$RT #./.0.:N

7roblem 6. Memor% Managemen!

S+u#"$ F&($ N*'$ ED I.;;;

#e7inition(T $ +p$#*t&n@ !-!t$ ' *n, *#, *#$ ,&)&,$ )&#tu*( '$ '+#- &nt+ p*@$! + &,$nt&"

!&8$ *n, ,&)&,$ #$*( '$ '+#- &nt+ p *@$ #*'$!. Du#&n@ t $ "+u#!$ + $ $"ut&n@ * p#+@#*'6@$n$#*t$! * !$ u$n"$ + )&#tu*( p*@$ #$ $#$n"$! "*(($, t $ #$ $#$n"$ !t#&n@

R X # 1# 2 # ?

I t $ p*@$ # 1 5$&n@ #$ $#$n"$, &! #$!&,$nt &n * p*@$ #*'$6 t $ #$ $#$n"$n+#'*((-. Ot $# &!$6 & t $ p*@$ &! n+t &n '$ '+#-6 * p*@$ *u(t &nt$##upt +""ut &! *pp$n!6 t $ CPU !" $,u($# "+p&$! t $ p*@$ &nt+ '$'+#-. I t $#$ &! n+ p*@$*)*&(*5($ #$$% In '$ '+#-6 t $ CPU !" $,u($# t*?$! * p*@$ #+' '$ '+#- *n, "+p&$

t+ * ,&!?. It t $n p(*"$! t $ n$ p*@$ &n * p*@$ #*'$. T &! &! "*(($, ! *pp&n@.P#+5($'

Up+n $ $"ut&+n + * p#+@#*'6 t $ +((+ &n@ #$ $#$n"$ !t#&n@ &! @R X 2 2 22 2 2 22 33 33% n3 333 3 322

A!!u'$ nXI<6 &" '$*n! t *t t $ !u5!t#&n@ &t &n p*#$nt $!&! &! #$ $#$n"$, 1< tK#&t$ * p#+@#*' t+ *n*(-8$ t $ #un>t&'$ 5$ *)&+# & * FIFO '$" *n&!' &! u!$, 5-CPU !" $,u($# t+ ! *p * p*@$ #+' '$'+#-. T *t &!6 t $ +(,$!t p*@$ &n '$'+#- &! t*?+ut + '$'+#- $n t $ p*@$ 5$&n@ #$ $#$n"$, &! n+t &n '$'+#- *n, t $#$ &! n+ p*@#*'$ *)*&(*5($ t+ "+p- t $ n$ p*@$.

A!!u'$ t *t #$*( '$'+#- &! $'pt- *t t $ 5$@&nn&n@ + $ $"ut&+n.In p*#t&"u(*#6 -+u# p#+@#*' ! +u(, p#&nt1% IRI > t+t*( nu'5$# + p*@$! #$ $#$n"$,.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 328/499

ICOM C *(($n@$ 1 4P#+@#*''&n@ C+nt$

M*#" 6 1 4

2% A t*5($ &t t $ +((+ &n@ In +#'*t&+n P*@$ #*'$! > t $ nu'5$# + p*@$ #*'$ &n #$*( '$'+#-. T &!

! +u(, #*n@$ #+' I t+ 1 .P*@$ *u(t! > t+t*( nu'5$# + p*@$ *u(t!

Page Fault Rate > average page 7ault rate 2PageF*u(t!bIRI%

E *'p($

L$t R X 2232 3.

F+# p*@$ #* '$ ! X 16 t &! &! * t @+$! +n ,u#&n@ $ $"u t&+n

P*@$ 2 &! #$ $#$n"$,6 &t &! n+t &n '$ '+#-6 !+ * p*@$ *u(t +""u#!. P*@$ 2 &! '$'+#-.P*@$ 2 I! #$ $#$n"$, *@*&n6 &t I! &n '$'+#-.P*@$ 3 &! #$ $#$n"$,6 &t &! n+t &n '$ '+#- *n, t $#$ I! n+ p*@$ #*'$ *)*&(*5(+n(- +n$ p*@$ #*'$ *n, It &! t*?$n 5- p*@$ 2%. A p*@$ *u(t +""u#!. P*@$ 2 &! ! *pp$, #+' '$'+#- *n, p*@$ 3 &! &nt+ '$'+#-.P*@$ 2 &! #$ $#$n"$, *@*&n6 &t &! n+t &n '$ '+#- *n, t $#$ &! n+ p*@$ #*'$ * p*@$ *u(t +""u#!. P*@$ 3 &! ! *pp$, #+' '$'+#- *n, p*@$ 2 &! "+p&$, &nt+ '$ '+P*@$ &! #$ $#$n"$,6 &t &! n+t &n '$ '+#- *n, t $#$ &! n+ p*@$ #*'$ *)*&(*5(*u(t +""u#!. P*@$ 2 &! ! *pp$, #+' '$'+#- *n, p*@$ &! "+p&$, &nt+ '$'+#-.

P*@$ 3 I! #$ $#$n"$,6 &t &! n+t &n '$'+#- *n, t $#$ &! n+ p*@$ #*'$ *)*&(*5($.*u(t +""u#!. P*@$ &! ! *pp$, #+' '$'+#- *n, p*@$ 3 I! "+p&$, &nt+ '$'+#-.

F+# p*@$ #*'$! X 2P*@$ 2 &! #$ $#$n"$,6 &t &! n+t &n '$ '+#-6 !+ * p*@$ *u(t +""u#!. P*@$ 2 I!*@*&n6 It I! &n '$'+#-.P*@$ 3 &! #$ $#$n"$,6 &t &! n+t &n '$ '+#-6 !+ * p*@$ *u(t +""u#!. P*@$ 2 &*@*&n6 &t &! &n '$'+#-.P*@$ &! #$ $#$n"$,6 &t &! n+t &n '$ '+#- *n, t $#$ &! n+ p*@$ #*'$ *)*&(*5(*u(t +""u#!. P*@$ 2 &! ! *pp$, #+' '$'+#- *n, p*@$ I! "+p&$, Int+ '$'+#-.

P*@$ 3 &! #$ $#$n"$,6 &t &! &n '$'+#-.

An, !+ +n.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 329/499

E *'p($ Output +# R> 2232 3

T $ nu'5$# + p*@$! #$ $#$n"$,6 IRI6 &! :.

P*@$ F#*'$! P*@$ F*u(t! P*@$ F*u(t R*t$

1 <. 3332 3 <. <3 3 <. <4 3 <. <4 4 44 4 44 4 41 3 <. <

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 330/499

ICOM Challenge 1994Programming Contest

March 5, 1994

Tur!le Te9! +rap ic"

S+u#"$ F&($ N*'$ AD2.;;; Input F&($ N*'$ AD2.1N

M*C#+ *#, C+#p *! &#$, -+u t+ 5u&(, * !p*n?- n$ &nt$#p#$t$# "*(($, BOGUS. B$@&nUn&)$#!*( S-!t$'%. BOGUS "+n!&!t! + * t&n@ !$t + "+''*n,! u!$, t+ "#$*t$ $ t#$'$(U "#u,$ tu#t($ t$ t@#*p &"!. T $ tu#t($ &! #$p#$!$nt$, 5- t $ ($tt$# T + "+u#!$% *n, t $ tu#t($ ! t#*&( &! #$p#$!$T $ &nt$#p#$t$# #$*,! t $ &nput &($ *n, ,&!p(*-! t $ p#+@#*' ! +ut"+'$ +n !"#$$n. K $n t $ tu#t$n, + t $ !"#$$n6 t $ tu#t($ ,+$! n+t #*p *#+un,. T $ tu#t($ !&t! t $#$ unt&( *n+t $# "+''*n, t* 5*"? t+ * p+!&t&+n t+ *#,! t $ "$nt$# + t $ !"#$$n +# *(+n@ t $ $,@$ + t $ !"#$$n. A(!+6 *n- !'u!t 5$ &@n+#$,. E)$#- "+''*n, +""up&$! +n$ (&n$. In&t&*((-6 t $ tu#t($ &! &n t $ "$nt$# + 264 % *"&n@ n+#t .

T $ +((+ &n@ *#$ t $ "+''*n,! +# BOGUS

I. FKD f!t$p!ZT*?$! *n Int$@$# ; *n, '+)$! t $ tu#t($ ; !t$p! +# *#,. N$@*t&)$! *#$ p#+ &5&t$,.

2. BC f!t$p!ZT*?$! *n Int$@$# ; *n, '+)$! t $ tu#t($ ; !t$p! 5*"? *#,!. N$@*t&)$! *#$ p#+ &5&t$,.

3. RGT f*n@($ZR+t*t$! t $ tu#t($ ; ,$@#$$! t+ t $ #&@ t. V*(&, )*(u$! *#$nu'5$#! #+' t+ 3 In"(u!&)$. N$@*t&)$! *#$ p#+ &5&t$,. 4. LFT f*n@($ZR+t*t$! t $ tu#t($ ; ,$@#$$! t+ t $ ($ t. V*(&, )*(u$! *#$nu'5$#! #+' t+ 3 In"(u!&)$. N$@*t&)$! *#$ p#+ &5&t$,. . JOM .M+)$! t $ tu#t($ t+ t $ "$nt$# + t $ !"#$$n.

:. CLSC($*#! t $ !"#$$n. T $ tu#t($ #$'*&n! &n t $ !*'$ p+!&t&+n.

NOTE K$ #$"+''$n, u!&n@ t $ @+t+> - LOCATE &n BASIC% "+''*n, t+ I'p($'$nt t &! p#+@#*'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 331/499

S*'p($ InputbOutputICOM C *(($n@$1 4P#+@#*''&n@ C+nt$!tM*#" 6 1 4

InputCLSJOMFKD RGT <FKD RGT <FKD RGT <FKD

RGT <Output

T ] ] ] ] ]

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 332/499

ICOM Challenge 1994Programming Contest

March 5, 1994

Problem 3, Pascal to C Mini-For-Converter

Source File Name: AD3.XXXInput File name: AD3.pasOutput File Name: AD3.c

Define: The for statement in the Pascal language has two formats:

For control-variable :- initial-value to final-value do program-statement;ex. for x:=1 to 5 do

n:=n+x;

For control-variable :- initial-value down to final-value do program-statement;

ex. for x:=5 down to 1 don:= n + x;

The for statement in the C language has the following format:

For (initial-expression;loop-condition ; loop-expression)Program statement ;

ex. for (x=1; x<=5; x++)n= n + x;

for (x=5;x>=1; x - -)n= n + x;

The assignment statement in Pascal has the form

variable := expression ;

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 333/499

ICOM Challenge 1994Programming Contest

March 5, 1994

where expression may be a constant, another variable, or a formula tobe evaluated.

. ~?)} ".

In C, the assignment statement has the following form:

variable - expression;

The begin and end statements in Pascal translate to open ({) and close ( } ) brackets in C. Theend in Pascal has a semicolon (;), but the close bracket in C does not.

Problem: Write a program to translate valid for statements in Pascal to the C language.Your program will read a Pascal for statement from the file AD3.pas, and will write theequivalent C statement into the file AD3.c. Your translator program must consider thecase of several assignment statements combined into a single for statement. You donot have to worry about nested for statements. You do not need to worry about arrayseither.

Sample Input/Output:

Input: for x:=l to 5 do beginn:=3;

J:=n+x;end;

Output: for (x= I; x<=5; x++){

n=3;J=n+x;

}

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 334/499

7roblem #. 5uffman Coding

S+u#"$ F&($ N*'$ A D 4. ; ; ;Input F&($ N*'$ A D 4. IN

Output F&($ N*'$ A D 4. OUT

D$ &n$Ju '*n "+,$! *#$ u!$, t+ "+'p#$!! ,*t*. On$ " *#*"t$#&!t&"! + Ju '*n "+,$! &! t *t t $ "+,$

+#,! )*#- &n t $ nu'5$# + 5&t! t $- "+nt*&n. D*t* "*n 5$ "+'p#$!!$! $ &"&$nt(- 5- *!!&@n&n#$ u$nt(- = +"u##&n@ ,*t* !-'5+(! t+ t $ ! +#t$# "+,$ +#,!6 *n, *!!&@n&n@ t $ ($!! #$ u$nt(- ,*t* !-'5+(! t+ t $ (+n@$# "+,$ +#,!.

P#+5($'K#&t$ * p#+@#*' t+ #$*, " *#*"t$#! #+' t $ A D 4. IN 6 "+unt t $ nu'5$# + +""u##$n"$!

" *#*"t$#6 t $n *!!&@n Ju '*n "+,$ +#,! t+ t $ " *#*"t$#! *! +((+ !

Ju '*n C+,$ K+#, C *#*"t$#

1 M+!t #$ u$nt<1 2n, '+!t #$ u$nt<<1 3#, '+!t #$ u$nt<<<1 4t '+!t #$ u$nt<<<<1 t '+!t #$ u$nt<<<<< :t '+!t #$ u$nt

I t $ nu'5$# + " *#*"t$#! &! t $ !*'$ +# t + ,& $#$nt " *#*"t$#!6 *!!&@n t $ Ju '*n "+,$ +#,! ASC ( ( nu'$#&"*( )*(u$ + t $ " *#*"t$#6 "+n!&,$#&n@ t $ &@ $# ASC ( ( )*(u$ *! [($*!t '*- *!!u'$ t *t $*" " *#*"t$# + t $ &nput &($ '*- 5$ 1 + *t '+!t : ,& $#$nt " *#*"t$#!.

T $n +utput t $ "+'p#$!!$, )$#!&+n + t $ &nput &($ (. $. #$p(*"$ $*" " *#*"t$# 5- &t! Ju+#,% t+ t $ &($ AD4. OUT. F+# pu#p+!$! + t &! p#+5($'6 -+u# +utput ! +u(, 5$ &n t $ +#' [1\ *n, [<\ " *#*"t$#!. K$ #$*(&8$ t *t t &! '$*n! t *t -+u *#$ n+t *"tu*((- "+'p#$!!&n@ t $ &t*?$! t $ p#+5($' $*!&$# t+ t$!t *n, t+ " $"?.%

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 335/499

0ample .nput<:utput(

.nput(

ABC#$F###C#$#CCC$$BBF

:utput(

KKKKKKKK&K&&KK&KKKK&&&&K&&KK&&K&K&K&KK&KK&KKK&

.nput(

H HH H H

:utput(

KK&K&&KKK&&K&&KK&KK&&K&&&K&KK&K&KKK&&&K&KK&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 336/499

ICOM C *(($n@$ 1P#+@#*''&n@ C+n

M*#" 6 1 4

7roblem &. $arge Number"

S+u#"$ F&($ N*'$ AD .;;;

Input F&($ N*'$ AD .1NOutput F&($ N*'$ AD .<UT

P#+5($' K#&t$ * p#+@#*' t+ 'u(t&p(- t + (*#@$ nu'5$#! + ($n@t up t+ 3 ,&@&t!.

On$ *pp#+*" &! t+ t#$*t $*" nu'5$# *! * (&!t6 $*" + +!$ $($'$nt! &! * 5(+"? + ,&@&t! +T $n -+u "*n 'u(t&p($ t $ &nt$@$#! (&!t!% $($'$nt 5- $($'$nt. O "+u#!$6 -+u '*- u!$ * ,& $#$nY+u# p#+@#*' &(( #$*, t + nu'5$#! #+' t $ &($ AD .1N. T $ nu'5$#!6 #$p#$!$nt$, 5- !t#&n@!6 &((!$p*#*t$ (&n$!. T $ +utput ! *(( 5$ #&tt$n t+ &($ AD .<UT.

.nput(

T + Int$@$#! + ($n@t up t+ 3 ,&@&t! #$p#$!$nt$, 5- * !t#&n@ + ASCII " *#*"t$#Int$#*"t&)$(- 5-t $ u!$#.

$5ample(

T+ 'u(t&p(- 34 2 e 2 346 +n$ "+u(, ,&)&,$ 34 2 &nt+ 34 *n, 26 *n,2 34 &nt+ 2 *n, 34. T $n6

2 e 34 X 1 : 6 34 e 34 X 11 :62 e 2 X 13<<6 2 e 34 X <.

1 : 13<<

11:

<

>>>>>>>>>>> >>>>>>>>>>>> 11 3: :3<<An, &n*((-6

1>1 3::3<<

>>>>>>>>>>>>>>>>4 3:

N+t$ t *t +# t &! (*!t *,,&t&+n6 t $ nu'5$#! '*- *(!+ 5$ )$#- (*#@$. T $#$ +#$6 -+u &(( *(!+ n$$,$*" nu'5$# &nt+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 337/499

ICOM C *(($n@$ 1 4P#+@#*''&n@ C+nt

M*#" 6 1 4

5(+"?! + ,&@&t! + t $ nu'5$#6 *n, t $n *,, t $ Int$@$#! (&!t!% 5(+"? 5- 5(+"?6 "*##-&n@ #+' +nn$ t $n n$"$!!*#-. N+t$ *(!+ t *t t $ #$!u(t&n@ p#+,u"t "*n *)$ '+#$ t *n 3 ,&@&t!. Y+u '*- *!!u'$ t *t &t &(( n+t *)$

t *n ,&@&t!.0ample .nput(

34 22 3

0ample :utput(

T $ p#+,u"t &! 4 3: .

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 338/499

University of Puerto RicoMayaguez Campus

!"#$ "%allen&e 5*8

Intermediate Division

Sponsored by

AEIC and Lucent Technologies

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 339/499

.NT$R-$#.A #./.0.:N

ProblemB, STAC MANIP0$ATION

S+u#"$ F&($ N*' ID1.;;;

.nput File Name( .#&4#AT

:utput File Name( .#&4:UT

Trite a program that converts an e>pression in infi> notation to postfi> and prefi> notation. ourprogram should Frite as output the original e>pression in infi> notation, the e>pression in postfi> andin prefi> notation. ach e>pression should be in a separate line, and properl* labeled.

Sample Inpu!:

+25#Q) "

Sample Ou!pu!:

infi> notation! +25#Q) "postfi> notation! 2# )5"prefi> notation! 5Q2# ) "

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 340/499

7roblem 2. EAS CA$ENDAR

0ource File Name( .#'4OOO.nput File Name( .#'4#AT:utput File Name( .#'4:UT

K#&t$ * p#+@#*' t *t t*?$! *! &nput * ,*t$ &t t $ +#'*t

mmmddyyyy

---- "*n 5$ *n- -$*# 5$ +#$ +# * t$# 1 3%

*n, #$tu#n! t $ ,*- + t $ $$? "+##$!p+n,&n@ t+ t *t ,*t$ &.$.6 M+n,*-6 Tu$!,*-6 $tY+u# p#+@#*' ! +u(, *(!+ t$!t +# *n- &n)*(&, &nput6 $.@. $5 2 1 3 *n, #$p+#t *n $'$!!*@$ &n t *t "*!$.

Remar3s(A @&)$n -$*# &! ,$ &n$, *! * [($*p\ -$*# & t $ -$*# &! ,&)&!&5($ 5- 4<<6 +# & & 5ut n+t 5- 1<<. F+# $ *'p($6 t $ -$*# 2<<< &! * ($*p -$*#a 1 << &! n+t * ($*p -$*#.

0ample .nput(

$5 <2 1 3

0ample :utput($5 <2 1 3 &! * Tu$!,*-

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 341/499

.NT$R-$#.AT$ #./.0.:N

EI+5T L0EENS 6IT5 A T6ISTProblem =(

E&@ t u$$n! "*n 5$ *##*n@$, +n * " $!! 5+*#, !+ t *t n+ u$$n &! un,$# *tt*"? #+' *n- + t&n +t $# +#,!6 !+ t *t n+ #+ +# "+(u'n +# ,&*@+n*( "+nt*&n! '+#$ t *n +n$ u$$n. K#&t$ * p#+@ p(*"$ t $ p+!&t&+n + u$$n! +n * " $!! 5+*#, *n, $n!u#$! t *t n+ u$$n! *#$ un,$# *tt*"?. Y+u#! +u(, &#!t ,#* t $ " $!! 5+*#, ,&!p(*-&n@ t $O '*t#& &t d! #$p#$!$nt&n@ t $ u$$n p+!&t&+n p#+@#*' 'u!t *(!+ !$*#" *n, ,&!p(*- *(( t $ !+(ut&+n! +# t &! p#+5($'. T $ *n! $#! ! +u(, ! + t $ "+!+(ut&+n.

Note( N+ *#,> &#$, !+(ut&+n *#$ *((+ $,W

0ample :utput(

1 2 3 4 :

1

2

3

4

:

PR$00 $NT$R F:R N$OT 0:!UT.:N

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 342/499

UNIVERSIDAD DE PUERTO RICO

RECINTO DE RIO PIEDRAS

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 343/499

Universidad de Puerto RicoRecinto de Río Piedras

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'AA'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 344/499

0ource File Name( PR.N&4555.nput File Name( 555:utput File Name( 555

#irecciones generales(T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. E!t+ $!6 n+ ($$#_n ,*t* ,$ n&n@/n *$nt#$@*# $( ,&!"+ "+n tu p#+@#*'* t*n p#+nt+ "+'+ (+ *-*! t$#'&n*,+. E( $ u&p+ "+n '$0+# t&$'p#$!+()$# t+,+! (+! p#+5($'*!% !$#_ $( @*n*,+# ,$ $nt#$ (+! $ u&p+! u$ "+'p($t$n $( '&!'+ n/ p#+5($'*! !*t&! *"t+#&*'$nt$.

;?O,L2-" B'

ARC5IHO DE CODI+O: PRINB,999

L* !$#&$ >@$n$#*(&8*,* ,$ n/'$#+! F&5+n*""& $!t* ,$ &n&,* "+'+

7 K 7 & 4 4 4 7 23>&6 K y 7 3 &

7 2n^3^&6 7 2n^3>&6^ 444 ^ 7 n para toda n K

D$5$! $!"#&5&# un p#+@#*'* u$ ($* p*#$! ,$ n/'$#+! $nt$#+!n - 3 - @$n$#$ (+! p#&'$#+!n n/'$#+ ,$ (* !$#&$ F&5+n*""& ?>

@$n$#*(&8*,* "+##$!p+n,&$nt$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 345/499

.NT$RACC.:N(

Ent#$ $( p*#_'$t#+ ? p*#* (* !$#&$ &5+n*""& ?>@$n$#*(&8*,*

< p*#* t$#'&n*#% 3

P+# *)+# $nt#$ (* "*nt&,*, ,$ $($'$nt+! ,$ ,&" * !$#&$

L+! p#&'$#+! $($'$nt+! ,$ (* !$#&$ &5+n*""& ?>@$n$#*(&8*,* !+n

Posición N)mero< <

1 <2 <3 14 1

2: 3

Entre el parámetro k para la serie fibonacci k-generalizada< p*#* t$#'&n*#% <

9racias

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 346/499

PR:B!$-A '

ARC5IHO DE CODI+O: PRIN4,999

E!"#&5$ un p#+@#*'* u$ ($* n/'$#+! $nt$#+!6N6 - u$ "*("u($ $( *"t+#&*( ,$N $ *"t*'$nt$

p*#* "u*( u&$# $nt$#+ N f 1<<. E( *"t+#&*( ,$ un n/'$#+ $!t_ ,*,+ p+#

NW X 1 2 3 N

.NT$RACC.:N(

F*)+# ,$ $nt#*# un n/'$#+ $nt#$ 1 - 1<< < p*#* t$#'&n*#% E( *"t+#&*( ,$ $! 12<

F*)+# ,$ $nt#*# un n/'$#+ $nt#$ 1 - 1<< < p*#* t$#'&n*#% 1< E( *"t+#&*( ,$ 1< $! 3:2 <<

F*)+# ,$ $nt#*# un n/'$#+ $nt#$ 1 - 1<< < p*#* t$#'&n*#% <G#*"&*!W

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 347/499

0ource File Name( PR.N=4555

L* un"&7n ,$ A"?$#'*n $!t_ ,$ &n&,* "+'+

* ' 6 n% X n 1 "u*n,+ ' X <* ' 6 n% X * '>16 1% "u*n,+ ' fZ < - n X <

* ' 6 n% X * '>16 * '6 n>1%% "u*n,+ ' fZ < - n fZ <

D$5$! $!"#&5&# un* un"&7n u$6 ,*,+ ,+! n/'$#+! n - '6 "*("u($ * '6n%. D$5$! t*5u(*# (+! )*(+#$! ,$ * '6n% p*#* t+,*! (*! ' t*( u$ 1 i ' i 4 - t+,*! (*! n t*( u$ 1i n i 1<.E!t$P#@#*'* n+ t&$n$ &nput.

Output

Funci n de "c$erman

& ' = + , L V &K& 55 >> >> >> >> >> >> >> V> >>

' 55 >> >> >> >> >> >> >> V> >>

= 55 >> >> >> >> >> >> >> V> >>

+ >> >> >> >> >> >> >> >> V> >>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 348/499

PR:B!$-A +

ARC5IHO DE CODI+O: PRINQ,999

D$5$! $!"#&5&# un p#+@#*'* u$ ($* un n/'$#+ N $nt$#+ &'p*# p+!&t&)+ $ &'p#&'* un "u*,#*,+Un "u*,#*,+ '_@&"+ N N "+nt&$n$ (+! n/'$#+! $nt$#+! ,$( 1 *( N2 ,$ +#'* t*( u$ (*! !u'*! ,$ (+!$($'$nt+! ,$ "*,* &(*6 "+(u'n*6 - ,&*@+n*( p#&n"&p*( !+n &@u*($!. Un *(@+#&t'+ p*#* "+n'_@&"+ !$#`*

E( *(@+#&t'+ *!u'$ u$ (+! `n,&"$! ,$( "u*,#*,+ !+n ,$( 1 *( N $n *'5*! ,&'$n"&+n$!.

P*!+ IC*("u($ F X P*#t$ $nt$#* ,$ N 1% b 2C*("u($ C X N

P*!+ IIC+(+ u$ 1 $n (* &(* F "+(u'n* C ,$( "u*,#*,+

P*!+IIIEn "*,* &nt$#*"&7n * "+nt&nu*"&7n6 "+(+ u$ $( !&@u&$nt$ n/'$#+ $n (* !$"u$n"&* 2>ZN2 $n,$( "u*,#*,+ '_@&"+In"#$'$nt$ $n "*,* &nt$#*"&7n *'5*! F - C $n 1 '7,u(+ N%= p+# N>1 )$"$!. C+(+ u$ $( p#7 &'+ n/'$#+ (* !$"u$n"&*.En (* !&@u&$nt$ &nt$#*"&7n #$,u8"* F $n 1 '7,u(+ N% - n+ "*'5&$ C. "+(+ u$ $( p#7 &'+ n/'$#"+(u'n* C.R$p&t* (+! p*!+! 5 - " *!t* u$ *-* "+(+"*,+ t+,+! (+! n/'$#+! *t* $( N2 $n $( "u*,#*,+ '_@&"+

= En $!t$ p#+5($'* ['7,u(+ N\ u&$#$ ,$"&# u$ !& '_! '$n+!% 1 $! &@u*( * N 1 <% $nt+n"$! p*N%.

E0$'p(+6 !& N X 3 - X 3 $nt+n"$! 1 '7,u(+ N $! 1.E0$'p(+6 !& N X 3 - X 1 $nt+n"$! = 1 '7,u(+ N $! N.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 349/499

INTERACCION

Ent#$ (* ,&'$n"&7n N ,$( "u*,#*,+ '_@&"+ < p*#* t$#'&n*#% 3

Cu*,#*,+ '_@&"+ p*#* N X 3

3: 12 4

Ent#$ (* ,&'$n"&7n N ,$( "u*,#*,+ '_@&"+ < p*#* t$#'&n*#% <G#*"&*!W

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 350/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 351/499

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 352/499

Universidad de Puerto RicoRecinto de Río Piedras

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'AA'

+ perto

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 353/499

$OP$RT #./.0.:N

$ON+ $ON+ DIHISION

Problem: BY+u *)$ 5$$n *!!&@n$, t+ * t$*' + !+ t *#$> *#, *#$ $n@&n$$#! +#?&n@ +n !up$# "+'put$#! ,$Y+u# t*!? &! t+ #&t$ !+ t *#$ +# &'p($'$nt&n@ 'u(t&p($ ,&@&t ,&)&!&+n6 &" &! t+ ,&)&,$ *$ $# ,&@&t! 5- *n- p+!&t&)$ ,&)&!+# ($!! t *n 1<<.

D*t* &n t $ &nput &($! "+'$! &n p*&#!6 &t t $ &#!t (&n$ "+nt*&n&n@ t $ ,&)&,$n, *n, t $ !$"+t $ ,&)&!+#. Y+u# p#+@#*' &! t+ *""$pt +n(- "+##$"t ,&)&,$n,! *n, ,&)&!+#!. T u!6 & $&t $# t,&)&!+# "+nt*&n! *n- n+n>,&@&t6 &.$.6 * " *#*"t$# n+t &n Q<.. 6 +# t $ ,&)&!+# &! @#$*t$# t$##+# '$!!*@$6 *! ! + n &n t $ !*'p($ +ut ! + n 5$(+ .

I -+u #$*, &n t + )*(&, )*(u$!6 -+u *#$ t+ "+'put$ t $ u+t&$nt *n, #$'*&n,$# *n, +utput t $ #$!u(t! *+n t $ !*'p($ +utput ! + n 5$(+ . Y+u *#$ t+ u!$ n+#'*( $n,>+ > &($ '$t +,! t+ t$#'&n*t$ -+u# #$*,! t $ &nput ,*t* &($. A( *-! !?&p * (&n$6 *! ! + n 5$(+ &n t $ $ *'p($ ,*t*6 5$t $$n t $ ,&)&,$n, p*&#!.

0ample #ata(

V==

0ample output(

2N/2? FI?S/ N1-,2?8 A$NT$R 0$C:N# NU-B$R =

ividend is A#ivisor is =Euotient is =Remainder is K

$NT$R F.R0T NU-B$R =$NT$R 0$C:N# NU-B$R

#ividend is =#ivisor is Euotient is Remainder is +

$NT$R F.R0T NU-B$R KM$O.T

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 354/499

TJE DATABASE PROBLEM

S+u#"$ F&($ N*'$ ED2.;;;Input F&($ N*'$ ED2.DAT

Output F&($ N*'$ ED2.OUT

#e7ine(

T $#$ &! * !t*n,*#, ,*t*5*!$ !t#u"tu#$6 "*(($, * !$t6 &" #$p#$!$nt! * t + ($)$( &$#*#" - 5$t,& $#$nt #$"+#, t-p$! = +n$ "*(($, t $ + n$# *n, t $ +t $# "*(($, t $ '$'5$#. T &! "+n!t#u"t &! u#$p#$!$nt * 1 t+ '*n- &.$.6 1 N% #$(*t&+n! &p 5$t $$n #$"+#, t-p$!. T $ + n$# #$"+#, &! t $ 1#$(*t&+n! &p *n, t $ '$'5$# &! t $ N &n t $ 1 N #$(*t&+n! &p. An $ *'p($ + t &! #$(*t&+n! &pt-p$% &! ! + n &n t $ &@u#$ 5$(+ . T $ &@u#$ 5$(+ &n,&"*t$! * 1 N #$(*t&+n! &DEPARTMENT #$"+#, *n, t $ FACULTY #$"+#,. It "+>n+t$! t *t t $#$ "*n 5$ N F*"u(t- '$*!!+"&*t$, &t $*" ,$p*#t'$nt. B$ * *#$ t *t t $ N "*n 5$ 8$#+W

M> The :?ner Record

M> M>The -ember Record

9 783J@ CJ

;84ULJ

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 355/499

An occurrence o7 this set could be as 7ollo?s(

B$ * *#$ t *t t &! &! +n(- +n$ +""u##$n"$ + t $ !$t t-p$. T $#$ "+u(, 5$ *n+t $# +""u##$n"$ +# t $D$p*#t'$nt6 *n+t $# +""u##$n"$ +# t $ A""+unt&n@ D$p*#t'$nt6 $t". A(!+ n+t$ t *t t $ n*'$! &n tDEPARTMENT #$"+#, E($"t#&"*( En@&n$$#&n@% *n, t $ FACULTY #$"+#,! SCOTT6 TJOMGAGNON% *#$ u!$, t+ &n,&"*t$ t $ #$"+#, +""u##$n"$!. T $#$ "+u(, 5$ *,,&t&+n*( &n +#'*t&+n"+n"$#n&n@ t $ DEPARTMENT $t".6 C *&#'*nv! N*'$6 D$p*#t'$nt6 L+"*t&+n6 Bu,@$t6 $t".% *FACULTY $ .6 A@$6 S*(*#-6 A,,#$!!6 $t".% !t+#$, &n t $ #$"+#,.

Problem(

Y+u *#$ t+ #&t$ * p#+@#*' t+ &'p($'$nt t &! !$t !t#u"tu#$. Y+u# p#+@#*' ! +u(, *""$pt unput #$""+nt*&n )*#&+u! !$t "+''*n,!. T $!$ "+''*n,! *#$ t+ p#+,u"$ )*#&+u! *"t&+n!. T $!$ *"t&+n! *#$!u''*#&8$, 5$(+ 6 *! $(( *! t $ +#'*t! + $*" +t t $ "+''*n,! ,$!"#&5$, +#'*t !t*t$'$nt &! #&tt$n &n 5+(,%. A(( &nput #$"+#,! "*n 5$ "+,$, &n #$$ &$(, +#'*t. T $ +n(- ,$(&'&t$#! *#$ 5(*n?!.

ADD DEPARTMENT = A,, * n$ ,$p*#t'$nt*( + n$#% #$"+#, +""u##$n"$ t+ t $ ,*t*5*!$.

A## #$PART-$NT department S name department S budget

$lectrical engineering

9agnon

Roggio

0cott

Thomas

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 356/499

2. ADD FACULTY > A,, * n$ *"u(t- '$'5$#% #$"+#, +""u##$n"$ t+ t $ ,*t*5*!$. E*" n$*"u(t- #$"+#, 'u!t 5$ *!!+"&*t$, &t * ,$p*#t'$nt*( #$"+#,

A## FACU!T 7aculty S member S last>name salary deaprrment>name

3. LIST DEPARTMENT = (&!t t $ n*'$! + *(( + t $ *"u(t- '$'5$#! *!!+"&*t$, &t * ,$p*#t'$nt. !.0T #$PART-$NT department>name4. LIST FACULTY> L&!t t $ n*'$ *n, !*(*#- + t $ !p$"& &" *"u(t- '$'5$#.

!.0T FACU!T 7aculty S member>last>name department>name

. STOP> St+p p#+""$!&n@.

0T:P

Assumptions(1. Y+u '*- *!!u'$ t *t budget *n, salary ,*t* *#$ ($!! t *t :<6<<<.

2. Y+u '*- *!!u'$ t *t *(( &nput ,*t* &! &n upp$#"*!$.

3. T $ '* &'u' ($n@t + t $ department name*n, t $ 7aculty name&! 2< " *#*"t$#!.

4. Y+u '*- *!!u'$ t *t t $#$ &(( n$)$# 5$ * LIST DEPARTMENT +# * LIST FACULTY "+''*n,+# * DEPARTMENT +# * FACULTY '$'5$# t *t ,+$! n+t $ &!t.

. T $#$ &(( n$)$# 5$ * LIST FACULTY "+''*n, +# * *"u(t- '$'5$# + &! (&!t$, &n t $ #+n@,$p*#t'$nt.

:. T $#$ &(( n$)$# 5$ *n ADD FACULTY "+''*n, &" "+nt*&n! * D$p*#t'$nt &" ,+$! $ &!t

:utput ReGuirements(

1. A(( &nput #$"+#,! ! +u(, 5$ $" +$,.

2. T $ +utput #+' t $ LIST FACULTY "+''*n, ! +u(, (++? *! +((+ !

FACULTY *"u(t->n*'$SALARY !*(*#-

3. T $ +utput #+' t $ LIST DEPARTMENT "+''*n, ! +u(, (++? *! +((+ !

DEPARTMENT ,$p*#t'$nt>n*'$

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 357/499

BUDGET 5u,@$t

4. I t $#$ &! *n &(($@*( "+''*n, ,&!p(*- t $ +((+ &n@ '$!!*@$ *n, "+nt&nu$ p#+"$!!&n@.

ERROR IN COMMAND

. I t $#$ &! *n $##+# &n $&t $# t $ ADD +# LIST "+''*n,!6 ,&!p(*- t $ *pp#+p&*t$ $##+# '

ADD C+''*n, $##+# LIST C+''*n, $##+#

:. D+u5($ !p*"$ *(( +utput $ "$pt $#$ n+t$,. S$$ +utput #$ u&#$'$nt! 2 *n, 3%.

0ample #ata(

A## #$PART-$NT $!$CTR.CA! S$N9 KKKKA## #$PART-$NT .N#U0TR.A! S $N9 =KKKKA## FACU!T $0P:0.T: ' KKK .N#U0TR.A! S$N9A## FACU!T 9A9N:N ''KKK $!$CTR.CA! S$N9A## FACU!T 9A9N:N $!$CTR.CA! S$N9!.0T FACU!T 9A9N:N $!$CTR.CA!> $N9

!.0T #$PART-$NT $!$CTR.CA!>$N90T:P

0ample :utput(

A## #$PART-$NT $!$CTR.CA! S$N9 KKKKA## #$PART-$NT .N#U0TR.A! S$N9 =KKKKA## FACU!T $0P:0.T: ' KKK .N#U0TR.A! S$N9A## FACU!T 9A9N:N ''KKK $!$CTR.CA! S$N9FACU!T ( 9A9N:N0A!AR ( ''KKK#$PART-$NT( $!$CTR.CA!>$N9BU#9$T( KKKK

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 358/499

UPR P#+@#*''&n@ C+ntP#+5($' S$t

M*#" 6 2 1 1

7roblem "! +O$D#AC5 CON(ECT0RE

S+u#"$ F&($ N*'$ ED3.;;;

Input F&($ N*'$ ED3.DATOutput F&($ N*'$ ED3.OUT

#e7ine(

T $ G+(,5*" "+n0$"tu#$ !t*t$! t *t *n- p+!&t&)$ $)$n nu'5$# @#$*t$# t *n 4 "*n 5$ $ p#$!!$, *+ t + p#&'$ nu'5$#!. T &! "+n0$"tu#$ *! n$)$# 5$$n "+'p($t$(- p#+)$n6 5ut &t *! 5$$n ,$'+n 5- "+'put$# t+ 5$ t#u$ +# * &,$ #*n@$ + $)$n nu'5$#!.

Problem(

G&)$n *n $)$n nu'5$# @#$*t$# t *n 46 &n, t + p#&'$ nu'5$#! &" !u' t+ &t. F+# pu#p+!$ p#+5($'6 1 &! n+t "+n!&,$#$, * p#&'$ nu'5$#.

.nput(

Input +# t &! p#+5($' "+n!&!t! + * (&!t + $)$n nu'5$#! @#$*t$# t *n 46 +n$ p$# (&n$. T $ n 5$ $ $# t *n 1< ,&@&t! &n ($n@t .

:utput(

E*" (&n$ + t $ p#+@#*' +utput "+n!&!t! + $ *"t(- t #$$ $nt&t&$! t $ +#&@&n*( &nput nu'5

p#&'$! &" !u' t+ t *t nu'5$#.0ample #ata(

1<

0ample :utput(

O#&@&n*( P#&'$3

1<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 359/499

UPR Programming ContestProblem Set

March 2, 1991

Problem +( CA$C0$ATOR

Source File Name: ED4.XXXInput File Name: ED4.DATOutput File Name: ED4.OUT

Problem:

You are to write a program which can evaluate simple expressions. The expression can contain thefollowing t~-q;:ms:

decimalnumber:operators:parenthesis:

optional sign, the digits 0-9 and decimal point,+, -, *, or/,( or ) to specify precedence grouping.

You can assume that the expression should be evaluated right to left, except where parenthesis grouping isfound. You can also assume that all input expressions are syntactically correct and that each token is separatedby exactly one blank space. All expressions will be less than 50 characters in length.

When an input expression is read, you are to print that expression and it's value correct to 6 decimal places.

Sample Data:

1 + 22 * 1.3 / ( 77 * 88 )

Note that · is equivalent to a space.Sample Output:1 + 2 = 3.0000002 * 1.3 / ( 77 * 88 ) = .000384

Page 9

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 360/499

7roblem ' W Pa! *inder

S+u#"$ F&($ N*'$ ED1.

Input F&($ N*'$ ED1.DATOutput F&($ N*'$ ED1.Out

P#+5($'Bu&(, * (&!t #+' * !$t + &nput p*&#! &,$nt& -&n@ * !t*#t *n, $n, p+&nt + (&n? +n * p*t .

A t#*"$ t $ p*t t+ p+&nt E. Output t $ p*t t *t *! t $ ($*!t (&n?!.

F+# $ *'p($F+# t $ +((+ &n@ p*&#!

A6BB6CC6DD6E

T $ p*t #+' A t+ E &! ABCDE.

S*'p($ D*t*A6LA6BL6DD6C

C6EB6FS*'p($ Output

T $ p*t #+' A t+ E &! ABFE

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 361/499

7roblem 2 W T e uca Complier

Source File Name: ED2.xxx

!nput 9ile 4ame: +-'.-2;

#utput 9ile 4ame: +-'.#ut

D$ &n&t&+nA !t#&n@ &! *n- "+'5&n*t&+n + 5(*n?!6 ($tt$#!6 ,&@&t! *n, !p$"&*( " *#*"t$#. K+#, *#$ @#+u!$p*#*t$, 5- 5(*n?!.

P#+5($'D$)$(+p * YUCA (*n@u*@$ p*#!$#b"+'p&($#. T $ YUCA Yu-+d! Un"($ C+'p&($# bA!!$'5($#% (*n,($ up t+ 2< )*#&*5($!6 *(( + &" *#$ @(+5*(. V*#&*5($! "*n 5$ up t+ : " *#*"t$#! (+n@. On(4< " *#*"t$#!% "*n 5$ *!!&@n$, t+ )*#&*5($. A )*#&*5($ "*n !t+#$ !t#&n@! up t+ 4< " *#*"t$#!.

A YUCA p#+@#*''$# "*n u!$

1% *n INVERT un"t&+n6 &" &(( #$)$#!$ t $ !t#&n@. +n$ *#@u'$nt%2% * PRINT un"t&+n6 &" &(( p#&nt t $ )*(u$ +# )*#&*5($. +n$ *#@u'$nt%3% * BEGIN !-'5+(6 &" &! u!$, t+ '*#? t $ 5$@&nn&n@ + * p#+@#*'.4% * END !-'5+(6 &" &! u!$, t+ '*#? t $ $n, + * p#+@#*'.

A(( un"t&+n! *#$ #$!$#)$, !-'5+(!. T $ YUCA "+'p&($# ! +u(, p#&nt *n $##+# &

An- un"t&+n n*'$ &! u!$, *! * !-'5+(. An- un*!!&@n$, !-'5+( &! u!$, &n * un"t&+n. An- un,$ &n$, un"t&+n &! u!$,.

A(!+ !-nt* $##+#! ! +u(, 5$ (*@@$,6 BUT NOT DESCRIBEDWWW. N+ n$!t$, un"t&+n! *#$ YUCA (*n@u*@$. NO NEED TO CJEC FOR CASE SENSITIVITY.

T $ "+'p&($# "*n #$*, up t+ p#+@#*'! *! ,*t*.

A !*'p($ YUCA p#+@#*' &!BEGINA1 X\BATATA\aA2 X\PLATANO\aA3 X [FOO\aINVERT A3%

PRINT A3%aPRINT A1%aEND

BEGON

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 362/499

A1 X\FOO\aEND

*n, &t! +utput &(( 5$

P#+@#*' 1OOFBATATA

P#+@#*' 2S-nt* E##+# *t (&n$ 1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 363/499

7roblem " Mo.ie $i"!ing" Da!aba"e

0ource File Name( $#=4555Input F&($ N*'$ ED3. DATOutput F&($ N*'$ ED3.OUT

D$ &n&t&+nA !t#&n@ &! *n- "+'5&n*t&+n + 5(*n?!6 ($tt$#!6 ,&@&t! *n, !p$"&*( " *#*"t$#!.

P#+5($'R$*, * !$t + ,*t* t&'$! *n, '+)&$!% &nt+ * ,*t*5*!$ *n, #$t#&$)$ *(( '+)&$! p(*-&n@ 5$t $$n "$#t*n, #$t#&$)$ *(( t&'$! +# t $ '+)&$ [ROC Y \ *! t $ (*!t u$#-. T $ #$t#&$)$ u$#- *! t $ +#'*t

RMstart>time Mend>time

N+ ,*t* &(( +((+ *n- u$#-. N+ n$$, +# $##+# " $"?&n@% T $ &n,&"*t+# +# t $ 5$@&nn&n@ *n $'pt- (&n$.

T $ t&'$ &(( 5$ t $ &#!t " *#*"t$#! + t $ &nput (&n$6 +((+ $, 5- * "+''* 6% *n, * !t#&n@ + ($!! " *#*"t$#! "+nt*&n&n@ t $ n*'$ + t $ '+)&$.

T $ p#+@#*' ! +u(, *n,($ &n"+##$"t &nput ,*t*. D*t* " $"?! ! +u(, 5$ '*,$ +# &(($@*( t&'$!.

F+# $ *'p($In t $ +((+ &n@ &nput

3<6 ROC Y <<6 T2

1< <<6 BLUE VELVET

R 3< <<

T $ +utput ! +u(, 5$P(*-&n@ 5$t $$n 3< *n, << *#$ ROC Y 6 T2 ROC Y 5$&n@ p(*-$, *t 3<.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 364/499

7roblem # W Direc!or% Searc

S+u#"$ F&($ N*'$ ED4.Input F&($ N*'$ ED4.DATOutput F&($ N*'$ ED4.OUT

D$ &n&t&+nK+#,! *#$ @#+up! + " *#*"t$#! !$p*#*t$, 5- 5(*n?!.

P#+5($'K#&t$ * p#+@#*' t+ #$*, * \'ut&(*t$,\ +#, #$p#$!$nt&n@ * n*'$ *n, !u5!t&tut$ t $ "(+!$!t '*t" &n@["+##$"t$,\ n*'$! #+' * (&!t + ["+##$"t\ n*'$!. T+ ,$t$#'&n$ t $ "(+!$!t '*t" &n@ n*'$6 *!!u'$ t $ &#($tt$# *! t+ '*t" 6 t $ +#, *! t+ 5$ &t &n 2 " *#*"t$#! + t $ !$($"t$, [ "+##$"t\ n*'$6 *n, t $ !$($"t$,["+##$"t\ n*'$ *! t $ '+!t " *#*"t$# '*t" $! &t t $ 'ut&(*t$, n*'$ "+unt +n(- '*t" &n@ " *#*"t$#!#$@*#,($!! + p+!&t&+n%.

A!!u'$ t *t n*'$! "+nt*&n +n(- "*p&t*( ($tt$#!. T $ &nput &($ &(( "+n!&!t + * (&!t + up t+ ["+##n*'$!6 +((+ $, 5- up t+ 2< [&n"+##$"t\ n*'$!. B+t + t $!$ (&!t! &(( 5$ !$p*#*t$, 5- *n $'pt- (&n$.

F+# $ *'p($6 +# *n &nput +

HENNIFER TRACYHEANINESANDRAHOSEPJ

HENIFER HOSETRAPPER

T $ +utput ! +u(, 5$

M*t" +# HENIFER &! HENNIFER M*t" +# HOSE &! HOSEPJM*t" +# TRAPPER &! TRACY

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 365/499

7roblem &GPu11le

Source File Name: ED5.xxxInput F&($ N*'$ ED .DATOutput F&($ N*'$ ED .OUT

P#+5($' Y+u *#$ t+ #&t$ * p#+@#*' &" &(( !"*n * 1< 1< " *#*"t$# @#&,6 *n, &n, t $ +""u##$n p*#t&"u(*# +#, &n t $ @#&,. T $ +#, "*n 5$ +un, +#&8+nt*((-6 )$#t&"*((-6 ,&*@+n*((- ON AN

F+# &n!t*n"$6 @&)$n * @#&, 4 4%

A B # O

O J P

J K U P

P L U P

*n, t $ n$ t &nput 5$&n@BOKLPULPPULL

$ p#+@#*' ! +u(, p#&nt t $ (+"*t&+n + t $ +#,6 (&?$

BOKL &! &n p+!&t&+n!6 261%6 262%6 263%6 264%.PULP &! &n p+!&t&+n! 164%6 264%6 364%6 464%T $ +#, PULL &! n+t &n t $ @#&n,.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 366/499

Problem 8) T e P%ramidU Sor!

S+u#"$ F&($ N*'$ ID2.Input F&($ N*'$ ID2.DATOutput F&($ N*'$ I,2.OUT

D$ &n&t&+nA !t#&n@ &! *n- "+'5&n*t&+n + 5(*n?!6 ($tt$#6 ,&@&t! *n, !p$"&*( " *#*"t$#!. K+#,! *#$ @#+u!$p*#*t$, 5- 5(*n?!.

P#+5($'K#&t$ * p#+@#*' t *t &(( #$*, * (&!t + &nt$@$#! up t+ 3<%6 *n, !+#t t $' p(*"&n@ t $ (*#@$!t n'&,,($6 t $ !$"+n, (*#@$!t t+ t $ ($ t + t $ (&!t6 t &#, (*#@$! t+ t $ #&@ t + t $ (&!t6 *n, !+ +n.

F+# $ *'p($6 & $ !+#t6 46 6 2<6 12

$ &(( *)$6 126 2<6 6 4

T $ p#+@#*' ! +u(, +#? +# 5+t $)$n *n, +,, nu'5$# + $($'$nt! &n t $ (&!t. F+# $)$n nu'5$#!6 t $ (*#nu'5$# ! +u(, 5$ p(*"$, &n t $ Nb2 1 p+!&t&+n6 t $ +((+ &n@ &t t $ !*'$ p*tt$#n.

F+# $ *'p($ 16 26 36 46 6 :

K&(( 5$ !+#t$, *! 16 36 6 :6 46 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 367/499

UNIVERSIDAD INTERAMERICANADE PUERTO RICO

RECINTO DE BAYAMÓN

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 368/499

Fma" O$IMPIADAS DE PRO+RAMACIONINTER#A 4 8

E-PERTOS

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 369/499

Problem: Ma!ri9 Ma!c er

Inpu!: tandard 6nputOu!pu!: tandard Butput

G&)$n *n N e M '*t#& 6 -+u# t*!? &! t+ &n, t $ nu'5$# + +""u##$n"$! + *n ; e Y p*tt$#n.

Inpu!T $ &#!t (&n$ "+nt*&n! * !&n@($ &nt$@$# t t i 1 %6 t $ nu'5$# + t$!t "*!$!. F+# $*" "*!$6 t $ &#!t (&n$ "+nt*&n! tN6 M i 1<<<%. T $ n$ t N (&n$! "+nt*&n M " *#*"t$#! $*" . T $ n$ t (&n$ "+nt*&n! t + &nt$@$#! ; *n, Y ;6 Y i 1<<%(&n$! "+nt*&n Y " *#*"t$#! $*" .

Ou!pu!F+# $*" "*!$6 +utput * !&n@($ &nt$@$# &n &t! + n (&n$6 t $ nu'5$# + +""u##$n"$!.

Sample inpu!21 1x1 1F3 3abc

bc* c*e2 2

bcc*

Ou!pu! for Sample Inpu!

02

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 370/499

Problem ( Pic3>up stic3s

St*n *! n !t&"?! + )*#&+u! ($n@t !. J$ t #+ ! t $' +n$ *t t&'$ +n t $ (++# &n *#*n,+' *-. A t$# &n&! &n@ t #+ &n@6 St*n t#&$! t+ &n, t $ t+p !t&"?! t *t *#$t $!$ !t&"?! !u" t *t t $#$ &! n+ !t&"? +n t+p + t $'. St*n *! n+t&"$, t *t t $(*!t t #+ n !t&"? &! *( *-! +n t+p 5ut $ *nt! t+ ?n+ *(( t $ !t&"?! t *t *#$ +nt+p. St*n !t&"?! *#$ )$#-6 )$#- t &n !u" t *t t $&# t &"?n$!! "*n 5$ n$@($"t$,.

Input "+n!&!t! + * nu'5$# + "*!$!. T $ ,*t* +# $*" "*!$ !t*#t &t1 i n i10000 6 t $ nu'5$# + !t&"?! +# t &! "*!$. T $ +((+ &n@n (&n$! "+nt*&n +u#nu'5$#! $*" a t $!$ nu'5$#! *#$ t $ p(*n*# "++#,&n*t$! + t $ $n,p+&nt! + +n$!t&"?. T $ !t&"?! *#$ (&!t$, &n t $ +#,$# &n &" St*n *! t #+ n t $'. Y+u '*-*!!u'$ t *t t $#$ *#$ n+ '+#$ t *n 1<<< t+p !t&"?!. T $ &nput &! $n,$, 5- t $"*!$ &t n X <. T &! "*!$ ! +u(, n+t 5$ p#+"$!!$,.

F+# $*" &nput "*!$6 p#&nt +n$ (&n$ + +utput (&!t&n@ t $ t+p !t&"?! &n t $ +#'*t@&)$n &n t $ !*'p($. T $ t+p !t&"?! ! +u(, 5$ (&!t$, &n +#,$# &n &" t $- $#$t #+ n.

T $ p&"tu#$ t+ t $ #&@ t 5$(+ &((u!t#*t$! t $&#!t "*!$ #+' &nput.

0ample .nput"1 1 $ 22 " " '' G2 . 0 % #' # % 2" " $ G2 . 0"0 0 ' '' 0 2 '2 0 " '0

:utput 7or 0ample .nput'op stic s: 2, $, "&'op stic s: 1, 2, 3&

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 371/499

In Op$#*t&n@ S-!t$'! * !p$"&*( #$!+u#"$>*((+"*t&+n @#*p *(@+#&t ' "*n 5$ u!$, t+ ,$t$"t $t $# t $#$ &! *n- ,$*,(+!-!t$'. A #$!+u#"$>*((+"*t&+n @#*p &! * ,&#$"t$, @#*p "+n!&!t&n@ + t + ,& $#$nt t-p$! + n+,$! P P 16 P 26 .6 P n6 t $ !$t"+n!&!t&n@ + *(( #$!+u#"$ t-p$! &n t $ !-!t$'.

A ,&#$"t$, $,@$ #+' p#+"$!! P & t+ #$!+u#"$ R 06 &! ,$n+t$, 5- P & w R 0 *n, '$*n! t *t p#+"$!! P & #$ u$!t$, *n &n!t*n"$ #$!+u#"$ t-p R 06 *n, &! "u##$nt(- *&t&n@ +# t *t #$!+u#"$. A ,&#$"t$, $,@$ #+' #$!+u#"$ t-p$ R 0 t+ p#+"$!! P &6 &! ,$n+t$, 5- R 0w P & *n, '$*n! t *t *n &n!t*n"$ + #$!+u#"$ t-p$ R 0 *! 5$$n *((+"*t$, t+ p#+"$!! P &.

T $ +((+ &n@ &@u#$ &((u!t#*t$! * #$!+u#"$>*((+"*t&+n @#*p $#$ p#+"$!!$! *#$ ,$n+t$, 5- "&#"($! *n, #$!+u#"$t *t & t $#$ &! * "&#"u(*# *&t *'+n@ t $ p#+"$!!$!6 t $n &t &'p(&$! t *t * ,$*,(+"? *! +""u##$,.

S$ u$n"$ D>">E>$>G>

G&)$n * #$!+u#"$ *((+"*t&+n @#*p &n &" $*" #$!+u#"$ t-p$ *! $ *"t(- +n$ &n!t*n"$6 -+u# 0+5 &! t+ ,+ ,$t$#'&n$* ,$*,(+"? &n t $ !-!t$'. In "*!$ * ,$*,(+"? $ &!t!6 -+u 'u!t *(!+ ! + t $ !$ u$n"$ + p#+"$!!$! *n, #$!+u#"$! &n)+()$,.

.NPUTThe input begins ?ith a single positive integer on a line by itsel7 indicating the number o7 cases 7ollo?ingJ each o7 them described belo?4 This line is 7ollo?ed by a blan3 lineJ and there is also a blan3 line bet?een t?o consecutive inputs4

K$ &(( *!!u'$ t *t t $ p#+"$!!$! *#$ n*'$, 5- "*p&t*( ($tt$#! *n, #$!+u#"$! 5- !'*(( ($tt$#!6 !+ $ (&'&t t+ 2: t $ nu'5$# + p#+"$!!$! *n,b+# #$!+u#"$!. T $#$ +#$6 t $ &#!t (&n$ + &nput "+n!&!t! + t #$$ nu'5$#! N 6 M *n, 6 #$!p$"t&)$(-6 t $ nu'5$# + p#+"$!!$!6 t $ nu'5$# + #$!+u#"$! *n, t $ nu'5$# + $,@$!. T $ $,@$! *#$ @&)$n &n t $ +((+ &n@ (&n$! *! p*&#! + ($RD^ " *#*"t$#. E,@$! *#$ !$p*#*t$, 5- !p*"$! +# n$ (&n$!.

:UTPUTFor each test caseJ the output must 7ollo? the description belo?4 The outputs o7 t?o consecutive cases ?ill be separated byblan3 line4

T $ +utput 'u!t 5$ RNK_ & n+ ,$*,(+"? &! ,$t$"t$,. In "*!$ $ ,$*,(+"? &! ,$t$"t$,6 t $ +utput 'u!t 5$RIE;_ +((+ $, 5- t $!$ u$n"$ +# !$ u$n"$! + "&#"u(*# *&t! ,$t$"t$,6 +n$ p$# (&n$. I '+#$ t *n +n$ !$ u$n"$ &! +un,6 t $- ! +u(, *(( 5$ +utp&n"#$*!&n@ + t $&# ($n@t .

#eadloc3 #etection

C D

B

E

GF

, $

A

" 5

*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 372/499

0ample .nput1

2 2 $6Db >DaaD6 bD>

0ample :utputIE;6DbD>DaD6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 373/499

N+ *,*-! '*#?>up (*n@u*@$! (&?$a'e# 6L'M 6; M 6 *n,#M *#$ &,$(- u!$, t+ ,$ &n$6 &n * "+'p($t$(- t$ tu*( '+,$6 t $!t#u"tu#$! + ,+"u'$nt!. T +!$ (*n@u*@$! *#$ "+'p+!$, 5- t*@!6 +# *nn+t*t&+n!6 t *t *#$ u!$, t+ '*#? 5(+"?! + t$ t t $&$n,% &n +#,$#

• t+ !p$"& - t $ ,+"u'$nt !t#u"tu#$!> +# &n!t*n"$6 t $ front material (&?$ t $title6 t $authors 6 t $date 6 +# *chapter 6 &t &t! sections *n, para#raphs a

• t+ @&)$ t $' !+'$ !p$"&*( &nt$#p#$t*t&+n6 +# * p*#t&"u(*# +#'*tt&n@ &n +#'*t&+n = +# &n!t*n"$6 t+ !*- t,$!&@n*t$! *country 6 * profession 6 *kin# 6 +# t $ 5(+"? 'u!t 5$ p#&nt$, +ut &nitalic 6 +#boldface .

T*@! *#$ 0u!t +#,! (&?$ *(( t $ +t $#! t *t 5$(+n@ t+ t $ +#&@&n*( p(*&n t$ ta !+6 &t &! n$"$!!*#- t+ u!$ !+'$ ($ &"*(,&!t&n@u&! t +!$ !p$"&*( +#,! *nn+t*t&+n!%. A(!+6 $ n$$, !+'$ ($ &"*( "+n)$nt&+n t+ &,$nt& - t $ 5$@&nn&n@ *t$ t 5(+"? $ *nt t+ *nn+t*t$.

In t $ p#$!$nt "+nt$ t6 +u# '*#?>up (*n@u*@$ +((+ ! *n *pp#+*" !&'&(*# t+ t $; M 5*!$, (*n@u*@$!

• !p$"&*( " *#*"t$#! = ! u*#$

*n, "u#(-\ ]

5#*"?$t! = *#$ u!$, t+ &,$nt& - t $ +#,! t *t *#$ t*@ n*'$!a• t $ !*'$ t*@ n*'$ &! u!$, t+ !$tup 5(+"? 5+un,*#&$!6 *n, ($ &"*( ,$t*&( ,$ &n$! t $ +p$n&n@ *n, "(+!&n@ t*@

&! openin Dta , closin Dta *n, \openin Dclosin Dta ] .

P*&#$, t*@! *#$ $'p(+-$, t+ ,$ &n$ t $ ,+"u'$nt !t#u"tu#$6 &($ !&n@($ t*@! *#$ u!$, t+ @&)$ '$*n&n@ +# +#'*tt&nT*@ n*'$! +n$ ($tt$# +((+ $, 5- 8$#+ +# '+#$ ($tt$#! +# ,&@&t!% *#$ #$$6 &.$. n+t p#$)&+u!(- ,$ &n$,a t &! '$*n! t *'*#?>up (*n@u*@$ "*n " +!$ t $ n*'$! + t $ t*@! $ &(( $'p(+- t+ *nn+t*t$ &! ,+"u'$nt. J+ $)$#6 t+ 5$ *valid annotation &t'u!t 5$ &n "+n +#'&t- &t t $ +((+ &n@ #u($!

• *nopenin#-ta# 'u!t *( *-! *)$ * "+##$!p+n,&n@closin#-ta# a• * closin#-up 'u!t *( *-! *)$ * "+##$!p+n,&n@openin#-ta# a• p*&#$, t*@! '*- 5$ n$!t$, t+ *n- ($)$(6 + $)$# t $ (*!t +p$n&n@>t*@ 'u!t 5$ "(+!$, 5$ +#$ *n- $n"(+!&n@ t*@

$ t$#n*( 5(+"? "*n n+t 5$ "(+!$, 5$ +#$ *n &nt$#n*( +n$a•

*nopenin#-closin#-ta# "*n n+t *)$ +t $# t*@! &n!&,$a &n t *t "*!$6 t $ "+##$!p+n,&n@ 5(+"? + t$ t &(( *pp$*#"u#(- 5#*"?$t!.

G&)$n * !t#u"tu#$, ,+"u'$nt6 !upp+!$, t+ 5$ *nn+t*t$, *""+#,&n@(- t+ t $ '*#?>up (*n@u*@$ *5+)$ ,$!"#&5$,6 #&t$ *)*(&,*t$! &t6 t *t &! t *t )$#& &$! & t $ t*@! *#$ p#+p$#(-

InputThe input begins ?ith a single positive integer on a line by itsel7 indicating the number o7 cases 7ollo?ingJ each o7 them described belo?4 This line is 7ollo?ed by a blan3 lineJ and there is also a blan3 line bet?een t?o consecutive inputs4T $ &nput &! * p(*&n t$ t &($ &t t*@!6 +((+ &n@ t $ *5+)$ !t*t$, "+n)$nt&+n!. A!!u'$ t *t ($ &"*( "+n)$nt&+n! !p$"t #$$ t*@ t-p$! openin Dta , closin Dta *n, \openin Dclosin Dta ] % *#$ *( *-! "+'p(&$,.

OutputFor each caseJ the output must 7ollo? the description belo?4 The outputs o7 t?o consecutive cases ?ill be separated by ablan3 line4

T $ +utput "+n!&!t! +• 0u!t 1 (&n$ &t t $ +#,Rerror_ & +n$ + t $ #u($! + *5+)$ &! n+t +5!$#)$,6 '*?&n@ t $ &nput *n &n)*(&, *nn

,+"u'$nta

#ocument /alidator

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 374/499

• 2 (&!t! &t t $ t*@ n*'$! +un,6 &t +ut ,up(&"*t$! *n, &n t $ +#,$# t $- *pp$*# &n t $ ,+"u'$nt #+' t $ 5$@&nn&$n,%6 1 +#, p$# (&n$. T $ &#!t (&!t 5$@&n! &t t $ $*,&n@ (&n$Rstructural ta s_ 6 &($ t $ !$"+n, (&!t &(( 5$@&&t t $ $*,&n@ (&n$Rsemantic ta s . B(*n? (&n$! 5$t $$n t +!$ *#$ n+ *((+ $,.

S*'p($ &nput1

memode Comiss ao Cient fica do M97P depara 'odos os Concurrentes paradata \bold 2!!1&set&2"] datamensa empara =evem ter o m axiom cuidado na leitura dos enunciados& parapara =ese8amos a todos \dese8o Calma] e \dese8o >oa ;orte]Z paramensa emmemo

S&'p($ Output;'57C'756 '6 ;

memodeparadatamensa empara;EM6N'9C '6 ;bolddese8o

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 375/499

Fma" O$IMPIADAS DE PRO+RAMACIONINTER#A 4 8

In!ermedio

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 376/499

D$!*##+(($ un p#+@#*'* $n $( ($@u*0$ ,$ !u p#$ $#$n"&*6 p*#* u$ ($* un *#" &)+DATA.t t6 u$ "+nt$n,#_ un* '*t#&8 '*-+# + &@u*( * 2 ; 2. Su p#+@#*'* ,$5$#_ ($$# - ,$t$#'&n*# (* #ut* '_! "+#t* p*#* (($@*# ,$!,$ (* "*!&((* <6<% * (* '6n% $! ,$"&#$ t#$'+ !up$#&+# &8 u&$#,+ *!t* $( &n $#&+# ,$#$" + $n $!t$ "*!+ ,$!,$ $( 1 *!t* $E0.

1 2 3 4:1< 11 12

13 14 1 1:

En $!t$ $0$'p(+ (* #ut* '_! "+#t* $! 16263646 61261:INPUT

Un $0$'p(+ ,$( "+nt$n&,+ ,$ DATA.t t pu$,$ !$#

3 3

<2341:

BUJ7UJ!

02"#'$(&)

La ruta más corta entre 0 * ) es! 0, 2, ', &, )

Cota! 9ebe tomar en consideración que su programa debe reconocer cualquiermatriz ma*or o igual a 2 V 2. emplos! " V ", # V # etc.

P#+5($'* llllllll CAMINO MAS CORTOAut+# P#+ . H+! A. R+,#`@u$8 O#t$@*

D&'$n!&7n ,$ (*'*t#&8

C+nt$n&,+,$ (* '*t#&8

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 377/499

6mplemente un diamante basándose en el Jriángulo de 7ascal. l usuario entrará elnivel * su programa deberá generarlo. l diamante debe ser nivel " en adelante.

emplo!

ntre el nivel de su diamante! $

emplo 2!ntre el nivel de su diamante! (

Cota! u programa mostrará solo el dimante, no inclu*a los niveles.

P#+5($'* llllllll DIAMANTE DE PASCALAut+# P#+ . H+! A. R+,#`@u$8 O#t$@*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 378/499

6mplemente un uego de Jic Jac Joe interactivo donde el usuario pueda ugar contrael código creado por usted. 9ebe tomar en consideración que se puede ganarhorizontal, vertical * diagonalmente. u programa deberá ser inteligente, es decir, lacomputadora debe programarse para ganar * ugar estratXgicamente. Co debe hacermeramente ugadas aleatorias.

P#+5($'* llllllll TIC TAC TOE 3D Int$#*"t&)+Aut+# P#+ . H+! A. R+,#`@u$8 O#t$@*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 379/499

D$!*##+(($ un p#+@#*'* $n $( ($n@u*0$ ,$ !u p#$ $#$n"&*6 p*#* u$ ($* un *#" &)+ ((*'*,+ DATA.t t u$ "+nt&$n$ un"u*( u&$#* - un* 3 ; 3 "+n ,*t+! "+'+ (+! !&@u&$nt$!

INPUT

2

n/'$#+ $nt$#+ *#5&t#*#&+:3214 "+nt$n&,+ ,$ (* '*t#&8

Su p#+@#*'* ,$5$#_ n*)$@*# t+,*! (*! #ut*! p+!&5($! ,$!,$ $( $ t#$'+ !up$#&+# &8 u&$#,+ <6<% $n $!t$ "*!+6 *!t*&n $#&+# ,$#$" + n6 '% $n $!t$ "*!+. Su p#+@#*'* ,$5$#_ '+!t#*# t+,*! (*! #ut*! p+!&5($!sin repetir casillas6 (* #ut* ,$ (*!u'*t+#&* '_! "$#"*n* *( n/'$#+ u$ !$ p#+)$$ $n $( *#" &)+ 2 $n $!t$ "*!+%. L+! "*'&n+! !$ pu$,$n "+n!t#u&# '+)& n,+*##&5*6 *5*0+6 * (* ,$#$" * - * (* &8 u&$#,* nun"* $n ,&*@+n*(. N+ $! n$"$!*#&+ u$ !&@* $( !&@u&$nt$ +#,$n p

(*! )$#$,*!.OUTPUT

2 3 : 1 4 X 4 2 3 4 X 3 2 X 31 3 : 1 4 X 3 3 2 X 2 3 4 X 31 : 3 2 X 4< : 3 2 X 2 : 3 4 X 2

L* #ut* '_! "$#"* ,$ Q2 $! : 3 2 X 2

N+t*

L+! )*(+#$! ,$ (* '*t#&8 pu$,$n "+nt$n$# )*(+#$! n$@*t&)+!. D$ $ &!t&# #ut*! u$ p#+,u8"*n un '&!'+ #$!u(t*,+6 $( p#$!"+@$#_ * "+n)$n&$n"&* (* u$ u&$#* '+!t#*#.

P#+5($'* llllllll VEREDAS CON PROPÓSITOAut+# P#+ . H+! A. R+,#`@u$8 O#t$@*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 380/499

Bac3groundOn$ ,*-6 *n *nt "*(($, A(&"$ "*'$ t+ *n MeM " $!!5+*#,. S $ *nt$, t+ @+ *#+un, *(( t $ @#&,!. S+ ! $ 5$@*n t+ *(? *(+" $!!5+*#, *""+#,&n@ t+ t &! *- -+u "*n *!!u'$ t *t $# !p$$, &! +n$ @#&, p$# !$"+n,%

At t $ &#!t !$"+n,6 S(&"$ *! !t*n,&n@ *t 16 1%. F&#!t(- ! $ $nt up t $ @#&,6 t $n * @#&, t+ t $ #&@ t6 * @#&, ,+ n$nt * @#&, t+ t $ #&@ t6 t $' t + @#&,! up *#,6 *n, t $n t + @#&,! t+ t $ ($ t &n * +#,6 t $ p*t *! (&?$ * !n*?$.

F+# $ *'p($6 $# &#!t 2 !$"+n,! $nt (&?$ t &!t $ nu'5$#! &n t $ @#&,! !t*n,! +# t $ t&'$ $n ! $ $nt &nt+ t $ @#&,!%

At t $ t !$"+n,6 ! $ *! *t 26 3%6 *n, *t 2<t !$"+n,6 ! $ *! *t 6 4%.Y+u# t*!? &! t+ ,$"&,$ $#$ ! $ *! *t * @&)$n t&'$.-+u "*n *!!u'$ t *t M &! (*#@$ $n+u@ %

.nputInput &($ &(( "+nt*&n !$)$#*( (&n$!6 *n, $*" (&n$ "+nt*&n! * nu'5$# N 1fX2e1< %6 &" !t*n,! +# t $ t&'$. T $ &($n,$, &t * (&n$ t *t "+nt*&n! * nu'5$# <.

:utputF+# $*" &nput !&tu*t&+n -+u ! +u(, p#&nt * (&n$ &t t + nu'5$#! 6 -%6 t $ "+(u'n *n, t $ #+ nu'5$#6 t $#$ 'u!t 5$ +n( 5$t $$n t $'.

0ample .nput2!2"!

0ample :utput2 3" $1 "

2 24 23 22 211< 11 12 13 2< 4

14 1 32 3 : 1 1 21 4 1: 1 1

1 2 3 4

Problem A4Ant on a Chessboard

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 381/499

Problem A( Bee -a%aM*0* &! * 5$$. S $ (&)$! &n * 5$$ &)$ &t t +u!*n,! + +t $# 5$$!. T &! 5$$ &)$ "+n!&!t! + '*n- $ *@+n*( +n$- "+'5t $ +n$- &! !t+#$, &n.But 5$$ M*0* *! p#+5($'. K&((& t+(, $# $#$ ! $ "*n '$$t &'6 5ut 5$"*u!$ K&((& &! * '*($ ,#+n$ *n, M*0* &! * $'*($t $- *)$ ,& $#$nt "++#,&n*t$ !-!t$'!.

J$(p M*0* t+ "+n)$#t K&((&d! !-!t$' t+ $#!. K#&t$ * p#+@#*' &" +# * @&)$n +n$- "+'5 nu'5$# @&)$! t $ "++#,&n*!-!t$'..nput 0peci7icationT $ &nput &($ "+nt*&n! +n$ +# '+#$ &nt$@$#! &" #$p#$!$nt K&((&d! nu'5$#!. E*" nu'5$# !t*n,! +n &t! + n &n * !$,&#$"t(- +((+ $, 5- * n$ (&n$. T $ +n$- "+'5 nu'5$#! *#$ ($!! t *n 1<< <<<.:utput 0peci7icationY+u ! +u(, +utput t $ "+##$!p+n,&n@ M*0 "++#,&n*t$! t+ &((&d! nu'5$#!6 $*" "++#,&n*t$ p*&# +n * !$p*#*t$ (&n$0ample .ntput123$"0ample :utput! !! 1D1 1D1 !! D1

-a%a s Coordinate 0ystem @illi s Coordinate 0ystemM*0* + + t$n (&$! ,&#$"t(- t+ * !p$"&*( +n$- "+'5*! (*&, *n *,)*n"$, t + ,&'$n!&+n*( @#&, +)$# t $+($ &)$.

K&((& + &! '+#$ (*8- *n, + t$n *(?! *#+un, 0u!tnu'5$#$, t $ "$((! "(+"? &!$ !t*#t&n@ #+' 1 &n t $'&,,($ + t $ &)$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 382/499

Fma" OI$IMPIADAS DE PRO+RAMACIONINTER#A 4 8

PRINCIPIANTES

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 383/499

B, $oKerca"e To 0pperca"e Con.er!

Trite a program that lets the user enter a string a character arra*. Jhe programshould then convert all the loFercase letters to uppercase or to Jitle 4ase. +6f acharacter is alread* uppercase, or is not a letter, it should be left alone. <int: 4onsultthe 8 446 chart in 8ppendi> 8. Cotice that the loFercase letters are represented b*the 8 466 codes )( thorough '22. 6f *ou subtract "2 from an* loFercase character:s

8 466 code, it Fill *ield the 8 466 code of the uppercase equivalent.

>ample!

Jhis program is difficult Y JA6 73BI38@ 6 9;;64ULJ Y Jhis 7rogram 6s9ifficult

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 384/499

2. Dri.erV" $icen"e E9am

Jhe local 9river:s License Bffice has asEed *ou to Frite a program that gradesthe Fritten portion of the driver:s license e>am. Jhe e>am has 20 multiplequestions. Aere are the correct ansFers!

'. N $. 8 ''. N '$. 42. 9 (. N '2. 4 '(. 4". 8 %. 8 '". 9 '%. N#. 8 ). 4 '#. 8 '). 9&. 4 '0. 9 '&. 9 20. 8

our program should store the correct ansFers shoFn above in an arra*. 6tshould asE the user to enter the student:s ansFers for each of the 20 questions, Fhichshould be stored in another arra*. 8fter the student:s ansFers have been entered, theprogram should displa* a message indicating Fhether a student passed or failed thee>am. +8 student must correctl* ansFer '& of the 20 questions to pass the e>am. 6tshould then displa* the total number of correctl* ansFered questions, and a listshoFing the questions numbers of the incorrectl* ansFered questions.

!nput validation: #nly accept t%e letters "4 ,4 C or as ans0ers .

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 385/499

3. $o!!er% Applica!ion

Trite a program that simulates a lotter*. Jhe program should have anarra* of five integers named lotter*, and should generate a randomnumber in the range of 0 through ) for each element in the arra*. Jhe usershould enter five digits Fhich should be stored in an integer arra* nameduser. Jhe program is to compare the corresponding elements in the tFoarra*s and Eeep account of the digits that match. ;or e>ample, thefolloFing shoFs the lotter* arra* and the user arra* Fith sample numbersstored in each. Jhere are tFo matching digits +elements 2 and # .

Lotter* arra*!

( # ) ' "

User arra*!

# 2 ) ( "

Jhe program should displa* the random numbers stored in the lotter*arra* and the number of digits matching digits. 6f all the digits match,displa* a message proclaiming the user as a grand prize Finner.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 386/499

4. &Ca" Regi"!er Applica!ion' Use the numeric Ee*pad from the Securi!%Panel application to build a Ca" Regi"!er application. 6n addition to numbers,the cash register should include a decimal point Nutton. 8part from this numericoperation, there should be En!er Dele!e Clear and To!al Nuttons. ales ta>should be calculated on the amount purchased. Use a elect 4ase statement tocompute sales ta>. 8dd the ta> amount to the subtotal to calculate the total.9ispla* the ta> and total for the user. Use the folloFing salesGta> percentages,Fhich are based on the amount of mone* spent!

8mount under Z'00 [ &\ +.0& sales ta> 8mount betFeen Z'00 and Z&00 [ (.&\ +.0(& sales ta> 8mount above Z&00 [ '0\ +.'0 sales ta>

*% Define e.en! andler" for ! e numeric #u!!on" and decimal poin! in! e ke%pad, 4reate event handlers for each of these Nutton:s 4licEevents. Aave each event handler concatenate the proper value to theJe>tNo> at the top of the ;orm.

5% Define an e.en! andler for ! e En!er #u!!onV" Click e.en!, 4reate anevent handler for this Nutton:s 4licE event. Aave this event handler addthe current amount to the subtotal and displa* the neF subtotal.

"% Define an e.en! andler for ! e To!al #u!!onV" Click e.en!, 4reate anevent handler for this Nutton:s 4licE event. Aave this event handler usethe subtotal to compute the ta> amount.

,% Define an e.en! andler for ! e Clear #u!!onV" Click e.en!, 4reate anevent handler for this Nutton:s 4licE event. Aave this event handler clearthe user input and displa* the value Z0.00 for the subtotal, sales ta> andtotal.

$% Define an e.en! andler for ! e Dele!e #u!!onV" Click e.en!, 4reate anevent handler for this Nutton:s 4licE event. Aave this event handler clearonl* the data in the Je>tNo>.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 387/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@ND

23pertos

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 388/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+u&nt*! O(&'p&*,*! ,$ P#+@#*'*"&7n

!N" R $% &''

CATEGORrA DE E;PERTOS

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+! -b+ "+n *#" &)+! $ t$#n+!. S$ ut&(&8Stu,&+. N$t p*#* #$!+()$# (+! '&!'+!. D$5$n $nt#$@*#!$ $n ,&!"+ t*n p#+nt+ "+'+ (+ *-*! t$#'&n

PROBLEMA 1

Decimal)#inar%

A !&'p($ '$t +, +# "+n)$#t&n@ 5*!$ 1< ,$"&'*(! t+ 5*!$ 2 &! t+ #$p$*t$,(- 'u(t&p(- 5- 2 *n, t*?$ t $ #$!u(t. F+# $ *'p($6 t $ "+n)$#!&+n + .14<:2 5*!$ t+ .<<1<<1 5*!$ 2 &! ! + n 5- t $ +((+ &n@ " *

.14<:2 <.2 12 XZ<

.2 12 <. :2 XZ<

. :2 1.12 XZ1

.12 <.2 XZ<

.2 <. XZ<

. 1 XZ1

T &! p#+"$!! t$#'&n*t$! $n t $ ,$"&'*( p+#t&+n + t $ p#+,u"t &! <.

T $#$ &(( 5$ nu'5$#! &nput6 $*" ($!! t *n 1.<. C+n)$#t $*" &nput t+ 5&n*#- *n, p#&nt t $ &#!tt $ 5*!$ 2 nu'5$#6 +# $ $# & t $ p#+"$!! t$#'&n*t$! 5$ +#$ t *t. D+ n+t p#&nt *n- ,&@&t! t+ t $ ($[,$"&'*( p+&nt.\

0ample .nput(

L&n$ 1 .14<:2L&n$ 2 .111

0ample :utput(

Output 1 .<<1<<1

Output 2 .<<<111<<<1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 389/499

Programming Problem #

Test #ata .nput(

1 .1<2 .43 .24 .12 .<<1

Test #ata :utput(

1 .<<<11<1<112 .<111<<11<<3 .<14 .<<1 .<<<<<<<<<1

PR:B!$-A '

Time CardH$nn- 0u!t !t*#t$, +#? *! * p#+@#*''$# +# Hu!t&n$d! H*)* K+#?! +p. S $ &! p*&, ^1< *n +u#6 $ "$pt&+n!. S $ $*#n! *n $ t#* ^1. < *n +u# +# *n- p*#t + * ,*- $#$ ! $ +#?! '+#$ t *n +u#!6 *n$ t#* ^2. < *n +u# +# +u#! 5$-+n, 4< &n *n- +n$ $$?. A(!+6 ! $ $*#n! * 2 x 5+nu! +# +#?&n@ S*tu#,*- *n, Sun,*- *#$ "+'put$, 5*!$, +n t $ +u#! +#?$, t +!$ ,*-!a t $- *#$ n+t u!$, t+ "*("u(*t$ *n- 5+nu! +# +#?&n@ '+#$ t *n 4< +u#! &n * $$?.

Y+ud(( 5$ @&)$n t $ nu'5$# + +u#! H$nn- +#?$, $*" ,*- &n * $$? Sun,*-6 M+n,*-6 6 S*tu#,*-%-+u n$$, t+ "+'put$ $# !*(*#- +# t $ $$?. T $ &nput &(( 5$ p+!&t&)$ &nt$@$#!6 ($!! t *n +# $ u*+utput 'u!t 5$ +#'*tt$, &t * ,+((*# !&@n *n, #+un,$, t+ t $ n$*#$!t p$nn-. F+# $ *'p($6 [^2\ *n,[^2.13::::\ *#$ #+n@ *n! $#!a t $ "+##$"t )$#!&+n! *#$ [ ̂ 2.<<\ *n, [^2.14\6 #$!p$"t&)$(-. T $#$ '* 5$ *n- $'5$,,$, !p*"$! &n -+u# *n! $#!. T $#$ &(( 5$ !$t! + ,*t*.

0ample .nput(

L&n$ 1 <6 6 6 6 1<6 :6 <L&n$ 2 46 <6 <6 <6 <6 :6 <

S*'p($ Output

Output 1 ^4<3.<<Output 2 ^12<.<<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 390/499

PROBLEMA 3

Mul!iplicación Ru"aEn $( !&@(+ p*!*,+ $n Ru!&*6 (+! "*'p$!&n+! !$ !$#)`*n ,$ un &n@$n&+!+ ' t+,+ ,$

'u(t&p(&"*"&7n p*#* $( u$ !7(+ n$"$!&t*5*n !*5$# $n"+nt#*# $( ,+5($ - (* '&t*, ,$ un n/'$"+'+ (* $($'$nt*( +p$#*"&7n ,$ !u'*#. C+n $!t$ !&!t$'* *5`* u$ +#'*# ,+! "+(u'n*!$n"*5$8*,*! p+# (*! "& #*! u$ !$ &5*n * 'u(t&p(&"*#.

E( ' t+,+ +p$#* $n (* !&@u&$nt$ +#'*

E0$'p(+ 'u(t&p(` u$!$ p+# 3

S$ !*"* !u"$!&)*'$nt$ (* '&t*, * (+! n/'$#+! !&tu*,+! $n (* "+(u'n* ,$ (* &8 u&$#,* !&t+'*# $n "u$nt* (+! #$!&,u+!%6 - $( ,+5($ * (+! ,$ (* "+(u'n* ,$#$" *. S$ "+nt&n/* $!t* +p$*!t* u$ (* "+(u'n* &8 u&$#,* !$ #$,u8"* * (* un&,*,.

; 34 ;

24 ; 1 :

12 ; 312

: ; :24

3 ; 124

1 ; 24 :

S$ t*" *n t+,*! (*! "& #*! p*#$! u$ &@u#$n $n (* "+(u'n* &8 u&$#,* - p+# "+n!&@"& #*! "+##$!p+n,&$nt$! $n (* "+(u'n* ,$#$" *.

; 3

4 ;

24

; 1 :

1

2

; 312

: ; :243 ; 1241 ; 24 :

F&n*('$nt$ !$ !u'*n (*! "& #*! u$ u$,*n $n (* "+(u'n* ,$#$" *. E( t+t*( ,$ (* !u'* $! $#$!u(t*,+. 3 124 24 :X3 3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 391/499

PROBLEMA 4

Her!ical 5i"!ogram

E!"#&5$ un p#+@#*'* u$ *"$pt$ ,`@&t+! <> % "+'+ Input. D$ "+'+ #$!u(t*,+ $( &)$#t&"*( #$p#$!$nt*t&)+ ,$ "*,* ,`@&t+. C*("u(* t*'5& n (* !u'* ,$ t+,+! (+! ,`@&t+!6 $( p

,* "+'+ #$!u(t*,+ (* (&!t* ,$ (+! n/'$#+! p+# ,$5*0+ ,$( p#+'$,&+ !&n #$p$t&# - (* (&!t* ,$ ( p+# ,$5*0+ ,$( p#+'$,&+ !&n #$p$t&# - (* (&!t* ,$ (+! n/'$#+! p+# $n"&'* ,$( p#+'$,&+ !&n

V$#& &"* tu p#+@#*'* "+n $!t$ !$t ,$ 13 ,`@&t+!.16 626 6:6 61636 6 6 6 6<

E0$'p(+ ,$ Input

Enter a Number : 12Enter 12 di its:1G!G2G9G6G!G1G3G!G5G!G9

E0$'p(+ ,$ Output

. .

. . .

... ... .

<1234 :

L* !u'* $! :4 E( p#+'$,&+ $! .3L+! n/'$#+! p+# ,$5*0+ !+n 16263L+! n/'$#+! p+# $n"&'* :6 6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 392/499

1234 : <1234 : <1234 : <1234 : <1234 : <1234 : <1234 : <1234 : <

1121123211234321123 43211234 : 43211234 : : 43211234 : : 43211234 : : 43211234 : : 43211234 : : 43211234 : 43211234 43211234321

123211211

XXXX En, + +utput ,*t*

P#+5($'*

V&#u! D$t$"t&+n

K $n $ *'&n&n@ * &($6 * "$#t*&n )&#u! !"*nn$# (++?! +#6 *'+n@ +t $# t &n@!6 +#, [)&#u!\ &n t $ &($. F+# $ *'p($6 t $ (&n$.

*512^)&#u!23

>>>>

*pp$*#&n@ &n !+'$ &($ +u(, 5$ '*#?$, *! !u!p$"t6 *! &t "+nt*&n! *n +""u##$n"$ +[)&#u!\. It &! !* $#6 + $)$#6 t+ *(!+ (++? +# *t *#$ "*(($, [!"*tt$#$, +""u##$n"$!\ + t $ !

[)&#u!\. F+# $ *'p($6 t $ (&n$.*(&#u!)2)#&&#"^u u!

> > > >

"+nt*&n! * [!"*tt$#$, +""u##$n"$\ + t $ !t#&n@ [)&#u!\6 &" &! &n,&"*t$, 5- t $ u" *#*"t$#!. N+t$ t *t $)$n &n * [!"*tt$#$, +""u##$n"$\ + t $ +#, t $ +#,$# + t $ ($tt$#! #$'*!*'$ *! &n t $ "+##$"t(- !p$(($, +#, [)&#u!\.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 393/499

Y+u# t*!? &n t+ #&t$ * p#+@#*' t *t #$*,! $*" (&n$ &n * t$ t &($ "*(($, TEST.DAT+utput! t $ (&n$ nu'5$# + $)$#- (&n$ + t$ t &" "+nt*&n! $&t $# * ,&#$"t +""u##$n"$ + t[)&#u!\6 +# * [!"*tt$#$, +""u##$n"$\ + t $ !t#&n@ [)&#u!\6 *! ,$!"#&5$, *5+)$. T $ &#!t ("+nt*&n! 0u!t t $ nu'5$# + (&n$! + t$ t t+ +((+ . T $ (&n$! + t$ t &n t $ &($ #+' (&n$ 2 ++n *#, *)$ [(&n$ nu'5$#!\ !t*#t&n@ *t 1.

XXXX S*'p($ &nput ,*t* #+' VIRUS1.DAT

4,! ,)& , ,# ))))&#u!23$4y 1))& ,!"#32uu2!!xx@ !,XXXXEn, + &nput ,*t*bSt*# + "+##$!p+n,&n@ +utput ,*t*XXXXXXXXXXXXXXXXXXXX

23XXXXEn, + +utput ,*t*

X

XXXXS*'p($ &nput ,*t* #+' VIRUS2.DATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX

:It&!)$#-&n)&@+#*t&n@t+#un*#+un,t $!?-!"#*p$#.T &! (&n$ ,+$! n+t "+nt*&n t $ )e&e#eue! !t#&n@. O# ,+$! &th% ex V y^y&e%e% R < ue%e%eS N+ &!t $t&'$ +#*(( *"?$#!*n,))))&&&###uuu!!! #&t$#!t+"$*!$*n,,$!&!tWF*0(")0&+#- $+p# *)?* -&$!,0)+$ 5@P&#+ut#@5! +@u+ @n?tn n!? ? ? ? ? 5 !??( $&?5'*, @&-$ t

XXXXEn, + &nput ,*t*bSt*#t + "+##$!p+n,&n@ +utput ,*t*XXXXXXXXXXXXXXXXXXXXX124XXXXEn, + +utput ,*t*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 394/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@ND

;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 395/499

=niversidad !nteramericana de Puerto >icou&nt*! O(&'p&*,*! ,$ P#+@#*'*"&7nINTERBAY 2<<4

CAT$9:R A0 #$ PR.NC.P.ANT$0

In!t#u""&+n$! @$n$#*($!

T+,+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+! -b+ "+n *#" &)+! $ t$#n+!. SV&!u*( Stu,&+ .N$t p*#* #$!+()$# (+! '&!'+!. D$5$n $nt#$@*#!$ $n ,&!"+ t*n p#+nt+ "+'+t$#'&n*,+.

PROBLEMA 1

&Ca" Regi"!er Applica!ion'U!$ t $ nu'$#&" ?$-p*, #+' t $ S$"u#&t- P*n$( *pp(&"*t&+n t+ 5u&(, * C*! R$@&

*pp(&"*t&+n. In *,,&"t&+n t+ nu'5$#!6 t $ "*! #$@&!t$# ! +u(, &n"(u,$ * ,$"&'*( p+&nt B#+' t &! nu'$#&" +p$#*t&+n6 t $#$ ! +u(, 5$ Ent$#6 D$($t$6 C($*# *n, T+t*( Butt+n!. S*(

5$ "*("u(*t$, +n t $ *'+unt pu#" *!$,. U!$ * S$($"t C*!$ !t*t$'$nt t+ "+'put$ !*($! t* . A,, t $t* *'+unt t+ t $ !u5t+t*( t+ "*("u(*t$ t $ t+t*(. D&!p(*- t $ t* *n, t+t*( +# t $ u!$#. U!$ t $+((+ &n@ !*($>t* p$#"$nt*@$!6 &" *#$ 5*!$, +n t $ *'+unt + '+n$- !p$nt

A'+unt un,$# ^1<<X x .< % !*($! t*A'+unt 5$t $$n ^1<< *n, ^ <<X . x .< % !*($! t*A'+unt *5+)$ ^ << X 1<x .1<% !*($! t*

D$ &n$ $)$nt *n,($#! +# t $ nu'$#&" Butt+n! *n, ,$"&'*( p+&nt &n t $ ?$-p*,. C#$**n,($#! +# $*" + t $!$ Butt+nd! C(&"? $)$nt!. J*)$ $*" $)$nt! *n,($# "+n"*t$n*t$ t $ p#+)*(u$ t+ t $ T$ tB+ *t t $ t+p + t $ F+#'.

D$ &n$ *n $)$nt *n,($# +# t $ Ent$# Butt+nd! C(&"? $)$nt C#$*t$ *n $)$nt *n,($# Butt+nd! C(&"? $)$nt. J*)$ t &! $)$nt *n,($# *,, t $ "u##$nt *'+unt t+ t $ !u5t+t*( *n, ,&!p(*n$ !u5t+t*(.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 396/499

D$ &n$ *n $)$nt *n,($# +# t $ T+t*( Butt+nd! C(&"? $)$nt C#$*t$ *n $)$nt *n,($# Butt+nd! C(&"? $)$nt. J*)$ t &! $)$nt *n,($# u!$ t $ !u5t+t*( t+ "+'put$ t $ t* *'+unt.

D$ &n$ *n $)$nt *n,($# +# t $ C($*# Butt+nd! C(&"? $)$nt C#$*t$ *n $)$nt *n,($# Butt+nd! C(&"? $)$nt. J*)$ t &! $)$nt *n,($# "($*t t $ u!$# &nput *n, ,&!p(*- *n, ,&!p(*- t $^<.<< +# t $ !u5t+t*(6 !*($! t* *n, t+t*(.

D$ &n$ *n $)$nt *n,($# +# t $ D$($t$ Butt+nd! C(&"? $)$nt C#$*t$ *n $)$nt *n,($#Butt+nd! C(&"? $)$nt. J*)$ t &! $)$nt *n,($# "($*# +n(- t $ ,*t* &n t $ T$ tB+ .

PROBLEMA 2

&Pre"en! Halue Calcula!or Applica!ion'A 5*n? *nt! t+ ! + &t! "u!t+'$#! + 'u" t $- +u(, n$$, t+ &n)$!t t+ *" &$)$ *

!p$"& &$, &n*n"&*( @+*( utu#$ )*(u$% &n 61<61<61 62<62 +# 3< -$*#!. U!$#! 'u!t p&n*n"&*( @+*( t $ *'+unt + '+n$- ,$!&#$, * t$# t $ !p$"& &$, nu'5$# + -$*#! *! $(*p!$,%&nt$#$!t #*t$ *n, t $ ($n@t + t $ &n)$!t'$nt &n -$*#!. C#$*t$ *n *pp(&"*t&+n t *t "*("u(*,&!p(*-! t $ p#&n"&p*( &n&t&*( *'+unt t+ &n)$!t% n$$,$, t+ *" &$)$ t $ u!$#d! &n*n"&**pp(&"*t&+n ! +u(, *((+ t $ u!$# t+ &n)$!t '+n$- +# 6 1<61 62<62 +# 3< -$*#!. F+# $ *'p"u!t+'$# *nt! t+ #$*" t $ &n*n"&*( @+*( + ^1 6<<< +)$# * p$#&+, + -$*#! $n t $ &nt$&! :.: x6 t $ "u!t+'$# +u(, n$$, t+ &n)$!t ^1<6 :. :.

A,,&n@ t $ nu'$#&"UpD+ n "+nt#+( P(*"$ *n, !&8$ t $ nu'$#&"UpD+ n !+ t *t & +(GUI D$!&@n Gu&,$(&n$!. S$t t $ nu'$#&"pD+ n "+nt#+(d! N*'$ p#+p$#t- t+ upY$*#. S$tnu'$#&"UpD+ n "+nt#+( t+ *((+ +n(- 'u(t&p($! + &)$ +# t $ nu'5$# + -$*#!. A(!+6*((+ tt+ !$($"t +n(- * ,u#*t&+n t *t &! &n t $ !p$"& &$, #*n@$ + )*(u$.

A,,&n@ * 'u(t&(&n$ T$ tB+ A,, * T$ tB+ t+ t $ F+#' 5$(+ t $ Nu'$#&"UpD+ n "+nt#C *n@$ t $ !&8$ t+ 2 26 *n, p+!&t&+n t $ T$ tB+ +n t $ B+ t+ ,&!p(*- 'u(t&p($ (&n$! *n)$#t&"*( !"#+((5*#. A(!+ $n!u#$ t *t t $ u!$# "*nn+t '+,& - t $ t$ t &n t $ T$ tB+ .

A,,&n@ * C(&"? $)$nt *n,($# *n, *,,&n@ "+,$ A,, * "(&"? $)$nt *n,($# +# t $ C*("uB+tt+n. On"$ &n "+,$ t+ t $ *pp(&"*t&+n !u" t *t6 $n t $ C*("u(*t$ Butt+n &! "(&"?$,6 tT$ tB+ ,&!p(*-! t $ n$"$!!*#- p#&n"&p*( +# $*" &)$>-$*# &nt$#)*( u!$ t $ +((+ &n@ )$ p#$!$nt>)*(u$ "*("u(*t&+n +#'u(*

PX*b 1 #%n

K $#$ p &! t $ *'+unt n$$,$, t+ *" &$)$ t $ utu#$ )*(u$r &! t $ *nnu*( &nt$#$!t #*t$ +# $ *'p($6 .< &! $ u&)*($nt t+ x%n &! t $ nu'5$# + -$*#!a &! t $ utu#$>)*(u$ *'+unt

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 397/499

PROBLEMA 3

&Arra%'

U!$ * +n$>,&'$n!&+n*( *##*- t+ !+()$ t $ +((+ &n@ p#+5($' A "+'p*n- p*-! &t! !*($+n * "+''&!!&+n 5*!&!. T $ !*($!p$+p($ #$"$&)$ ^2<< p$# $$?6 p(u! x + t $&# @#+!! !*

$$?. F+# $ *'p($6 * !*($!p$#!+n + @#+!!$! ^ <<< &n !*($! &n * $$? #$"$&)$! ^2<< p(u!^ <<<6 +# * t+t*( + ^: <. K#&t$ * p#+@#*' u!&n@ *n *##*- + "+unt$#!% t *t ,$t$#'&n$!t $ !*($!p$+p($ $*#n$, !*(*#&$! &n $*" + t $ +((+ &n@ #*n@$! *!!u'$ t *t $*" !*($!p$#!&! t#un"*t$, t+ *n &nt$@$# *'+unt%

^2<<>^2^3<<>^3^4<<>^4^ <<>^^:<<>^:^ <<>^^ <<>^^ <<>^^1<<< *n, +)$#

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 398/499

PROBLEMA 4

&Crea!e and Main!ain Telep one Direc!orie"'

K#&t$ * p#+@#*' t+ "#$*t$ *n, '*&nt*&n t$($p +n$ ,&#$"t+#&$!. E*" ,&#$"t+#- &

!$p*#*t$ !$ u$nt&*( &($. T $ +((+ &n@ 5utt+n! ! +u(, 5$ *)*&(*5($

S$($"t * ,&#$"t+#- t+ *""$!!. A (&!t + ,&#$"t+#&$! t *t *)$ 5$$n "#$*t$, ! +u(, 5$ !!$p*#*t$ !$ u$nt&*( &($. K $n * #$ u$!t &! '*,$ t+ +p$n * ,&#$"t+#-6 t $ (&!t + *)*&(*5($! +u(, 5$ ,&!p(*-$, *! p*#t + *n InputB+ p#+'pt #$ u$!t&n@ t $ n*'$ n+ (&!t$,6 t $ ,$!&#$ t"#$*t$ * n$ ,&#$"t+#- "#$*t$, *n, *,,$, t+ t $ (&!t + $ &!t&n@ ,&#$"t+#&$!.

A,, n*'$ *n, p +n$ nu'5$# *! @&)$n &n t $ t$ t 5+ $!% t+ t $ $n, + t $ "u##$nt ,&#$"tD$($t$ n*'$ *! @&)$n &n t $ t$ t 5+ % #+' t $ "u##$nt ,&#$"t+#-S+#t t $ "u##$nt ,&#$"t+#- &nt+ n*'$ +#,$#.P#&nt +ut t $ n*'$! *n, p +n$ nu'5$#! "+nt*&n$, &n t $ "u##$nt ,&#$"t+#-T$#'&n*t$ t $ p#+@#*'

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 399/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N9

23pertos

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 400/499

!nter?ay -ay &,J 'KK=

$5pert

Program &

6eig !ed #inar% Tree"

K *t +u(, *n ACSL A((>St*# C+nt$!t 5$ &t +ut * 5&n*#- !$*#" t#$$ p#+@#*'h Yup6 &t 0u!t +u(A((>St*# C+nt$!t6 !+ $#$ $ @+

In * 5&n*#- !$*#" t#$$6 t $ n+,$! t *t *#$ n$*# t $ t+p + t $ t#$$ *#$ *!t$# t+ &n, t *t t $ n+,$! *t tIt +u(, 5$ n&"$ t+ *)$ t $ n+,$! t *t &(( 5$ (++?$, +# #$ u$nt(- t+ *pp$*# *t t $ t+p + t $ t#$$.

T $ &nput &n t &! p#+@#*' &! * !t#&n@. I@n+#$ $)$#-t &n@ &n t $ !t#&n@ 5ut t $ ($tt$#! + t $upp$#"*!$ ($tt$#! t+ (+ $#"*!$ +# )&"$ )$#!*%a t $ n+,$! &n t $ t#$$ &(( 5$ ($tt$#!.

0tep &. Bu&(, * 5&n*#- !$*#" t#$$ #+' t $ &nput. I -+u $n"+unt$# * ($tt$# t *t &! *(#$*,- &n t $ t# 5u&(,&n@ t $ t#$$. D$($t$ #+' t $ &nput t $ p#$)&+u! +""u##$n"$ + t &! ,up(&"*t$ ($tt$#6 *n, " *!+ t $ ,up(&"*t$ ($tt$# 0u!t $n"+unt$#$, &! n+ &#!t &n t $ &nput. R$5u&(, t $ t#$$ #+' !"#*t" 6 !tn$ t t&'$ t *t * ,up(&"*t$ ($tt$# &! +un, &n t $ '+,& &$, &nput%6 #$*##*n@&n@ t $ &nput6 *n, !&nput &! [CENTER\6 -+ud, 5u&(, * t#$$ &t C E N T6 !t+p 5$"*u!$ t $#$d! * ,up(&"*t$ E6 #$*##* 5$ E C N T *n, "+nt&nu$ 5u&(,&n@ t $ t#$$. T $ ?$-! &n t $ &n*( t#$$ +u(, 5$ E C N T R6 &n t &

0tep '4 A t$# t $ t#$$ &! 5u&(t6 @+ t #+u@ t $ ($tt$#! &n t $ +#&@&n*( &nput !t#&n@ *n, !$*#"t#$$. K $n -+u &n, t $ n+,$6 #$"+#, &t! ,$pt . T $ !u' + t $ ,$pt ! + t $ n+,$! +# *(( t $ &nput &n p#+p+#t&+n*( t+ t $ t&'$ n$$,$, t+ !$*#" &n t $ t#$$.

F+# $ *'p($6 "+n!&,$# t $ &nput [J+u!t+n6 T$ *!\ A !t*n,*#, 5&n*#- !$*#" t#$$ &@n+#&n@ ,up(&t#$$ *t t $ ($ ta t $ $&@ t$, t#$$ t *t -+ud(( 5u&(, &n t $ p#+@#*' &! *t t $ #&@ t. T $ &n*( t&'$ t$&@ t$, t#$$ *! #$5u&(t *! $n &t p#+"$!!$, t $ &n*( S. At t *t p+&nt6 t $ ($tt$#! $#$ &n!$#t$, S T O J U N E ; A.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 401/499

T $ !t*n,*#, 5&n*#- !$*#" t#$$ ($ t% *! * processin# time + 2: < 1 2 3 4 1 2 4 1 3 2 3%6 $#$*! t $$&@ t$, )$#!&+n #&@ t% *! * processin# time + 21 2 1 2 < 1 1 3 1 3 3 4 <%.

0ample #ata 2 !$t! + ,*t*a t $ t$!t ,*t* *! 1< !$t! + ,*t*%

.nput :utputJ+u!t+n6 T$ *! 21

A'$#&"*n C+'put$#S"&$n"$ L$*@u$ ACSL% :

Program @eighted Binary Trees

.nput :utput

B&n*#- !$*#"t#$$!

34

F#$$,+' +!p$$"

2

D#. H-?$(( *n,M#. J-,$

4<

S*n F#*n"&!"+ 22

C*(& +#n&* 2<S*n F#*n"&!"+6

C*(& +#n&*4

t+ +' &t '*-"+n"$#n

3:

P#$!&,$ntK&((&*' C(&nt+n

4

V&"$ P#$!&,$ntA( G+#$

4<

; <

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 402/499

.nterBay

-ay &,J 'KK=

$5pert

Program '

TriangleG&)$n t #$$ (&n$! t *t &nt$#!$"t !u" t *t t $ &nt$#!$"t&+n p+&nt! +#' * t#&*n@($6 &n, t $ p$#&

T+ '*?$ t $ &nput $*!-6 $*" (&n$ &(( 5$ !p$"& &$, 5- t + p+&nt! #+' *'+n@ t $ +((+ &n@ 12 p+&

A <6<% B 263% C >26 %D >26 >4% E 16 >2% F 46 1%G >46 1% J >26 <% I <6 >:%H 36 >4% 6 % L 36<%

0ample #ata !$t! + ,*t*a t $ t$!t ,*t* *! 1< !$t! + ,*t*%

Input OutputDL6

GJ6 JF13. <

JD6EH6 FI

23. 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 403/499

Program 'J Triangle

.nput :utputAG6

GC6 CA13. <4

HL6 EH6EL

.: :

BC6L6 AE

22. <

JL6BJ6 LB

13.1:22

EH6 HL6EL

.: :

ID6 FH6BD

3 .3 421

JB6BL6 LJ

13.1:22

LE6 HE6 LH

.: :

BF6 IL6G

11. 2<1

AL6HL6 AH

12.<<<<<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 404/499

.nterBay

-ay &,J 'KK=

$5pert

Program =

Ano! er #alancing Ac!

U!u*((- $n -+u 5u&(, * 5&n*#- !$*#" t#$$6 -+u *,, $*" ?$- t+ t $ t#$$ *! t $ ?$- &! $n"+unt$#$, &n!t#$*'. F+# $ *'p($6 t $ 5&n*#- !$*#" t#$$ 5u&(t #+' t $ ($tt$#! A M E R I C A !t*#t&n@ &t t $ A&t t $ &n*( A (++?! *! +((+ !

I -+u ?n$ *(( + t $ ?$-! &n *,)*n"$6 -+u '&@ t " ++!$ t+ *,, t $' &n t $ +#,$# E A A C M I R t+ +#' * p$# $"t(- 5*(*n"$, t#$$. T $#$ *#$ +t $# +#,$#! t *t *(!+ -&$(, * 5*(*n"$, t#$$.% J+ $)$#6 ,$t$#'&nt+ &n!$#t t $ ?$-! #$ u&#$! t *t -+u !+#t t $ ?$-!6 * t&'$>"+n!u'&n@ p#+p+!&t&+n. T &! p#+5($' $'$t +, t *t ,+$!ndt &n)+()$ !+#t&n@.

In t &! p#+@#*'6 -+ud(( ?$$p * 2>" *#*"t$# (++?>* $*, 5u $#. T *t &!6 &n *,,&t&+n t+ ?n+ &n@*,,&n@6 -+u *(!+ *)$ *""$!! t+ t $ n$ t t + " *#*"t$#!. O t $ t #$$ " *#*"t$#!6 -+u ! +u(, &n!$#t t $ +n$. F+# $ *'p($6 &t t $ ($tt$#! A M E R I C A6 -+u !t*#t + (++?&n@ *t A M E6 *n, -+ud, &n!$##++t. N+ 6 -+u *)$ A *n, M &n -+u# 5u $#6 *n, -+u !"*n t $ R. O t $!$ t #$$ ($tt$#!6 -+ud, *!! t $ Y+ud, *,, t $ I *n, t $n t $ C. F&n*((-6 $n -+u !"*n t $ &n*( A6 -+u *)$ A *n, R *(#$*,- &n t $ "*"Y+u &n!$#t *n A t $ '$,&*n ($tt$#%6 *n, t $n -+u *#$ ($ t &t A *n, R. In!$#t t $ !'*(($# + t $ t + &&n*( t#$$ (++?! *! +((+ !

In t &! p#+5($'6 -+u n$$, t+ "+'p*#$ t $ ! *p$ + * !t*n,*#, 5&n*#- !$*#" t#$$ &t +n$ 5u&(t u!&n@" *#*"t$# (++?>* $*, 5u $#. T $ &nput &(( 5$ 1< !$t! + ,*t*. E*" !$t &(( "+n!&!t + * !t#&n@ S.S6 &@n+#$ $)$#-t &n@ 5ut t $ ($tt$#! + t $ *(p *5$ta upp$#"*!$ *n, (+ $#"*!$ *#$ t $ !*'$. F+# $*

I

I

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 405/499

#$p+#t + 'u" t $ &nt$#n*( p*t ($n@t ,$"#$*!$! u!&n@ * 2>" *#*"t$# (++?>* $*, 5u $#. I t $ &n($n@t &n"#$*!$!6 -+ud(( #$p+#t * n$@*t&)$ nu'5$#.% F+# $ *'p($6 AMERICA *! *n &nt$#n*( pu!&n@ * "+n)$nt&+n*( 5&n*#- !$*#" t#$$a &t t $ 5u $#6 t $ p*t ($n@t ,$"#$*!$! 5- 1 t+ 11.

0ample .nput(L&n$ 1 A'$#&"*L&n$ 2 N+#t C*#+(&n*

0ample :utput(Output 1 1Output 2 >4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 406/499

.nterBay

-ay &,J 'KK=

$5pert

Program +

ACS$1ip

In +#,$# +# * 5u!&n$!! t+ @$t t $ 5$!t p#&"$ #+' t $ Un&t$, St*t$! P+!t*( S$#)&"$6 t $ 5u!&n$!! 'u'*&( t+ t $ p+!t + &"$ &n p#$>!+#t$, 5un,($!. T $ 5un,($! 'u!t 5$ +#'$, *""+#,&n@ t+ t $ +((+ &n@&n t $ +((+ &n@ +#,$#

1. Bun,($ 1< +# '+#$ p&$"$! + '*&( &t t $ !*'$ ,&@&t 8&p "+,$ *n, p(*"$ * [D\ !t&"?$# + p&$"$.

2. Bun,($ 1< +# '+#$ p&$"$! &t t $ !*'$ &#!t 3 ,&@&t! + t $&# 8&p "+,$ *n, p(*"$ * [3\ !tt+p p&$"$.

3. Bun,($ 1< +# '+#$ p&$"$! t+ t $ !*'$ A#$* D&!t#&5ut&+n C$nt$# ADC% *n, p(*"$ *n [t $ t+p p&$"$. An ADC &! * *- t+ @#+up t+@$t $# )*#&+u! 8&p "+,$!. T $ +((+ &n@ ADC t *t &! u!$, +# 8&p "+,$! +!$ &#!t 3 ,&@&t! 5$@&n *! &n,&"*t$,. F+# $ *'p($6 [<2 \ &! u!$, +# 8&p "+,$! t *t 5$@&n <2<6 <236 <246 <2 6 6 <2 .

4. 1< <<46 1< >1<. 11 << 6 11 6 11 >11:. 1<: <<:><<. 11< <1<><1. <21 <1 6 <1 6 <216 <226 <. <2 <2<6 <23><21<. Bun,($ t $ #$'*&n&n@ p&$"$! *n, p(*"$ *n [MS\ !t&"?$# +n t $ t+p p&$"$.11. N+ 5un,($ '*- *)$ '+#$ t *n 12 p&$"$! + '*&( &n &t.

T $#$ &(( 5$ t$n !$t! + ,*t*. E*" !$t "+n!&!t! + * p+!&t&)$ &nt$@$# N +((+ $, 5- N p*&#! + nut $ nu'5$# + p&$"$! @+&n@ t+ $*" 8&p "+,$. F+# $ *'p($6 t $ &#!t (&n$ 5$(+ *! p&$"$! + '*&*n, : p&$"$! + '*&( +# <1 4 . F+# $*" !$t + ,*t*6 p#&nt t $ nu'5$# + ,& $#$nt t-p$! + 5un,($! DMS% t *t -+u *)$ &t (*5$(!. Y+u 'u!t n+t (&!t *n- 5un,($>t-p$! t *t *#$ 8$#+.

0ample .nput(L&n$ 1 26 6 <2 1<6 :6 <1 4L&n$ 2 6 6 <2 1<6 1:6 <2 2<6 26 <1 246 :6 <1 34

6 <1 4 6 6 <1 3 6 6 <22446 1 6 <2 3:

0ample :utput(Output 1 MSX1Output DX2 3X1 AX1 MSX1

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 407/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N9

;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 408/499

.nterBay

-ay &,J 'KK=

BeginnersProgam &

CO0NTC5ARS

T &! p#+5($' #$ u&#$! -+u t+ p$# +#' !+'$ *n*(-!&! +n * &($ + t$ t. M+#$ !p$"& &"*((-6 &t #$ u&*t $*" (&n$ + t $ &($ *n, #$p+#t +n + '*n- upp$#>"*!$ ($tt$#!6 (+ $#>"*!$ ($tt$#!6 *n, n+n>($tt$"+nt*&n!.

T $ &nput &($ &(( "+nt*&n *t ($*!t +n$ (&n$ + t$ t6 5ut -+u ,+ n+t ?n+ + '*n- (&n$!. L&n$! '*- ($n@t 6 up t+ * '* &'u' + < " *#*"t$#!6 *n, t $#$ '*- 5$ 5(*n? (&n$!. N+t$ t *t t $ p#$)&+u! t + !t*t$&'p(- t *t * &($ '*- "+nt*&n 0u!t * !&n@($ 5(*n? (&n$.

Y+u# p#+@#*' 'u!t #$*, t $ (&n$! + t$ t &n t $ &nput &($ *n, 'u!t p#+,u"$ +n$ +utput (&n$ +# $*"&n t $ &($. E*" !u" (&n$ + +utput 'u!t *)$ t $ +((+ &n@ +#'

L&n$h "+nt*&n!h "*p&t*( ($tt$#!6h (+ $#>"*!$ ($tt$#!6 *n,h n+n>($tt$#!.

In &" t $ &#!t u$!t&+n '*#? h% #$p#$!$nt! t $ (&n$ nu'5$#6 t $ !$"+n, *n, t &#, u$!t&+n '*#?! #t $ nu'5$# + upp$#>"*!$ "*p&t*(% ($tt$#! *n, (+ $#>"*!$ !'*((% ($tt$#!6 #$!p$"t&)$(-6 *n, t $ &n'*#? #$p#$!$nt! t $ nu'5$# + n+n>($tt$# " *#*"t$#!. T $ $n,>+ >(&n$ " *#*"t$# &! &t!$( n+t "+unt

N+t$ "*#$ u((- t $ +#'*t + $*" +utput (&n$ It 'u!t 5$ * "+'p($t$ !$nt$n"$6 t$#'&n*t$, 5- * p$#&+,6nu'$#&"*( )*(u$ &! p#$"$,$, *n, +((+ $, 5- * !&n@($ !p*"$.

N+t$ &n t $ !*'p($ &nput ,*t* &($! &" +((+ t *t t $#$ *#$ n+ 5(*n? !p*"$! * t$# t $ (*!t )&!&5($ "$*" (&n$.

XXS*'p($ &nput ,*t* "+nt*&n$, &n COUNTCJARS1.DATXXT &! &! VERY GOOD TIME6 5$(&$)$ &t +#6 n+t t+ 5$ UITE CAREFUL.I -+u *#$ n+t6 $((6 t &n@! "*n @+ KRONGWW N+t +n(- t *t6 BUT6 &t &(( t*?$ -+u t&'$ t+ '*?$ t $' #&@ t W %XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX+utput +# &nput ,*t* #+' COUNTCJARS1.DATXL&n$ 1 "+nt*&n! 2 "*p&t*( ($tt$#!6 23 (+ $#>"*!$ ($tt$#!6 *n, 1 n+n>($tt$#!.L&n$ 2 "+nt*&n! : "*p&t*( ($tt$#!6 2 (+ $#>"*!$ ($tt$#!6 *n, 12 n+n>($tt$#!.L&n$ 3 "+nt*&n! < "*p&t*( ($tt$#!6 < (+ $#>"*!$ ($tt$#!6 *n, < n+n>($tt$#!.L&n$ 4 "+nt*&n! 4 "*p&t*( ($tt$#!6 42 (+ $#>"*!$ ($tt$#!6 *n, 23 n+n>($tt$#!.XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX,*t* "+nt*&n$, &n COUNTCJARS2.DATXXA*B5C"D,E$F G@J I&H0 ?L(M'NnO+Pp R#S!TtUuV)K ; Y- 81234 : <gWy ^x e %l> Xjcm Q \adfZh6.b ,+ SEEM 5$ ALL + t +!$ pun"tu*t&+n " *#*"t$#!.T $#$ +n"$ *! * '*n #+' P$#uK + ,#$*'t $ *! $*t&n@ &! ! +$WJ$ * +?$ &n t $ n&@ t

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 409/499

K&t * t$##&5($ #&@ tAn, +u@ t &t *! p$# $"t(- t#u$WW

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX+utput +# &nput ,*t* #+' COUNTCJARS2.DATL&n$ 1 "+nt*&n! 2: "*p&t*( ($tt$#!6 2: (+ $#>"*!$ ($tt$#!6 *n, 1< n+n>($tt$#!.L&n$ 2 "+nt*&n! "*p&t*( ($tt$#!6 32 (+ $#>"*!$ ($tt$#!6 *n, 41 n+n>($tt$#!.L&n$3 "+nt*&n! 2 "*p&t*( ($tt$#!6 22 (+ $#>"*!$ ($tt$#!6 *n, 1< n+n>($tt$#!.L&n$ 4 "+nt*&n! 1 "*p&t*( ($tt$#6 2: (+ $#>"*!$ ($tt$#!6 *n, n+n>($tt$#!.L&n$ "+nt*&n! 1 "*p&t*( ($tt$#6 1: (+ $#>"*!$ ($tt$#!6 *n, 4 n+n>($tt$#!.L&n$ : "+nt*&n! 1 "*p&t*( ($tt$#6 1 (+ $#>"*!$ ($tt$#!6 *n, 3 n+n>($tt$#!.L&n$ "+nt*&n! 1 "*p&t*( ($tt$#6 2 (+ $#>"*!$ ($tt$#!6 *n, n+n>($tt$#!.L&n$ "+nt*&n! < "*p&t*( ($tt$#6 < (+ $#>"*!$ ($tt$#6 *n, < n+n>($tt$#!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 410/499

.nterBay

-ay &,J 'KK=

BegginersProgram '

Decoding an Encoded Te9!file

T &! p#+5($' #$ u&#$! -+u t+ ,$"+,$ *n $n"+,$, &($ + t$ t *n, ,&!p(*- t $ #$!u(t &.$.6 t $ [p(*&n t$!"#$$n.

F&#!t6 +# !&'p(&"&t-6 -+u '*- *!!u'$ t *t t $ +n(- " *#*"t$#! &n *n- +#&@&n*( p(*&n t$ t &($ $#t $ 5(*n? !p*"$ " *#*"t$#6 *n, t $ $n,>+ >(&n$ " *#*"t$# *(!+ "*(($, t $ [n$ (&n$ " *#*"t$#\6 +# t $ " *#*"t$#\% &" &n,&"*t$! $#$ t $ (&n$ 5#$*?! *#$ (+"*t$,.

K$ ! *(( ,$!"#&5$ + *n- &nput &($ +# -+u# p#+@#*'6 &" 'u!t 5$ "*(($, TEST.DAT6 *! $n"+,$,. $ ! *(( ,$!"#&5$ + t $ +#&@&n*( p(*&n t$ t &($ *! t#*n! +#'$, &nt+ t $ $n"+,$, t$ t &($ t *t -+u# 'u!t n+ ,$"+,$.

F&#!t + *((6 t+ $n"+,$ * &($6 *(( " *#*"t$#! &n &t *#$ #$*, +n$ *t * t&'$. I t $ " *#*"t$# &! +n$ A6 B6 6 t $n &t &! $n"+,$, 5- #&t&n@ +ut t $ t + ,&@&t " *#*"t$#! @&)&n@ &t! nu'$#&"*( p+*(p *5$t <1 +# A6 <2 +# B6 2: +# %. I &t &! *n $n,>+ >(&n$ " *#*"t$# &t &! $n"+,$, *! 2 *n,!p*"$ &t &! $n"+,$, *! 2 .

A(!+6 *! t $!$ ,&@&t! *#$ #&tt$n +ut t+ t $ +utput &($6 *! !++n *! 4< ,&@&t! "+##$!p+n,&n@ t" *#*"t$#!% *)$ 5$$n #&tt$n +ut6 * n$ (&n$ + +utput &! !t*#t$,. T u! $)$#- (&n$ &n *n $n"+,$, u!u*((-% t $ (*!t "+nt*&n! $ *"t(- 4< ,&@&t " *#*"t$#!.

On"$ ,$"+,$,6 t $ p(*&n t$ t 'u!t 5$ ,&!p(*-$, +n t $ !"#$$n &t (&n$ 5#$*?! &n t $ p#+p$# p(*"$!6 *t $ !*'p($ +utput 5$(+ .

XX S*'p($ &nput ,*t* #+' DECODE1.DAT XX2<< < 1 2 < 1 2 2<< < 2 1 212<1:212<2 <:1 1 132 <1142 < 14<31 <4< <42 2<< 1 2<2<:< 12< 2 < 2<2 <31 142<<1< 141 2 1 < 22< 1 <1122 12< 14< 1 2 1 <:2 2<< 242<2 21 212 <3<1142 2<< < 14112 1 <:2 < <1<3<2 12< 14< 2 <11 2 <12 1 < 142<< 14<3< 2< 22< 142 2<< 1 21< < 2 < 2<2 < <11 2 14

1 2 1:2114<32<21<12<< 1 142 1 1 2 2 1 212 <3<1142 2<< < 14112 23< <12<< 22< 1 2< 121 < 2 2 1 212 12< 11< 2 2<< < 1 2 <1 2 2<< < 2 12<11 2<2 12< 14< 2

XX En, + &nput ,*t*bSt*#t + "+##$!p+n,&n@ +utput ,*t* XXTJIS IS TJE OUTPUT FROM AN ENCODED TEST FILE IT CONTAINS SEVERAL LINES OF TEYOU CAN TJIN OF EACJ LINE AS A SENTENCE EVEN TJOUGJ IT JAS NO PUNCTUATON OYOU CAN TJIN KJATEVER ELSE YOU LI E TJIS IS TJE LAST LINEXXXX En, + +utput ,*t* XXX

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 411/499

XXXX S*'p($ &nput ,*t* #+' DECODE2.DATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX2 2 2 2 2 2<< < 1 < 2 2<231 2 12< 14< 12 <:1 12121 232 <12 <:< 1 1 2<2 <212<114112 12< 14< 2 2 2 2 2 <114<42 <11 < 2 <<1<3< 2 < 14<4< 142<< <42 <22 2 <:1 2112 1 1:<1<3< 1 2XXXX En, + &nput ,*t*bSt*#t + "+##$!p+n,&n@ +utput ,*t*XXXXXXXXXXXXXXXXXXXXXX

TJESE TKO LINES FOLLOK A FIRST BLAN LINE AND ARE EACJ INDENTED BY FOUR SPAXXXX En, + +utput ,*t* XXXX

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 412/499

.nterBay-ay &,J 'KK=

BeginnersProgram =

Hiru" De!ec!ion

K $n $ *'&n&n@ * &($6 * "$#t*&n )&#u! !"*nn$# (++?! +#6 *'+n@ +t $# t &n@!6 +""u##$n"$! +t $ &($. F+# $ *'p($6 t $ (&n$

*512^)&#u!23

*pp$*#&n@ &n !+'$ &($ +u(, 5$ '*#?$, *! !u!p$"t6 *! &t "+nt*&n! *n +""u##$n"$ + t $ !t#&n@ [+ $)$#6 t+ *(!+ (++? +# *t *#$ "*(($, [!"*tt$#$, +""u##$n"$!\ + t $ !t#&n@ [)&#u!\. F+# $ *'p($6

"+nt*&n! * [!"*tt$#$, +""u##$n"$\ + t $ !t#&n@ [)&#u!\6 &" &! &n,&"*t$, 5- t $ un,$#(&n$ " *#$)$n &n * [!"*tt$#$, +""u##$n"$\ + t $ +#, t $ +#,$# + t $ ($tt$#! #$'*&n! t $ !*'$ *! &n t $ "+##$"t(+#, [)&#u!\.

Y+u# t*!? &! t+ #&t$ * p#+@#*' t *t #$*,! $*" (&n$ &n * t$ t &($ "*(($, TEST.DAT6 *n, +utput! t+ $)$#- (&n$ + t$ t &" "+nt*&n! $&t $# * ,&#$"t +""u##$n"$ + t $ !t#&n@ [)&#u!\6 +# * [!"*tt$+ t $ !t#&n@ [)&#u!\6 *! ,$!"#&5$, *5+)$. T $ &#!t (&n$ + t $ &($ "+nt*&n! 0u!t t $ nu'5$# + (&+((+ . T $ (&n$! + t$ t &n t $ &($ #+' (&n$ 2 + t $ &($ +n *#, *)$ [(&n$ nu'5$#!\ !t*#t&n@ *t 1

XXXXS*'p($ &nput ,*t* #+' VIRUS1.DAT4,! ,)& , ,# ))))&#u!23$4y 1))& ,!"#32uu2!!xx@ !,

XXXXEn, + &nput ,*t*bSt*#t + "+##$!p+n,&n@ +utput ,*t*XXXX'=XXXXEn, + +utput ,*t*XXXX

XXXXS*'p($ &nput ,*t* #+' VIRUS2.DATXXXX:&t&!)$#-&n)&@+#*t&n@t+#un*#+un,t $!?-!"#*p$#.T &! (&n$ ,+$! n+t "+nt*&n t $ )e&e#eue! !t#&n@. O# ,+$! &th% ex V y^yze%e% R < ue%e%eS N+ &!t $t&'$ +#*(( *"?$#!*n,))))&&&###uuu!!! #&t$#!t+"$*!$*n,,$!&!TWF*0(")0&+#- $+p# *)?* -&$!,0)+$ 5@P&#+ut#@5! +@u+ @n?tn n!? ? ? ? ? 5 !???( $&?5'*, @&-$ tXXXXEn, + &nput ,*t*bSt*#t + "+##$!p+n,&n@ +utput ,*t*XXXX&'+XXXXEn, + +utput ,*t*XXXX

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 413/499

.nterBay

-ay &,J 'KK=

BeginnersProgram +

Number Proper!ie"

A p+!&t&)$ &nt$@$# &! "+n!&,$#$, p#&'$ & &t &! $)$n(- ,&)&!&5($ +n(- 5- &t!$( *n, 1. A(!+6&t!$( * p#&'$. T u!6 t $ !$ u$n"$ + p#&'$! 5$@&n 26 36 6 61161361 6

A p+!&t&)$ &nt$@$# &! "*(($, p$# $"t & &t &! t $ !u' + &t! p#+p$# ,&)&!+#. F+# $ *'p($6 2 &! 5$"*u!$ 2 X 1 2 4 14.

Y+u# *!!&@n'$nt &! t+ #&t$ * p#+@#*' t *t &(( &nput * !$ u$n"$ + &nt$@$#!6 +n$ p$# (&n$6 * p#+p$#t&$! + $*" &nt$@$# &n t $ +((+ &n@ +#'*t

I t $ nu'5$# &! n$&t $# p#&'$ n+# p$# $"t6 +utput [Du((\.I t $ nu'5$# &! p#&'$ 5ut n+t p$# $"t6 +utput [P#&'$\.I t $ nu'5$# &! p$# $"t 5ut n+t p#&'$6 +utput [P$# $"t\.I t $ nu'5$# &! 5+t p#&'$ *n, p$# $"t6 +utput [T &! p#+@#*' ,+$!ndt +#?\.A(( &nput &(( 5$ p+!&t&)$ &nt$@$#!. T $ $n, + &nput &(( 5$ '*#?$, 5- t $ nu'5$# < n+ +utput !@$n$#*t$, +# <%.

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXE *'p($XXXX.nputXXXX2

14<1

<XXXX:utput XXXX

Per*e+t Prime ,ull ,ull Prime

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 414/499

.nterBay

-ay &,J 'KK=

BeginnersProgram

Time Card

H$nn- 0u!t !t*#t$, +#? *! * p#+@#*''$# +# Hu!t&n$d! H*)* K+#?! +p. S $ &! p*&, ^1< *n +u#6 $ "$pt&+n!. S $ $*#n! *n $ t#* ^1. < *n +u# +# *n- p*#t + * ,*- $#$ ! $ +#?! '+#$ t *t +u#6 *n, $ t#* ^2. < *n +u# +# +u# 5$-+n, 4< &n *n- +n$ $$?. A(!+6 ! $ $*#n! * 2 x 5+nu! +# +#?&n@ +*n, * <x 5+nu! +# +#?&n@ +n Sun,*-. T $ 5+nu!$! +# S*tu#,*- *n, Sun,*- *#$ "+'put$, 5*!$, +n t+u#! +#?$, t +!$ ,*-!a t $- *#$ n+t u!$, t+ "*("u(*t$ *n- 5+nu! +# +#?&n@ '+#$ t *n 4< +u#! &n *

Y+ud(( 5$ @&)$n t $ nu'5$# + +u#! H$nn- +#?$, $*" ,*- &n * $$? Sun,*-6 M+n,*-6 6 S*tu#,*-%-+u n$$, t+ "+'put$ $# !*(*#- +# t $ $$?. T $ &nput &(( 5$ p+!&t&)$ &nt$@$#!6 ($!! t *n +# $ u*+utput 'u!t 5$ +#'*tt$, &t * ,+((*# !&@n *n, #+un,$, t t $ n$*#$!t p$nn-. F+# $ *'p($6 [^2\ *n,[^2.13::::\ *#$ #+n@ *n! $#!a t $ "+##$"t )$#!&+n! *#$ [2.<<\ *n, [^2.14\6 #$!p$"t&)$(-. T $#$ '*- *n- $'5$,,$, !p*"$! &n -+u# *n! $#!. T $#$ &(( 5$ !$t! + ,*t*.

XXXX0ample .nput(XXXX

L&n$ 1 <6 6 6 6 1<6 :6 <L&n$ 2 46 <6 <6 <6 <6 :6 <XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX

0ample :utput(

:utput &( f+K=4KK:utput '( f&'K4KK

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 415/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

23pertos

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 416/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+R$"&nt+ ,$ B*-*'7n

T$#"$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n !N" R $% &''&

CATEGORrA DE E;PERTO

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$"+'+ (+ *-*! t$#'&n*,+.

PROBLEMA 1

Mul!iplicación Ru"a

En $( !&@(+ p*!*,+ $n Ru!&*6 (+! "*'p$!&n+! !$ !$#)`*n ,$ un &n@$n&+!+ ' t+,+ ,$ 'u(t&p(&"*"&!7(+ n$"$!&t*5*n !*5$# $n"+nt#*# $( ,+5($ - (* '&t*, ,$ un n/'$#+6 *!` "+'+ (* $($'$nt*( +p$#*"&7n C+n $!t$ !&!t$'* *5`* u$ +#'*# ,+! "+(u'n*! $n"*5$8*,*! p+# (*! "& #*! u$ !$ &5*n * 'u(t&p(&"*#

E( ' t+,+ +p$#* $n (* !&@u&$nt$ +#'*

E0$'p(+ Mu(t&p(` u$!$ p+# 3

*% S$ !*"* !u"$!&)*'$nt$ (* '&t*, * (+! n/'$#+! !&tu*,+! $n (* "+(u'n* ,$ (* &8 u&$#,* !&n t+"u$nt* (+! #$!&,u+!%6 - $( ,+5($ * (+! ,$ (* "+(u'n* ,$#$" *. S$ "+nt&n/* $!t* +p$#*"&7n *"+(u'n* &8 u&$#,* !$ #$,u8"* * (* un&,*,.

3424 1 :12 312: :243 1241 24 :

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 417/499

5% S$ t*" *n t+,*! (*! "& #*! p*#$! u$ &@u#$n $n (* "+(u'n* &8 u&$#,* - p+# "+n!&@u&$n"+##$!p+n,&$nt$! $n (* "+(u'n* ,$#$" *.

; 3

4 ;2

4; 1

:1

2; 3

12: ; :

243 ; 1

24

1 ; 24 :

"% F&n*('$nt$ !$ !u'*n (*! "& #*! u$ u$,*n $n (* "+(u'n* ,$#$" *. E( t+t*( ,$ (* !u'* $! $( #$!u

3 124 24 : X 3 3

Problema(

D$!*##+(($ un p#+@#*'* u$ !+(&"&t$ *( u!u*#&+ - 'u(t&p(& u$ ,+! "& #*! n+ '$n+#$! ,$ 2 ,`@&t+. E( p#+@#*'* t&$n$ u$ $ $"tu*# (+! '&!'+! p*!+! '$n"&+n*,+! *nt$#&+#'$nt$ p*#* p+,$# (($@*#

$%emplo de .nput(

In,& u$ $( p#&'$# ,`@&t+VIn,& u$ $( !$@un,+ ,`@&t+=V

$%emplo de :utput(

34 f>S$ $(&'&n*24 1 : f>S$ $(&'&n*12 312 f>S$ $(&'&n*: :24 f> S$ $(&'&n*3 1241 24 :

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 418/499

3 124 24 :

RESULTADOX 3 3

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 419/499

PROBLEMA 2

Her!ical 5i"!ogram

E!"#&5$ un p#+@#*'* u$ *"$pt$ ,`@&t+! <> % "+'+ Input. D$ "+'+ #$!u(t*,+ $( &)$#t&"*( #$p#$!$nt*t&)+ ,$ "*,* ,`@&t+. C*("u(* t*'5& n (* !u'* ,$ t+,+! (+! ,`@&t+!6 $( p

,* "+'+ #$!u(t*,+ (* (&!t* ,$ (+! n/'$#+! p+# ,$5*0+ ,$( p#+'$,&+ !&n #$p$t&# - (* (&!t* ,$ ( p+# ,$5*0+ ,$( p#+'$,&+ !&n #$p$t&# - (* (&!t* ,$ (+! n/'$#+! p+# $n"&'* ,$( p#+'$,&+ !&n

V$#& &"* tu p#+@#*'* "+n $!t$ !$t ,$ 13 ,`@&t+!.16 626 6:6 61636 6 6 6 6<

E0$'p(+ ,$ Input

Ent$# * Nu'5$# 12Ent$# 12 ,&@&t!16 626 6:6 61636 6 6 6

E0$'p(+ ,$ Output

ee

e e eeee eee e<1234 :

L* !u'* $! :4 E( p#+'$,&+ $! .3L+! n/'$#+! p+# ,$5*0+ !+n 16263L+! n/'$#+! p+# $n"&'* :6 6

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 420/499

PROBLEMA 3

K#&t$ * p#+@#*' t+ #$*, &n t + 2>,&'$n!&+n*( *##*-!6 *n, t $n 'u(t&p(- +n$ 5- t $ +T &! "*(($, '*t#& 'u(t&p(&"*t&+n. F+# $ *'p($6 & &#!t A##*- 2>#+ 5- 2>"+(u'n *##*-%

3

*n, !$"+n,A##*- 2>#+ 5- 1>"+(u'n *##*-% *pp$*#! *!

:

t $n t $ p#+,u"t '*t#& &!

p#+,u"tM*t#& Q< Q< X 2 e e : p#+,u"tM*t#& Q1 Q< X e 3 e :

M*t#& 'u(t&p(&"*t&+n "*n 5$ ,+n$ +n(- & t $ nu'5$# + "+(u'n! &n t $ 'u(t&p(&"*n, t $ &#!t *##*nu'5$# + #+ ! &n t $ 'u(t&p(&$# t $ !$"+n, *##*-%.

T $ p#+@#*' ! +u(, #$*, &n t $ t + *##*-!6 t$!t t+ !$$ + 'u(t&p(&"*t&+n &! p+!!&5($6 *n, t $n 'u(t&&!. T $ +utput &(( 5$ * p#&nt+ut + t $ t + *##*-! *n, &(( $&t $# +utput t $ p#+,u"t *##*- +# p#&n!*-&n@ t *t 'u(t&p(&"*t&+n &n n+ p+!!&5($.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 421/499

PROBLEMA 4

K#&t$ *n &nt$#*"t&)$ p#+@#*' t *t p(*-! t&">t*">t+$. R$p#$!$nt t $ 5+*#, *! * t #$$>5->t #$$ " *In&t&*(&8$ t $ *##*- t+ 5(*n?! *n, $*" p(*-$# &n tu#n t+ &nput * p+!&t&+n. T $ &#!t p(*-$#d! p'*#?$t +n t $ 5+*#, &t * <6 *n, t $ !$"+n, p(*-$#d! p+!&t&+n &(( 5$ '*#?$t &t *n ;. C+nt&nu$ t $unt&( * p(*-$# &n! +# t $ @*'$ &! * ,#* . T+ &n6 * p(*-$# 'u!t *)$ t #$$ '*#?! &n * #+ 6 &n * "+(* ,&*@+n*(. A ,#* +""u#! $n t $ 5+*#, &! u(( *n, n+ +n$ *! +n.

E*" p(*-$#d! p+!&t&+n ! +u(, 5$ &nput *! &n,&"$! &nt+ t $ t&">t*">t+$ 5+*#, t *t &!6 * #+ nu'5$* "+(u'n nu'5$#. M*?$ t $ p#+@#*' u!$#> #&$n,(-.

A t$# $*" @*'$6 p#&nt +ut * ,&*@#*' + t $ 5+*#, ! + &n@ t $ $n,&n@ p+!&t&+n. $$p * "+unt +@*'$! $*" p(*-$# *! +n *n, t $ nu'5$# + ,#* !. B$ +#$ t $ 5$@&nn&n@ + $*" @*'$6 *!? $*" p(*$ +# ! $ &! $! t+ "+nt&nu$. I $&t $# p(*-$# &! $! t+ u&t6 p#&nt +ut t $ !t*t&!t&" *n, !t+p.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 422/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

Intermedios

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 423/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+R$"&nt+ B*-*'7n

P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n !N" R $% &''&

CAT$9:R A0 #$ .NT$R-$#.:0

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$# (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$ $*-*! t$#'&n*,+.

PROBLEMA 1

T e In be!Keen Sum

Problema(

Y+u *#$ @&)$n t + nu'5$#!6 A *n, B6 *n, -+u *)$ t+ &n, t $ t+t*( + *(( t $ nu'5$#! 5$t $$n t $!$ t +nu'5$#!. F+# $ *'p($ & -+u *#$ @&)$n t $ nu'5$#! 6 *n, 1 6 -+u 1 6 -+u 'u!t &n, t $ !u'1< 11 12 13 14 &" &! :<.

$%emplo de .nput(

T $ &nput &! t $ p*&# + &nt$#@$#!6 A *n, $ 1 fXA fXB fX 3<<<<%.

$%emplo de :utput(

T $ +utput &(( 5$ t $ !u' + *(( t $ nu'5$#! 5$t $$n A *n, B.

$5ample &

.nput 1:utput:<

$5ample '

.nput1< 2<:utput13

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 424/499

PROBLEMA 2

U!*n,+ un* t*5(* !$n"&((* un *##$@(+ ,$ +#,$n 1% #$!u$()* $( !&@u&$nt$ p#+5($'*. Un* "+'p*9)$n,$,+#$! #$"&5$n ^2<< !$'*n*('$nt$ '_! $( x ,$ (*! )$nt*! ,$ $!* !$'*n*. P+# $0$'p(+6 un )$n,$,+#u$ )$n,* ^ <<<6 #$"&5$ ^2<< '_! $( x ,$ ^ 6<<<6 7 ^: <.

U!*n,+ un *##$@(+ ,$ "+nt*,+#$!6 ,$t$#'&n$ "u_nt+! )$n,$,+#$! #$"&5&$#+n un !*(*#&+ $n "*,* !&@u&$nt$! $!"*(*!

*. ^2<<>2 >2 . ̂ <<> >4 5. ^3<<>3 >4 @.^ <<> >3". ^4<<>4 >4 .^ <<> >4,. ^ <<> >3 &. ̂ 16<<< >$. ^:<<>: >4

U!* (+! !&@u&$nt$! ,*t+! ,$ )$nt*!

1<<< 11<< 14<< 1 << 1 << 21<<24<<2 << 3<<< 33<< 3:<< 3 << 42<<4 <<4 << <<< 3<< :<< << :2<<: <<<<< 2<< << << 1<< 3<<<<<<< 2<< << 1<2<< 1<3<< 11<<< 13<<<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 425/499

PROBLEMA 3

E!"#&5* un p#+@#*'* u$ ($* un "*#_"t$# ,$ [A\ * (* [ \ - p#+,u8"* un* !*(&,* "+n +#'* ,$ p&#_'&"+n!&!t$ ,$ (+! "*#*"t$#$! $nt#*,+!. E( "*#_"t$# !up$#&+# ,$5$ !$# (* ($t#* [A\ - $n "*,* n&)$( !u($t#* $nt#*,* ,$5$ "*$# $n $( '$,&+ ,$ (+! "*#*"t$#$! $nt#*,+! *nt$#&#'$nt$.

AABAABCBA

ABC#CBAABC#$#CB

PROBLEMA 4

&Prin! a S!ring #ackKard'E!"#&5* un* un"&7n #$"u#!&)* u$ #$"&5* un *##$@(+ u$ "+nt&$n$ un [!t#&n@\ "+'+ *#@u'$n[!t#&n@\ - ,$)u$()$ n*,*. E( p#+@#*'* t$#'&n* !u $0$"u"&7n "u*n,+ $n"u$nt#* un [nu(( "*#_"t$#\

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 426/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 427/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+R$"&nt+ ,$ B*-*'7n

P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n !N" R $% &''&

CAT$9:R A0 #$ PR.NC.P.ANT$0

Int#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$"+'+ (+ *-*! t$#'&n*,+.

PR:B!$-A &

P#$p*#* un p#+@#*'* u$ "u$nt* $( n/'$#+ ,$ ($t#*!6 punt+! - (+! !&@n+! ,$ $ "(*'*"&7n $n (+! p#&"*#*"t$#$! ,$ un [!t#&n@\. I'p#&'$ $( [!t#&n@\ - $( t+t*( ,$ ($t#*!6 punt+!6 - !&@n+! ,$ $ "(*'*"&

Input zJOLAW. Fu$ un p(*"$# "+n+"$#t$. z u$ t$ )*((* 5&$nWOutput zJ+(*W. Fu$ un p(*"$# "+n+"$#t$. z u$ )*((*! 5&$nW

L$t#*!X 3 E "(*'*"&7n X4 Punt+!X2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 428/499

PROBLEMA 2

Ro!a!ing 6ord"

Y+u *#$ #$ u&#$, t+ #+t*t$ * +#, * "$#t*&n *'+unt. F+# $ *'p($6 t+ #+t*t$ t $ +#, [C+'put$#\ 5- 1&n [#C+'put$\. R+t*t&n@ &t t + '+#$ t&'$! @&)$! -+u [t$#C+'pu\.

$%emplo de .nput(

T $ &#!t (&n$ "+nt*&n! t $ +#, &" &(( n+t *)$ '+#$ t *n 1 ($tt$#!%. T $ !$"+n, (&n$ "+nt*&n!&nt$@$# n6 &" &(( 5$ ($!! t *n t $ ($n@t + t $ +#,. Y+u 'u!t #+t*t$ t $ +#, n t&'$!.

$%emplo de :utput(

T $ +utput &(( 5$ t $ #+t*t$, +#,.

$5ample &

InputEnt#$ (* p*(*5#*ComputerEnt#$ (* "*nt&,*,=Outputt$#C+'pu

$5ample '

InputEnt#$ (* p*(*5#*ProgramEnt#$ (* "*nt&,*,&Output'P#+@#*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 429/499

PR:B!$-A

A p*#?&n@ @*#*@$ " *n@$! * ^:.<< '&n&'un $$ t+ p*#? +# up t+ t #$$ +u#!. T $ @*#*@$ " *#^1. < p$# +u# +# $*" +u# +# p*#t t $#$ + &n $ "$!! + t#$$ +u#!. T $ '* &'u' " *#@$ +# *n- @&+u#! *t * t&'$. K#&t$ * p#+@#*' t *t &(( "*("u(*t$ *n, p#&nt t $ p*#?&n@ " *#@$! +# $*" "u!t+

p*#?$, &! +# $# "*# &n t &! @*#*@$ -$!t$#,*-. Y+u ! +u(, $nt$# t $ +u#! p*#?$, +# $*" "u!t+'$ p#+@#*' ! +u(, p#&nt t $ #$!u(t! &n * n$*t t*5u(*# *n, ! +u(, "*("u(*t$ *n, p#&nt t $ t+t*( + -$!t$#,#$"$&pt!. T $ p#+@#*' ! +u(, u!$ t $ p#+"$,u#$CalculateChargest+ ,$t$#'&n$ t $ " *#@$ +# $*""u!t+'$#.

PR:B!$-A +

K#&t$ * p#+@#*' t *t "+n)$#t! ($tt$#! + t $ *(p *5$t &nt+ t $&# "+##$!p+n,&n@ ,&@&t! +n t $ t$ p#+@#*' ! +u(, ($t t $ u!$# $nt$# ($tt$#! #$p$*t$,(- unt&( * +# * &! $nt$#$,. *n, *#$ t $ t + ($t*#$ n+t +n t $ t$($p +n$%. An $##+# '$!!*@$ ! +u(, 5$ p#&nt$, +# *n- n+n*(p *5$t&" " *#*"t$# t

T $ ($tt$#! *n, ,&@&t! +n t $ t$($p +n$ *)$ t $ +((+ &n@ "+##$!p+n,$n"$.

ABCX2 H LX TUVX DEFX3MNOX: K;YX GJIX4 PRSX

J$#$ * ($tt$# PT $ ($tt$# P "+##$!p+n,! t+ +n t $ t$($p +n$Ent$# * ($tt$# A

T $ L$tt$# A "+##$!p+n,! t+ 2 +n t $ t$($p +n$Ent$# * ($tt$# DT $ ($tt$# D "+##$!p+n,! t+ 3 +n t $ t$($p +n$Ent$# * ($tt$# 2In)*(&, ($tt$#. Ent$# +# t+ u&tEnt$# * ($tt$# u&t

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 430/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'

23pertos

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 431/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n

.nterBay 'KK&

CAT$9:R A $OP$RT:0

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+! - "+n *#" &)+! $ t$#n+!. Pu$,$! ut&(&8#$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$ $n ,&!"+ t*n pt$#'&n*,+.

PRO#$EMA B

Un BpalindromeB $! un* p*(*5#* u$ !$ ,$($t#$* ,$ &@u*( '*n$#* *( ,$#$" + + *( #$) !6 t*( "+'+ \#*,*E!"#&5$ un p#+@#*'* u$ *"$pt* un* !$#&$ ,$ "*#*"t$#$! [!t#&n@\% "+n un punt+ *( &n*( - ,$t$ p*(*5#* !&n &n"(u&# $( punt+% $! un [ palindromeB . Tu pu$,$! *!u'&# u$ (* $nt#*,* ,$ (* p*(*5#* !$#_ $n'&n/!"u(* - u$ t&$n$ un (*#@+ '_ &'+ ,$ 2< "*#*"t$#$!. E( p#+@#*'* n+ t&$n$ u$ "+t$0*# !& (* #$*('$nt$ $( $!p*9+( + &n@( !. P+# $0$'p(+6 (* p*(*5#* [**55"55**\ !$ "+n!&,$#*#_ un [ palindromeB p+# tu p#+@#*'*.

P$#'&t$ (* &t$#*"&7n ,$( p#+@#*'* ,$ '*n$#* u$ ($ p$#'&t* *( u!u*#&+ "+t$0*# p*(*5#*! *,&"&+,$"&,* t$#'&n*#.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 432/499

PR:B!$-A '

E!"#&5$ un p#+@#*'* u$ ($ *!&@n$ *!&$nt+! * (+! p*!*0$#+!. A!u'$ u$ (+! *!&$nt+! ,$( p$ u$9*!&@n*n !&@u&$n,+ $( p*t#7n * "+nt&nu*"&7n.

& A B C D' A B C D= A B C D

+ A B C DA B C D, A B C D

A B C D

E( p#+@#*'* ,$5$ ,$!p($@*# (+! *!&$nt+! ,$( *)&7n6 '*#"*n,+ "+n un*\O\6 * u$((+! *!&$nt+! +"up*,+!. P+#$0$'p(+ ,$!pu ! u$ (+! *!&$nt+!&AJ 'B y +C !$ +"up*n6 !$ ,$5$ ,$!p($@*# (+ !&@u&$nt$

D$!pu ! ,$ ,$!p($@*# (+! *!&$nt+! ,&!p+n&5($!6 $( p#+@#*'* ,$5$ p$,&# *( *!&$nt+ ,$!$*,+. E( un/'$#+ ,$( *!&$nt+ - !$ ,$!p(&$@* (+! ,*t+! *"tu*(&8*,+!. E!t+ "+nt&nu* *!t* u$ t+,+! (+! *!&$nt+"up*,+! + *!t* u$ $( u!u*#&+ &n,& u$ u$ ,$!$* t$#'&n*#. S& $( u!u*#&+ p&,$ un *!&$nt+ +"u p#+@#*'* ,$5$ *!` &n,&"*#(+ - p$,&# u$ !$ $nt#$ +t#+ *!&$nt+.

PRO#$EMA 2

E!"#&5$ un* un"&7n u$ ((*'*#$'+!merge-lists u$ *"$pt* ,+! *#@u'$nt+! ["*((>5->#$ $#$n"$[ u$ !+n)*#&*5($! u$ *punt*n *( p#&n"&p&+ ,$ ,+! (&!t*! $n"*,$n*,*! [(&n?$, (&!t!\% ,$ t&p+int A!u'$ u$ (*! ,+!(&!t*! $n"*,$n*,*! $!t_n +#,$n*,*! ,$ '*n$#* u$ $( )*(+# *( p#&n"&p&+ ,$ (* (&!t* $! $( )*(+# '_! p*punt* *( n/'$#+ u$ ($ !&@u$ $n t*'*9+ - *!` !u"$!&)*'$nt$. L* un"&7n ,$)u$()$ $( )*(+# ,$( *puntun* (&!t* $n"*,$n*,* u$ "+n!&!t$ ,$ (*! ,+! (&!t*! *nt$#&+#$!. L+! )*(+#$! ,$ $!t* (&!t* t*'5& n $+#,$n*,+!. E!t* un"&7n n+ "#$*#* n& ,$!t#u&#_ (+! n+,+! ,$ (* (&!t*. A( t$#'&n*# (* un"&7n6 (,$5$n t$n$# "+'+ "+nt$n&,+ $( )*(+# ,$ NULL.

& ; B C D' A ; C D= A B C D

+ A B ; DA B C D

, A B C DA B C D

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 433/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'

Intermedios

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 434/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n

.nterBay 'KK&

CAT$9:R A #$ .NT$R-$#.:0

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+! - "+n *#" &)+! $ t$#n+!. Pu$,$! ut&(&8#$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$!. V&!u*( B*!&" + C . D$5$n $nt#$@*#!$ $n ,&!"+ t*n p*-*! t$#'&n*,+.

PR:B!$-A &

Programa Planilla forma cor!a,E!t$ p#+@#*'* "*("u(*#_ (* "+nt#&5u"&7n * p*@*#6 + !& $!t_ $ $nt+ ,$ p*@*# + !& ($ t&$n$n u"*nt&,*, #$t$n&,*. E( p#+@#*'* p$,&#_ (+! !&@u&$nt$! )*(+#$!

*% N+'5#$ ,$( "+nt#&5u-$nt$ 5% C*nt&,*, @*n*,* $n $( *9+"% C*nt&,*, #$t$n&,* ,u#*nt$ $( *9+,% D$,u""&+n$!

1% C*nt&,*, ,$ ,$p$n,&$nt$! !$ 'u(t&p(&"* p+# 162<<%2% Int$#$!$! ,$ *ut+ '_ &'+ ,$ 12<<6 )$#& &"*# ,&" * "*nt&,*,%3% E!t*tu!. S+(t$#+ + C*!*,+ ,$,u""&7n &0* S+(t$#+ X363<<. C*!*,+ X:6<<<%4% G*!t+! +#,&n*#&+! n$"$!*#&+! '_ &'+ ,$ 3x ,$ (* "*nt&,*, @*n*,*6 )$#& &"*# "*n% C*nt&,*, &n)$#t&,* $n IRA !& $! !+(t$#+ '_ &'+ ,$ 36<<< - C*!*,+ :6<<<%

$% C_("u(+!1% C*("u(*# $n un* un"&7n (* "*nt&,*, t+t*( ,$ ,$,u""&+n$! !u'*# (*! ,$,u""&+n$! *p(&2% C*("u(*# $n un* un"&7n (* "+nt#&5u"&7n * p*@*# ut&(&8*n,+ (* t*5(* ,$ "+nt#&$ $nt+ !& (* "*nt&,*, @*n*,* ,$!pu ! ,$ (*! ,$,u""&+n$! $! '$n+# + &@u*( * "$#+% +

#$!+()$# ,$ (* "*nt&,*, #$t$n&,* - "u_nt+.3% E( p#+@#*'* ,$5$# ,*# (+! #$!u(t*,+! "+##$!p+n,&$nt$! - un '$n!*0$ p*#* )+()$# *( M

"+'$n8*# "+n un nu$)+ "+nt#&5u-$nt$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 435/499

"abla .ontributivaNo mayor de f'JKKK 4$n e5ceso de f'JKKK

pero no en e5ceso def& JKKK

f& K m*s el &&del e5ceso de f'JKKK

$n e5ceso def& JKKK pero no en e5cesode f=KJKKK

f&JLKK m*s el&,4 del e5ceso def& JKKK

$n e5ceso def=KJKKK pero no en e5cesode f KJKKK

f=JV+ m*s el'V4 del e5ceso def=KJKKK

$n e5ceso def KJKKK

fVJL+ m*s el ==del e5ceso de f KJKKK

PRO#$EMA 4

En un *#" &)+ $ t$#n+ ,$ t&p+ TE;T $ &!t$ un* (&!t* ,$ n/'$#+! ,$ t$( +n+!. !t+! "+nt&$n$n n/'$($t#*! $0$ *(>2 4 7 4>E *'. J*"$# un* (&!t* ,$ (+! n/'$#+! ,$ t$( +n+! +#&@&n*($! - *( (*,+

$ u&)*($nt$ $n +#'*t+ ,$ !7(+ n/'$#+ + !$* #$'p(*8*# (*! ($t#*! p+# n/'$#+! !$@/n $( "7,&@+ ,$( tD$5$ "+nt$n$# p+# (+ '$n+! 1 #$"+#,.

./0igo

' A>B>C = #>$>F + 9>;>. >8>D>! , ->N>:P>E>R>0 L T>U>/ V @>O> >"

PRO#$EMA 2

2. J*"$# un p#+@#*'* u$ p&,* $!"#&5&# un p_##* + - (u$@+ ,$! ENTER p*#* t$#'&n*#. D* "+'"*nt&,*, ,$ "*#*"t$#$! u!*,+! !&n "+nt*# (+! $!p*"&+! - (* "*nt&,*, ,$ p*(*5#*! u$ "+nt&$n$.

PR:B!$-A +

Programa Promedio",L$$# un* (&!t* ,$ 1 n+t*! ,$ $ _'$n$! ,$ un '_ &'+ ,$ 1<< u$ $!t_ $n un *#" &)+ $ t$#n+ ((*'*,+notas4dat - @u_#,*(+! $n un A##*-. En un* un"&7n !$ "*("u(*#_ $( p#+'$,&+ ,$ ,&" * (&!t*. D*# "#$!u(t*,+

*% L* (&!t* ,$ (+! n/'$#+! 5% E( p#+'$,&+ ,$ ,&" * (&!t*"% Un* (&!t* ,$ (*! n+t*! p+# ,$5*0+ ,$( p#+'$,&+,% E( p#+'$,&+ ,$ (* (&!t* ,$ n+t*! p+# ,$5*0+$% Un* (&!t* ,$ (*! n+t*! p+# $n"&'* ,$( p#+'$,&+% E( p#+'$,&+ ,$ (* (&!t* p+# $n"&'* ,$( p#+'$,&+L* un"&7n u$ "*("u(* $( p#+'$,&+ !$ ((*'*#_ 3 )$"$!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 436/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'

;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 437/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n

.nterBay 'KK&

CAT$9:R A #$ PR.NC.P.ANT$0

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+! + ,$ *#" &)+! $ t$#n+!. Pu$,$! ut&(&8*#$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$ $n ,&!"+ t*n p#t$#'&n*,+.

PROBLEMA 1

Programa de nWmero"

J*"$# un p#+@#*'* u$ p&,* un* "*nt&,*, ,$ n/'$#+! &n,$t$#'&n*,+! - un !$nt&n$( p*#* t$#'&n*#. #$!u(t*,+ (+ !&@u&$nt$

*% Cu_nt+! u$#+n p+!&t&)+! 5% Cu*nt+! u$#+n n$@*t&)+!"% Cu*nt+! u$#+n "$#+!,% P#+'$,&+ ,$ (+! p+!&t&)+!$% L&!t* ,$ (+! p+!&t&)+!% L&!t* ,$ (+! n$@*t&)+!

@% C*nt&,*, t+t*( ,$ n/'$#+! $nt#*,+! !&n "+nt*# $( !$nt&n$(

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 438/499

PROBLEMA 2

Programa para "or!ear por edad

D$!*##+(($ un* *p(&"*"&7n u$ ($* ,$ unarchivo (+! !&@u&$nt$! "*'p+! n/'$#+ !$@u#+ !+"&*(6 *p$((&,n+'5#$6 pu$5(+ - $" * ,$ n*"&'&$nt+. G$n$#*n un #$p+#t$ u$ p#$!$nt$ t+,+! (+! "*'p+! - "*("u($ (* p$#!+n*. E( #$p+#t$ !$ )* * &'p#&'&# $n +#,$n ,$ $,*, ,$ '$n+# * '*-+#.

,atos 0el $r+hivo

1111111116 R+,#`@u$86 M*#&!+(6 B*-*'7n6 2 ,$ ,&"&$'5#$ ,$ 1 <2222222226 M*#t`n$86 E,@*#6 D+#*,+6 12 ,$ $n$#+ ,$ 1 :23333333336 G+n8_($86 Hu*n6 D+#*,+6 12 ,$ +"tu5#$ ,$ 1 34444444446 R+,#`@u$86 I)_n6 V$@* B*0*6 2 ,$ $5#$#+ ,$ 1 :2

6 A(+'*#6 R+5$#t+6 S*(&n*!6 1: ,$ 0un&+ ,$ 1 :

PROBLEMA 3

Programa para calcular cuen!a" a cobrar

L* "+'p*9`* ;Y t&$n$ p#+5($'*! "+n (*! "u$nt*! * "+5#*# - (+ "+nt#*t* p*#* ,$!*##+((*# un* *p(&,&@* (+! "(&$nt$! u$ "*nt&,*, ,$ ,&n$#+ ,$5$n * 3< ,`*!6 * :< ,`*! - !+5#$ < ,`*!. T&$n$n u$ ($$*"tu#*6 n+'5#$ ,$ "(&$nt$6 $" * *"tu#* - t+t*( ,$ (* *"tu#*.

E( #$p+#t$ t&$n$ u$ $!t*# +#@*n&8*,+ p+# "(&$nt$ - t&$n$ u$ &n +#'*# (* "*nt&,*, u$ ,$5$ * 3!+5#$ < ,`*!.

#atos del archivo

33433*6 C+'p*9`* ,$ En$#@`*6 2 ,$ '*#8+ ,$ 2<<16 43 3. :43 3:56 E( V+"$#+6 2: ,$ '*#8+ ,$ 2<<16 3423.43 :306 M&"#+!+ t6 : ,$ *5#&( ,$ 2<<16 43 .34

43 32 6 C+'p*9`* ,$ En$#@`*6 2 ,$ '*#8+ ,$ 2<<16: 34.2: 3 3 6 C+'p*9`* ,$ En$#@`*6 2 ,$ *5#&( ,$ 2<<16234 .:3 3 16 E( V+"$#+6 1 ,$ '*-+ ,$ 2<<16 43 :. :

PR:B!$-A +

Programa para recibo de .en!a

Un* "*0$#* n$"$!&t* !*5$# $( "*'5&+ ,$ un* "+'p#* ,$ un p#+,u"t+. E((* )* * $nt#*# (+! n+'5#$! ,$ p#+,u"t+! - !u! #$p$t&,+! p#$"&+! ,$ )$nt*. Lu$@+ u$ !u'$ $( t+t*( ,$ (* )$nt* )* * $nt#*# (* "*nt& p+# $( "(&$nt$. L* *p(&"*"&7n t&$n$ u$ &n +#'*# $( "*'5&+ u$ !$ ($ )* * ,*# *( "(&$nt$ t*nt+ $$n ,7(*#$!. E0$'p(+ !& (* )$nt* t+t*( $! ^12.1< - $( "(&$nt$ ,* un 5&(($t$ ,$ ̂ 2<6 $( "*'5&+ )* * !$,$ ^ 6 ,+! 5&(($t$! ,$ ^16 t#$! p$!$t*!6 un )$((7n ,$ 1< "$nt*)+! - un )$((7n ,$ "$nt*)+!. A,$'_! ,$( t+(* )u$(t*6 ,&!$9$ $( #$"&5+ "+'+ !& u$#* un* t&$n,* p+# ,$p*#t*'$nt+!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 439/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N'

;remiaciones

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 440/499

.nterAmerican University o7 Puerto RicoBayamón Campus

.n7ormatic and Telecommunications #epartment.n7ormatic 0tudent Association 2.0A<A$.6

.1MP2" R PR1 $MM!N .4$55 N !! &''

CATE+OR : ADHANCED

6!R7" P5$. TEAM NAME L+! M+ +n@+!PARTICIPANTS NAMES Hu*n C. V ($86 Hu*n P*5(+ L$7nEMAIL1 VISUAL STUDIO ENTERPRISE EDITION1 KINDOKS 2<<< PROFESSIONAL

0$C:N# P!AC$TEAM NAME L*! G&#(! S"+utPARTICIPANTS NAMES I!'*$( P(*"*6 M*#`* ,$( M*# ()*#$8EMAIL1 VISUAL STUDIO PROFESSIONAL EDITION1 IBM KEB SPJERE STUDIO

T;.R# P!AC$TEAM NAME 5&t *"t+#- 1<PARTICIPANTS NAMES Eu#`p&,$! R&)$#*6 C*#(+! R$-$!EMAIL $u#&l#&)$#*y +t'*&(."+'6 !+n&"y"+ u&.n$t1 VISUAL STUDIO PROFESSIONAL EDITION1 VISUAL AGE SMALL TAL ENTERPRISE

C"/2<O?E: IN/2?-2 I"/2

6!R7" P5$. TEAM NAME L+! M*##+n$#+!PARTICIPANTS NAMES G$+#@$ G+n8_($86 Lu&! C*#'+$@*EMAIL1 VISUAL STUDIO ENTERPRISE EDITION1 VISUAL AGE FOR HAVA

0$C:N# P!AC$TEAM NAME C-5$# Sp&,$#'*nPARTICIPANTS NAMES J*+ K$& Ku6 D*n&$( D`*8EMAIL1 VISUAL STUDIO PROFESSIONAL EDITION1 BORLAND DELPJI DEVELOPMENT TOOLS

T;.R# P!AC$

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 441/499

TEAM NAME T$'&5($!PARTICIPANTS NAMES E(!&$ M*(*) 6 M-#n* I#&8*##-EMAIL (&!& <y +t'*&(."+'1 VISUAL STUDIO PROFESSIONAL EDITION1 VISUAL BASIC :.< DEVELOPMENT BOO %

C"/2<O?E: ,2<INN2?S

6!R7" P5$. TEAM NAME R$*($! p*#* C#&!t+PARTICIPANTS NAMES n@$( C+(7n6 M*#`* M*##$#+EMAIL "+(+nl*n@$(y +t'*&(."+'6''*#$##+3 1y5".&nt$#.$,u 1 VISUAL STUDIO ENTERPRISE EDITION1 OFFICE 2<<< DEVELOPER

0$C:N# P!AC$TEAM NAME N+ C+,$PARTICIPANTS NAMES K&(!+n D`*86 M*#t&n R$-$!EMAIL -&$(,yp#t".n$t6#$-$!'*#t&n1 y +t'*&(."+' 1 VISUAL STUDIO PROFESSIONAL EDITION1 TJE COMPLETE VISUAL BASIC :.< TRAINING COURSE

T;.R# P!AC$TEAM NAME yWb3^ ..ZPARTICIPANTS NAMES M*-#* V_8 u$86 H+n*t *n N*8*#&+EMAIL '*-#&t*1 y +t'*&(."+' 6 0+!"*#&ny"*#&5$.n$t 1 VISUAL STUDIO PROFESSIONAL EDITION1 KEB APPLICATION DEVELOPMENT USING MS VISUAL INTERDEV :.< BOO %

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 442/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

23pertos

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 443/499

Universidad .nteramericana de Puerto RicoPrimeras :limpiadas de Programación

.NT$RBA 'KKK

CAT$9:R A #$ $OP$RT:

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!"+'+ (+ *-*! t$#'&n*,+.

1% C+,$ * p#+@#*' t *t $n*5($! * p$#!+n t+ &nput n*'$!6 p +n$ nu'5$#!6 *n, "*t$@+#&$! F#&$nBu!&n$!!% + *" u*&nt*n"$! '* &'u' + 2 %. Input t $ &#!t n*'$!6 (*!t n*'$!6 *n, p +n$ nu'5$#! t$ t 5+ $!. U!$ +pt&+n 5utt+n! +# t $ "*t$@+#-. K $n t $ u!$# "(&"?! *n A,, t+ L&!t 5utt+n6 t $!t+#$! t $ n*'$6 nu'5$#6 *n, "*t$@+#- &n *##*-6 ,&!p(*-! + '*n- n*'$! *#$ !*)$,6 *n, "($*#! t $ &)*(u$! #+' t $ !"#$$n. A '$!!*@$ (*5$( &! u!$, +# $##+# '$!!*@$! *n, t+ &n,&"*t$ + '*n- n*'$! 5$$n *,,$, t+ t $ *##*-!. K $n t $ u!$# "(&"?! t $ "($*# 5utt+n6 t $ t$ t 5+ $!6 '$!!*@$6 "*t$@+#- 5+ "($*#. K $n t $ u!$# "(&"?! t $ ,&!p(*- (&!t 5utt+n6 *(( t $ )*(u$! #+' t $ *##*-! *#$ ,&!p(*-$(&!t 5+ *t t $ 5+tt+'. D&!p(*- * !p$"&*( '$!!*@$ & D&!p(*- (&!t &! "(&"?$, 5$ +#$ *n- n*'$! **##*-!. A #+u@ (*-+ut + t $ +#' &! ! + n $#$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 444/499

2% A (& $ &n!u#*n"$ "+'p*n- *! &#$, -+u t+ #&t$ * p#+@#*' t+ p#&nt * (&!t + t $&# "u!t+'$#! p#$'&u' t *t $*" "u!t+'$# p*-!. P#$'&u'! *#$ 5*!$, &n t $ *@$ "u!t+'$# *! $n $ +# ! $ 5$"*'$ *"u!t+'$#. T $ +((+ &n@ t*5($ &! u!$, t+ ,$t$#'&n$ $*" "u!t+'$#d! p#$'&u'6 5ut t $!$ #*t$! *#$ !t+ " *n@$.

A@$ P#$'&u'2 ^2 .<<3 2 .<<4 3< .<<

32 .<<: 3 .<<

E*" *@$ (&!t$, &n t &! t*5($ &! t $ upp$# (&'&t +# t $ p#$'&u'. F+# $ *'p($6 & * "u!t+'$# !&@n p+(&"- $n ! $ *! 3 6 ! $ +u(, p*- ^3< .

K#&t$ * p#+@#*' t *t #$*,! t $ (&!t + !$ u$nt&*( &($ &nt+ p*#*(($( *##*-!6 t $n #$*,! &n t $ "u!t+*n, *@$! $n t $- 5+u@ t t $ p+(&"&$! &nt+ *n+t $# p*&# + p*#*(($( *##*-!. T $ t*5($ *n, t $ "u!n*'$! *n, *@$! *#$ !t+#$, &n t + &($!. P#&nt +ut * +#'*tt$,6 (*5$($, (&!t ! + &n@ $*" "u!t+'$#d! +# $# *@$ $n t $ p+(&"- *! 5+u@ t6 *n, t $ "u!t+'$#d! p#$'&u'.

3% C+n!&,$# t $ !$ u$n"$ + ,&@&t! #+' 1 t#+u@ N $#$ NX % &n &n"#$*!&n@ +#,$# 1 2 3 4$&t $# * % +# *,,&t&+n +# * >% +# !u5t#*"t&+n +# * % Q5(*n? t+ #un t $ ,&@&t! t+@$t $#$!u(t *n, !$$ &, -+u @$t 8$#+.

K#&t$ * p#+@#*' t *t &(( &n, *(( !$ u$n"$ + ($n@t N t *t p#+,u"$ * ERO SUM.

T$0T CA0$

Input

Output1 2>3 4> >: X<1 2>3>4 :> X<1>2 3 4> :> X<1>2>3>4> : X<1>23 4 : X<1>23>4 : X<

Y+u '*- t$!t t &! p#+@#*' 5- $nt$#&n@ t $ &nt$@$# #+' t $ ?$-5+*#,.4%A t$*" $# '*&nt*&n! * #*n,+'>*""$!! &($ "+nt*&n&n@ t $ +((+ &n@ &n +#'*t&+n +# $*" !tu!+"&*( !$"u#&t- nu'5$#6 @#*,$! +n $*" + t + +u#(- $ *'!6 *n, t $ &n*( $ *' @#*,$. A!!u'$ t $ #*n,*""$!! &($ GRADES.T;T *! 5$$n "#$*t$, &t !t#&n@ &$(,! + ($n@t ! 2 *n, 11 *n, t #$$ nu'$#&" *n, *(( t $ n*'$! *n, !+"&*( !$"u#&t- nu'5$#! *)$ 5$$n $nt$#$,. T $ nu'$#&" &$(,! *)$ 5$$n &n&t&&t 8$#+!. K#&t$ * p#+@#*' &t t $ &)$ "+''*n, 5utt+n! [D&!p(*- F&#!t Stu,$nt\6 [R$"+#, G#*,$D&!p(*- N$ t Stu,$nt\6 [L+"*t$ Stu,$nt\6 [P#&nt G#*,$ L&!t\6 *n, [D+n$\ t+ *((+ t $ t$*" $# t+ ,+ t+((+ &n@.

*% Ent$# *(( @#*,$! +# * !p$"& &" $ *'.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 445/499

5% L+"*t$ *n, ,&!p(*- t $ #$"+#, +# * !p$"& &" !tu,$nt !+ t *t +n$ +# '+#$ @#*,! '*- 5$ " *n"% P#&nt * (&!t + &n*( @#*,$! t *t "*n 5$ p+!t$,. T $ (&!t ! +u(, ! + t $ (*!t +u# ,&@&t!

!$"u#&t- nu'5$#6 t $ @#*,$ +n t $ &n*( $ *'6 *n, t $ !$'$!t$# *)$#*@$ + $*" !tu,$nt. T $!$'$!t$# *)$#*@$ &! ,$t$#'&n$, 5- t $ +#'u(* $ *'1 $ *'2 2 e &n*( $ *'%b4.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 446/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

Intermedios

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 447/499

Un&)$#!&,*, Int$#*'$#&"*n* ,$ Pu$#t+ R&"+P#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n

!N" R $% &'''

CAT$9:R A0 #$ .NT$R-$#.:0

Int#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$"+'+ (+ *-*! t$#'&n*,+.

PRO#$EMA B

E!"#&5$ un p#+@#*'* u$ p&,* un* "*nt&,*, ,$ ,&n$#+. D*# "+'+ #$!u(t*,+ $( n/'$#+ ,$ p$!$t*!6 ,&)$((+n$! - "$nt*)+! u$ *( !u'*#(+! ,$ (* "*nt&,*, ,$ ,&n$#+ $nt#*,+. D$5$ !$# $( n/'$#+ '`n&'+ ,$ '$nE0$'p(+ "*nt&,*, $nt#*,* ^2.1

R$!u(t*,+

p$!$t* !%1 ,&'$ !%1 )$((7n $!%2 "$nt*)+ !%

PRO#$EMA 4

E!"#&5$ un p#+@#*'* u$ &'p($'$nt$ $ p+n$n"&*"&7n. E( p#+@#*'* p$,&#_ )*(+# p*#* N u$ !$#)*(+# p*#* E u$ !$#_ $( $ p+n$nt$ ,$ N6 *'5+! t&$n$n u$ !$# )*(+#$! $nt$#+!.D$5$ !$@u&# (*! !&@u&$nt$! #$@(*!

Cu*n,+ EZ<X N e N e ..N% E )$"$!Cu*n,+ EX<X1Cu*n,+ Ef<X1b N e N e .N% E )$"$!

eN+ pu$,$ u!*# n&n@un* un"&7n p#$>,$ &n&,*

E0$'p(+ n/'$#+ $nt#*,+ E p+n$nt$ $nt#*,+ 3R$!u(t*,+

R$!u(t*,+ ,$ N $($)*,+ * (* E $! 12

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 448/499

PRO#$EMA 2

E!"#&5&# un p#+@#*'* u$ p&,* (* ,&'$n!&7n "u*,#*,* p*#* +#'*# un* '*t#&8. L* '*t#&8 !$ "#$*n/'$#+! *( *8*# $nt#$ < - . P+n,#_ $n p*nt*((* (* '*t#&8 "#$*,* - *( (*,+ +t#* '*t#&8 u$ $!t*#_ 'u(t p+# 3.E0$'p(+ N/'$#+ $nt#*,+ $! 3 "$#+ p*#* t$#'&n*#%

M*t#&8 M*t#&8 p+# 23 1 4 : 22 2 4 1 4< 3 < : 14

PROBLEMA 4

E!"#&5&# un p#+@#*'* ,$ #$!$#)*"&7n ,$ *!&$nt+! p*#* un *)&7n. E( *)&7n !7(+ t&$n$ 1< *!&!$""&7n ,$ FUMAR - +t#* ,$ NO FUMAR.P$,&# "+n Input $( n+'5#$ ,$( p*!*0$#+ - (* !$""&7n ,$!$*,*.eL+! *!&$nt+! ,$( 1> $! !$""&7n ,$ FUMAR eL+! *!&$nt+! ,$( :>1< $! !$""&7n ,$ NOFUMAR e < !$ ($ *!&@n* *( *!&$nt+ *( &n&"&+ p*#* &n,&"*# u$ $!t_ ,$!+"up*,+ - 1 "u*n,+ $! #$!$#)*,+eN+ pu$,$ #$!$#)*# *!&$nt+! u$ -* $!t n #$!$#)*,+!eCu*n,+ $( p*!*0$#+ ,$!$$ !$""&7n ,$ FUMAR - $!t$ (($n*6 p$#+ (* ,$ NO FUMAR t+,*)`* *- *!& p#$@unt*#($ !& ,$!$* (* +t#* !$""&7n - )&"$)$#!*eCu*n,+ t+,+! (+! *!&$nt+! $!t n +"up*,+! ,*# un '$n!*0$ ,$ u$ $( )u$(+ $!t_ (($n+.eeeD*# "+'+ #$!u(t*,+ "*,* )$8 u$ *-*n #$!$#)*"&+n$!6 $( n+'5#$6 n/'$#+ ,$ *!&$nt+ - !$""&7n F NO FUMAR%eee E( p#+@#*'* ,$5$ "+##$# *!t* u$ !$ (($n$n t+,+! (+! *!&$nt+!.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 449/499

Universidad Interamericana de Puerto RicoRecinto de Bayamón

CO-;2/2NCI"S 2 ;?O<?"-"CI@N

;rincipiantes

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 450/499

1niversidad Interamericana de ;uerto ?icoP#&'$#*! O(&'p&*,*! ,$ P#+@#*'*"&7n

!N" R $% &'''

CAT$9:R A #$ PR.NC.P.ANT$0

In!t#u""&+n$! @$n$#*($!

T+,+! (+! p#+5($'*! ,$ $!t* "*t$@+#`* !$#_n &nt$#*"t&)+!. NO ($$n ,*t+! ,$!,$ *#" &)+! $ t$#n+!%ut&(&8*# p*#* #$!+()$#(+! (+! !&@u&$nt$! ($n@u*0$! V&!u*( B*!&" + C . D$5$n $nt#$@*#!$"+'+ (+ *-*! t$#'&n*,+.

PRO#$EMA B

E!"#&5$ un p#+@#*'* u$ p+n@* $n p*nt*((* un t#&_n@u(+ !`'5+(+!. E( n/'$#+ ,$ (`n$*! $n $( t#&!`'5+(+ !$#_ $nt#*,+ p+# $( t$"(*,+. D$5$ *!$@u#*#!$ u$ $( n/'$#+ !$* )_(&,+ + !$* u$ !$* '*-+# ,'$n+# ,$ 2 . D$ n+ !$# )_(&,+ ,*# un '$n!*0$ ,$ $##+# - u$ )u$()* * p#$@unt*# *!t* u$ !$* )_(&,+P+# $0$'p(+ !& !$ $nt#* - ed (* !*(&,* !$#_

eeee

eeeeeeeeeeee

eeeeeeeee

PRO#$EMA 4

E!"#&5$ un p#+@#*'* u$ "*("u($ $( &nt$# ! u$ @*n*#_ ,$ un* "*nt&,*, ,$ ,&n$#+ &n)$#t&,*. Dun '$n/ + 5+t+n$! (* "*nt&,*, ,$ *9+! u$ !$#_ $nt#$ 1 - 1<. T*'5& n $!"+@$#_ ,$ un '$n/ + 5+t+n$! "&$nt+ ,$ &nt$# ! *p(&"*5($ u$ !$#_ $nt#$ un x - un 1 x. D$5$ #$p$t&# (+! "_("u(+! *!t* u$ !$ $,$( p#+@#*'*.

E0$'p(+ "*nt&,*, &n)$#t&,* ^1<<< * 2 *9+! * un x $( #$!u(t*,+ !$#_ ^12<<

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 451/499

PRO#$EMA 2

E!"#&5$ un p#+@#*'* u$ !&'u($ un* "u$nt* ,$ , 5&t+ ATJ%. D$5$ p+n$# "+'+ "+n!t*nt$ $( 5*(*n$( p*!! +#, u$ !$#_ nu' #&"+. A( "+'$n8*# (* "+##&,* ,$( p#+@#*'* ,$5$ p$,&#($ $( p*!! +#, - p$#&nt$nt*#(+ !+(*'$nt$ 3 )$"$!6 ,$ n+ $nt#*#(+ "+##$"t+ t$#'&n*# $( p#+@#*'*. S& $( p*!! +#, $! "+un '$n/ "+n (*! !&@u&$nt$! *(t$#n*t&)*!

1. Retiro> p$,&# (* "*nt&,*, - ,*# "+'+ #$!u(t*,+ $( 5*(*n"$ *!t* $( '+'$nt+. D$5$ )$#& &"*# u!+5#$ @&#$ (* "u$nt* ,$ !$# *!` ,*# '$n!*0$ [n+ t&$n$ +n,+! !u &"&$nt$!\ - $( 5*(*n"$.

2. #epósito> p$,&# (* "*nt&,*, ,$ ,$p7!&t+ - ,*# "+'+ #$!u(t*,+ $( 5*(*n"$ ,&!p+n&5($.3. Balance>D*# "+'+ #$!u(t*,+ $( 5*(*n"$.

Lu$@+ ,$ (+! #$!u(t*,+! ,$5$ p#$@unt*# !& ,$!$* *"$# +t#* t#*n!*""&7n + ,$!$* !*(&#.

PRO#$EMA Q

E!"#&5&# un p#+@#*'* u$ p&,* 2 n/'$#+!. p+!&t&)+!6 n$@*t&)+ + "$#+%. D*# "+'+ #$!u(t*,+ '$n!*0$! [#$!u(t*,+ !$#_ p+!&t&)+\6 [#$!u(t*,+ !$#_ n$@*t&)+\ + [#$!u(t*,+ !$#_ "$#+\ p*#* (*! +p'*t$'_t&"*! ,$ 'u(t&p(&"*"&7n - !u'*. NO PODR SUMAR NIMULTIPLICAR LOS NÚMEROS.

E0$'p(+ Ent#$ un p#&'$# n/'$#+>'KEnt#$ !$@un,+ n/'$#+'K

-ultiplicación( resultado ser* negativo0uma( resultado ser* cero

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 452/499

MISCELÁNEOS

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 453/499

Fecha <4b1 b2<<< Nombre de la competencia lllllllllllllllllllllllll Categoría E p$#t+ Universidad UPR BAYAMON .Autor N$((&u, T+##$! Tipo de competencia E(&'&n*t+#&*! .Problema lllll Algoritmos llllllllllllllllllllllllllllllllllllll

CO#O$ DESCRIPTION +ENERATOR

0ource File Name( C:B:9$ 4OOO.nput File Name( 9$N>.4!.B:utput File Name( 9$N>: 4!.B

En un "$nt#+ ,$ "+'put+! "#$*#+n un $,&t+# u$ ,&!$9* un #$p+#t$ p+# p*nt*((* - un* )$8 "#$*,+ @$n$#$ $( "7

p*#* (* ,$!"#&p"&7n ,$( *#" &)+. Tu t*#$* $! "#$*# $( '7,u(+ u$ #$"+@$ $( *#" &)+ "+n $( ,&!$9+ ,$ (* p*nt*((* - @$

&n!t#u""&+n$! ,$ COBOL $n +t#+ *#" &)+.

E0$'p(+

ARC;./: C:N $! F:R-AT: #$! R$P:RT$ #$0CR.PC.:N #$! R$P:RT$

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 454/499

A UC6] 3 6989 9 7U 3JB 364BL 5EC9N'K =E >6I6MKNL 5E 9;'5K =E CLE07E;LLJECL6: VMMA==AIIW P6 E: V BWL

L6CCK7N' CLEC ; CLEC CLEC ;L N7M>E5 >EJK5E N7M>E5 CL 6M' 6J'E5=VBBBBBBW VBBW V BWV , &BBW VBBW' V , &BBW

!1 LE6=9N D1& !" P9C #-"/&

!" P9C #-2*/ Q6 7E 7N9QE5;9=6= =E P7E5'K59CKX&!1 LE6=9N D2& !" P9C #- /&

!" P9C #-1 / Q6 7E 5EC9N'K =E >6I6MKNX&!1 LE6=9N D3& !" P9C #-</&

!" P9C #-1B/ Q6 7E 5E 9;'5K =E CLE07E;X&!1 LE6=9N D$& !" JECL6 P9C #-*/ Q6 7E

JECL6:X&

!" P9C #& !" MKN'L P9C BB& !" P9C # Q6 7E AX& !" =6I P9C BB& !" P9C # Q6 7E AX& !" IE65 P9C BB&!1 LE6=9N D"& !" P9C #-</ Q6 7E

6CCK7N'X&

!" P9C ##& !" P9C #-*/ Q6 7E

CLEC ;X&

!" P9C ##& !" P9C #-"/ Q6 7E

CLEC X&

!" P9C #-11/& !" P9C #-*/ Q6 7E

CLEC ;X&

!1 LE6=9N D*& !" P9C #&

!" P9C #-*/ Q6 7E

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 455/499

N7M>E5X&

!" P9C ##& !" P9C #-*/ Q6 7E

>EJK5EX&

!" P9C ##& !" P9C #-*/ Q6 7E

N7M>E5X&

!" P9C #& !" P9C #-*/ Q6 7E

CL X&

!" P9C #& !" P9C ### Q6 7E

6M'X&

!" P9C ###& !" P9C #-"/ Q6 7E

6J'E5X&

!1 =E'69 D1& !" J9E =D1 P9C -"/&

!" P9C ####&

!" J9E =D2 P9C BB& !" P9C #-"/& !" J9E =D3 P9C B& !" P9C ##& !" J9E =D$ P9C , &BB&

!" P9C ###&!" J9E =D" P9C BB&

!1 'K'6 D1& !" P9C #-22/&

!" P9C , &BB&

T+'$ $n "+n!&,$#*"&7n (+ !&@u&$nt$

1. E( p#&'$# "*#*"t$# ,$( *#" &)+ ,$t$#'&n* $( t&p+ ,$ (&n$* * ,$ &n&#. J X J$*,&n@6 D X D$t*&(6 T X T+t*(%.2. L`n$*! $n 5(*n"+ n+ t&$n$n u$ ,$ &n&#!$.3. L+!string ,$ (+! values )*n $n un* !$@un,* (`n$* &n,$p$n,&$nt$'$nt$ ,$ !u (*#@+ $ "(u-$n,+ $( +#'*t+ ,$ $" *. (+! [b4. E( "7,&@+ t&$n$ u$ @$n$#*#!$ "+n (* '$n+# "*nt&,*, ,$ "*#*"t$#$! p+!&5($!.. L+! n+'5#$! ,$ )*#&*5($! !$ &n"#$'$nt*n *ut+'_t&"*'$nt$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 456/499

:. L+! !&@n+! Z - f &n,&"*n &n*( - p#&n"&p&+ ,$ un "*'p+. Cu$nt*n "+'+ $!p*"&+.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 457/499

Fecha <4b1 b2<<< Nombre de la competencia lllllllll Categoría E p$#t+ Universidad lllllllllllllllllllll Autor N$((&u, T+##$! Tipo de competencia llllllllllllll Problema lllll Algoritmos llllllllllllllllllllll

CO#O$ DESCRIPTION OPTIMI7ER

0ource F ile Name( C:B:PT 4OOO.nput File Name( #$0C>.4!.B:utput File Name( #$0C>: 4!.B

En un "$nt#+ ,$ "7'put+! !$ $n"+nt#*#+n "+n p#+5($'*! ,$ $!p*"&+ $n ,&!"+ $n !u M*&n #*'$ p#&n"&p*(. D$!p

)*#&*! t "n&"*! p*#* (&5$#*# $!p*"&+ $n ,&!"+6 !$ $n"+nt#*#+n "+n $( p#+5($'* ,$ u$ t+,*)`* n$"$!&t*5*n $!p*"&+System

ana#er !u@&#&7 u$ !$ ,$pu#*#*n (*! (&5#$#`*! ,$ (*! ,$ &n&"&+n$! ,$ *#" &)+! ,$ COBOL. E!t+ ,$5&,+ * u$ $( <

$n $!$ ($n@u*0$. D$!*##+(($ un p#+@#*'* u$ ($* ,$ $nt#*,* un* ,$!"#&p"&7n ,$ #$"+#, n&)$( <1% - ($ ,&!'&nu-* (*

"*#*"t$#$! p+!&5($!. E0$'p(+

#$0CR.PC.:N :R.9.NA! #$0CR.PC.:N :PT.-."A#A

!1 5ECK5=D=EJ&!" C6MPKD1 P9C'75E #####&!" C6MPKD2 P9C'75E BBBBB&!" C6MPKD3 P9C BB&

!" C6MPKD$ P9C'75E BBBBBQBB&!" C6MPKD" P9C ####&!" J9 E5 P9C' #-1!/&!" C6MPKD* P9C QBBBBBBB&!" J9 E5 P9C'7 ###&

!1 5ECK5=D=EJ&!" C6MPKD1 P9C #-"/&!" C6MPKD2 P9C B-"/&!" C6MPKD3 P9C BB&

!" C6MPKD$ P9C B-"/QBB&!" C6MPKD" P9C #-$/&!" P9C #-1!/&!" C6MPKD* P9C QB-</&!" P9C ###&

T+'$ $n "+n!&,$#*"&7n (+ !&@u&$nt$

. L+! FILLER !$ $(&'&n*n ,$( "7,&@+ +#&@&n*(.

. PICTURE !$ *5#$)&* * PIC.

. Cu*( u&$# !`'5+(+ ,$ $,&t*0$ '*-+# ,$ 3 p+!&"&+n$! ; 7 % !$ *5#$)&* "+n (* "*nt&,*, ,$ "*#*"t$#$! pu$!t+! $n u"+'&((*!.

1<. S$ t&$n$ u$ "+n!&,$#*# $( !`'5+(+ V.11. S$ ,$5$ '*nt$n$# (* *(&n$*"&7n u$ t#*&@* $( "7@&,+ +#&@&n*(.12. A!u'* u$ $( "7,&@+ n+ t&$n$ $##+#$! ,$ !&nt* &!.13. S+(+ *5#_ un* ,$!"#&p"&7n ,$ #$"+#, p+# *#" &)+.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 458/499

Fecha <4b1 b<< Nombre de la competencia lllllllllll Categoría E p$#t+ Universidad lllllllllllllllllllllll Autor Hu*n M S+(_ S(+*n Tipo de competencia llllllllllllllll Problema lllll Algoritmos llllllllllllllllllllllll

TCA$ , B CompilerTCA$ Ne"!ed $oop !o 9 8 A""embl% $anguage

A u!t$, !$ ($ * $n"+'$n,*,+ "#$*# p*#t$ ,$( "+'p&(*,+# ,$ TCAL . <1. TCAL $! un ($n@u*0$ ,$#&)*,+ ,$( COBOL u$ !$ p*#* p#+@#*'*# t$#'&n*($! ,$ '*n+ ,$ *('*" n. L* t*#$* u$ !$ ($ * $n"+'$n,*,+ $! "+n)$#t&# un* !$#&$ ,$ "&"(+! "+n " Assembly /an#ua#e ,$ < .

L+! "&"(+! $n A!!$'5(- un"&+n*n ,$ (* !&@u&$nt$ '*n$#* E( #$@&!t#+ C; )* * t$n$# (* "*nt&,*, ,$ )$"$! u$ !$ $0$"C*,* )$8 u$ (* &n!t#u""&7n ,$ LOOP *p*#$8"* $n $( "7,&@+6 C; !$ ,$"#$'$nt*#_ *ut+'_t&"*'$nt$. Un "&"(+ ,$ 1 * 1<un "&"(+ ,$ 1< * 1. E0$'p(+

Ciclos en Assembly

MOV C;61< > Ot#*! &n!t#u""&+n$! )*n * u& >LOOP

L+! "&"(+! *n&,*,+! ,*n p#+5($'* pu$! $( /n&"+ #$@&!t#+ ,$ p#+p7!&t+ @$n$#*( u$ un"&+n* "+n LOOP $! C;. P*#*n&,*,+ un"&+n$ !$ ,$5$ $'pu0*# $( )*(+# ,$ C; $n $( St*"? V *!$ $( $0$'p(+ ,$ *5*0+%.

.nstrucciones de Assembly a utiliQarseP*#* $!t$ p#+@#*'* (*! &n!t#u""&+n$! u$ !$ ut&(&8*#_n !$#_n !u'*6 #$!t*6 &n"#$'$nt+ - ,$"#$'$nt+. En *!!$'5(- ,$ <

INC ; &n"#$'$nt+ ;DEC ; ,$"#$'$nt+ ;SUB ;6Y #$!t* ; > YADD Y6 !u'* Y

In!t#u""&+n ,$ LOOP V *!$ $0$'p(+ ,$ "&"(+ $n A!!$'5(-%

$%emplo del insumo 2TCA!4.N6 Salida &TCA$,O0T'DATA DIVISION.

<1 ; PIC .<1 Y PIC .<1 PIC .PROCEDURE DIVISION.PERFORM VARYING CTR FROM 1 BY 1 UNTIL CTR Z 1<

PERFORM VARYING CTR2 FROM 1 BY 1 UNTIL CTR Z 1<< COMPUTE ; X ; 1END>PERFORMCOMPUTE Y X Y>1

COMPUTE X >;END>PERFORM.PERFORM 2<<>OPENlPORT

STOP RUN.

MOV C;6 1<PUSJ C; MOV C;6 1<< INC ; LOOPPOP C;DEC Y

SUB 6Y

LOOPCALL OPENlPORT.E;IT <END

Nota: L*! &n!t#u""&+n$! ,$ PERFORM 2<<>OPENlPORT - STOP RUN. T&$n$ u!t$, u$ "+(+"*#(*! *( &n*( ,$ !u "7,&A!!$'5(- !&$'p#$ u$ *p*#$8"*n $n $( *#" &)+ ,$ $nt#*,* Su5!t&tu&# p+# CALL OPENlPORT - .E;IT <6 END "+'+ $n $

No apare8eran otros P R61RM a otras rutinas

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 459/499

UN./$R0.#A# #$ PU$RT: R.C:A#-.N.0TRAC.:N #$ C:!$9.:0 R$9.:NA!$0

C:!$9.: UN./$R0.TAR.: T$CN:!:9.C: #$ BA A-:N#$PARTA-$NT: #$ C:-PUTA#:RA0

C:-P$T$NC.A0 #$ $!.-.NAT:R.ACAT$9:R.A PR.NC.P.ANT$

PRO#$EM X B, CAPS

.NPUT F.!$ NA-$( B$9#./&4#AT:UTPUT F.!$ NA-$ B$9#./&4:UT

PR:B!$-(

Ut&(&8$ $( *#" &)+A0C.. B$9#./&4#AT u$ $!t* &n"(u&,+ $n $( ,&!"+ u$ !$ $nt#$@+ - $( "u*(* !&@u&$nt$ &n +#'*"&7n

Universidad de Puerto RicoAdministracion de Colegios RegionalesColegio Universitario Tecnologico de Bayamon

N+ !$ ut&(&8*n (+! *"$nt+! p*#* $!t$ p#+5($'*. J*@* un p#+@#*'* u$ "*'5&$ (*! ($t#*! '&'*-/!"u(*! - )&"$)$#!* - (+ @u*#,$ $n $( *#" &)+B$9#./&4:UT . S$ pu$,$ ut&(&8*# "u*( u&$# un"&7,$ &n&,* u$ "+nt$n@* $( ($n@u*0$ p*#* "+n)$#t&# (*! ($t#*!.

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

PRO#$EM X 4, C5ARACTER TO ASCCII TO C5ARACTER A+AIN

.NPUT F.!$ NA-$( B$9#./&4#AT:UTPUT F.!$ NA-$( B$9#./'4:UT:UTPUT F.!$ NA-$( B$9#./'A4:UT

PR:B!$-(

Ut&(&8*n,+ $( *#" &)+ ,$ $nt#*,* ,$( p#+5($'* *nt$#&+#6 *@* un p#+@#*'* u$ "#B$9#./'4:UT %6 $( "u*( "+n)&$#t* $n "$#+!K% - un+!&% (+! "*#*"t$#$!6 ut&(&8*n,+ $( "7,&@+A0C.. &n"(u`

$n $!t*! +0*!% ,$( *#" &)+B$9#./&4#AT . En +t#*! p*(*5#*! !$ !u!t&tu&#_ "*,* ($t#* p+# +" +!&'u(*n,+ $( "7,&@+ 5&n*#&+A0CC.. . Un* )$8 $( *#" &)+ B$9#./'4:UT % $!t$ "#$*,+6 $( p#+@#*'* p#* ($$#(+ "+'+ *#" &)+ ,$ $nt#*,* "$##*#(+ p#&'$#+% - (+ )+()$#_ * "+n)$#t&# $n un *#" &)+ ,$ "A0C..((*'*,+ B$9#./'A4:UT4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 460/499

PRO#$EM X 2, P5ONE CODE

.NPUT F.!$ NA-$( N:N$:UTPUT F.!$ NA-$ N:N$

PR:B!$-(

L+! n/'$#+! t$($ 7n&"+! t&$n$n un* !$#&$ ,$ ($t#*! *!&@n*,*! (*! "u*($! !+n

&X N+ t&$n$ ($t#*! *!&@n*,*!

' XA B C

=X# $ F

+X9 ; .

X8 D !

, X- N :

XP R 0

LXT U /

VX@ O

KX N+ t&$n$ ($t#*! *!&@n*,*!

C#$$ un p#+@#*'* u$ p&,* ,$ &n!u'+ un n/'$#+ t$($ 7n&"+ ,$ !&$t$ ,&@`t+! &n"(u-$n,+ $( _#$* "+,$. E( p#+@#*'* '+!t#*#_ $n (* p*nt*((* $( n/'$#+ "+n)&#t&$n,+ (*! ($t#*! u$ t$n@* $n n/ p#+@#*'* t&$n$ u$ )*(&,*# $( ,*t+ ,$ $nt#*,*

&4 u$ $ &!t*n L "*#*"t$#$! &n"(u-$n,+ @u&7n%. '4 u$ $( @u&7n $ &!t* - $!t $n (* p+!&"&7n "+##$"t*.

=4 u$ n+ $ &!t* n&n@/n +t#+ "*#*"t$# $!p$"&*( *p*#t$ ,$( @u&7n6 ($t#*! - n/'$#+!+4 N+ !$ ut&(&8*n (*! ($t#*!E - " p+# (+ u$ !& !+n &n"(u&,*!6 $( p#+@#*'* ,$5$ &n,&" $!*! ($t#*! n+ !+n )_(&,*!.

0A-P!$ .NPUT < :UTPUT(

.NPUT( >CASJ :UTPUT( >22 4

.NPUT( TJE>BEST :UTPUT( 43>23

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 461/499

PRO#$EM X Q, DA O* T5E 6EE

.NPUT F.!$ NA-$( N:N$:UTPUT F.!$ NA-$( N:N$

PR:B!$-(J*@* un p#+@#*'* u$ "*("u($ $( ,`* ,$ un* $" * $n p*#t&"u(*# u$ p+# (+ '$n+! $!t $n $( !&

p#+@#*'* #$"&5&#_ ,$ $nt#*,* un* $" * "+n $( +#'*t+--<##< . J*- u$ )*(&,*#

1. u$ (* $" * $!t$ "+##$"t*.2. u$ n+ !$* '$n+# ,$ &VK& n& '*-+# ,$&VVV.3. L+! ,`*! - (+! '$!$!. E0. N+ $ &!t$ un 3< ,$ $5#$#+%4. S& pu$,$ )*(&,*# un *9+ 5&!&$!t+6 $!t+ !$ "+n!&,$#*#_ *( '+'$nt+ ,$ $)*(u*# (* "*nt&,*, ,$ p#+5($'*! u$ #$!+()&7 $( $!tu,&*nt$.

0A-P!$ .NPUT < :UTPUT(.NPUT( <3b<1b ::UTPUT( VIERNES

.NPUT( <:b31b ::UTPUT( INCORRECT DATE>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

PRO#$EM X , TE-T INHERTER

.NPUT F.!$ NA-$( N:N$:UTPUT F.!$ NA-$ N:N$

PR:B!$-(

J*@* un p#+@#*'* u$ *"$pt$ ,$ $nt#*,* un !t#&n@ ,$ "*#*"t$#$! - (+! &n)&$#t*.Para resolver esteproblema no se puede utiliQar ninguna 7unción e5istente en el lengua%e Gue haga este proceso4 E( p#+@#*'*tiene u$ '*n$0*# $( !t#&n@ p+# "*#*"t$#$! - n+ p+,#_ *"$pt*# '_! ,$ 2< "*#*"t$#$! "+n!$ N+ !$ )* * ut&(&8*# $( $!p*"&+ $n 5(*n"+ "+'+ un "*#*"t$# $nt#$ (+! u$ !$ )*n * &n)$#t&#. J*-

&4u$ $( !t#&n@ n+ !$* '*-+# ,$'K n& '$n+# ,$' .

'4 u$ (+! "*#*"t$#$! * ut&(&8*#!$ !$*n ,$ (*A>" '&n. - '*-. - (+! n/'$#+! ,$( K *(V.0A-P!$ .NPUT < :UTPUT(

.NPUT( ARRO:UTPUT( ORRA

.NPUT( ROMA:UTPUT( AMOR

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 462/499

Fecha llllbllllbllll Nombre de la competenciaCategoría PRINCIPIANTES Universidad UPR PROGRAMMINGAutor lllllllllllll Tipo de competencia $(&'&n*t+#&*Problema 1 Algoritmos

T.TU!: #$! PR:B!$-A

0ource File Name( OOOOOOOO4OOO.nput File Name( OOOOOOOO4OOO:utput File Name( OOOOOOOO4OOO

PR:B!$-A0 PARA $!.-.NAT:R.ACAT$9:R.A( PR.NC.P.ANT$0

PRO#$EMA XB

E!"#&5* un p#+@#*'* u$ ($* ,$( u!u*#&+ "&$#t* "*nt&,*, ,$ '$,&,*! $n @*(+n$!6 un* * (* )$86 - )*(+# * (&t#+! *nt$! ,$ p$,&# $( p#7 &'+ )*(+#. L* "*nt&,*, ,$ "+n)$#!&+n$! * #$*(&8*# !$#_ $ntL* "+n)$#!&7n #$ u$#&,* $!litros =4 L _9alones . L&'&t$ !u #$!pu$!t* * ,+! 2% (u@*#$! ,$"&'*($!. At$#'&n*# (* "+##&,*6 ,$5$ )$#& &"*# !& $( u!u*#&+ ,$!$* #$p$t&# $( p#+"$!+a

$8$-P!: #$ !A C:RR.#A(In,& u$ $( n/'$#+ ,$ "+n)$#!&+n$! * #$*(&8*# 3

In,& u$ $( )*(+# 1 * "*("u(*# 1<1< @*(+n$! $ u&)*($n * 3 . (&t#+!

In,& u$ $( )*(+# 2 * "*("u(*# 1313 @*(+n$! $ u&)*($n * 4 .21 (&t#+!

In,& u$ $( )*(+# 3 * "*("u(*# @*(+n$! $ u&)*($n * 2:.4 (&t#+!

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 463/499

Fecha llllbllllbllll Nombre de la competenciaCategoría PRINCIPIANTES Universidad UPR Autor lllllllllllll Tipo de competencia $(&'&n*t+#&*Problema ll2 Algoritmos

PRO#$EMA X4

E!"#&5* un p#+@#*'* u$ ($* un *#" &)+ ,$ t$ t+ "+,&@+.&n%6 - "+n)&$#t* !u "+nt$n&,+ *( "7"+nt&nu*"&7n A > d6 B > d6 C X dWd6 D = yd6 E X d6 F X d6 G X d6 J = xd6 I X fd6 HZd6 M = ed6 N X bd6 O X cd6 P X Q 6 X m 6 R X d6 S X 6 T X %d6 U X d6 V = ld6 K X X Xd

L* "+n)$#!&7n ,$( t$ t+ * !t$ "7,&@+6 ,$5$ *p*#$"$# $n +t#+ *#" &)+ "+,&@+."+,%. Lu$@+"+nt$n&,+ ,$( *#" &)+ $n "7,&@+ "+,&@+."+,% * t$ t+ - $!"#&5&#(+ $n +t#+ *#" &)+ "+,&@+*#" &)+! $n t$ t+6 *p*#$"$#_ $n ($t#*! '*-/!"u(*! /n&"*'$nt$. E( +#'*t+ ,$( t$ t+ ,$5$ !$# $( '&!

*#" &)+ ,$ $nt#*,* "+,&@+.&n% - $n $( *#" &)+ ,$ !*(&,* "+,&@+.+ut%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 464/499

Fecha llllbllllbllll Nombre de la competenciaCategoría lp#&n"&p&*nt$! Universidad UPR Autor lllllllllllll Tipo de competencia $(&'&n*t+#&*!Problema 3 Algoritmos

PRO#$EMA X 2

E!"#&5* un p#+@#*'* u$ ($* $( u!u*#&+ 1< )*(+#$! $nt$#+!6 - (+! @u*#,$ $n un *##$@(+ ,$ un$( p#+@#*'* ,$5$ &n,&"*# "u*( ,$ $!+! )*(+#$! $! $( )*(+# '_ &'+6 - "u*( $! $( )*(+# '`n&'+.

$8$-P!: #$ C:RR.#A

E!"#&5* 1< )*(+#$! $nt$#+! !$p*#*,+! p+# un $!p*"&+23 12 1 4 3 2 3 3 <

E( )*(+# '_ &'+ ,$ $!$ @#up+ $! <E( )*(+# '̀ n&'+ ,$ $!$ @#up+ $! 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 465/499

Fecha llllbllllbllll Nombre de la competenciaCategoría p#&n"&p&*nt$! Universidad UPR Autor lllllllllllll Tipo de competencia $(&'&n*t+#&*!Problema 4 Algoritmos

PRO#$EMA XQ

E!"#&5* un p#+@#*'* u$ "*("u($ $ &'p#&'* $n p*nt*((* (* "*nt&,*, ,$ ,&n$#+ ,&!p+n&5($ $n un*$n (* "u*( &n&"&*('$nt$ !$ ,$p+!&t7 un* "*nt&,*, ,*,* ,$ ,&n$#+ (* "u*( !$#_ $nt#*,* p+# $( u!u*un* t*!* ,$ &nt$# ! ,$( x . E( p#+@#*'* ,$5$ p+,$# "*("u(*# $!t$ )*(+# ,*,* un* "*nt&,*, ,$ *9+! ($nt#*,* p+# $( u!u*#&+%. U!$ (* #$(*"&7n ,$ u$ $( ,&n$#+ $n (* "u$nt* *( &n*( ,$ un *9+6 $! "u$nt* *( p#&n"&p&+ ,$( *9+ '_! .< )$"$! $( ,&n$#+ $n (* "u$nt*.

$8$-P!: #$ C:RR.#A(

Ent#$ (* "*nt&,*, ,$ ,&n$#+ ,$p+!&t*,+ $n (* "u$nt* 1<<<.<<Ent#$ (* "*nt&,*, ,$ *9+! u$ ,$!$* "*("u(*# 3

A9+1 ^ 1< <.<<A9+ 2 ^ 11::.4<A9+ 3 ^ 12 . 1

P#+"$!+ T$#'&n*,+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 466/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A4C4C4A!+"&*"&7n ,$ C&$n"&*! ,$ C+'put*,+#*!%

2< ,$ '*#8+ ,$ 1

*O+0EO DE PRO+RAMACI<N

Problem &(

Tu#t($ G#*p &"!% T $ L+@+ (*n@u*@$6 &" &! p*#t&"u(*#- p+pu(*# *'+n@ p$#!+n*( "'*,$ t $ "+n"$pt + tu#t($ @#*p &"! *'+u!. I'*@&n$ * '$" *n&"*( tu#t($ t *t *(?! *#+un, t $ #++' un,"+nt#+( + * C p#+@#*'. T $ tu#t($ +(,! * p$n &n +n$ + t + p+!&t&+n!6 up +# ,+ n. K &($ t $ p$ntu#t($ t#*"$! +ut ! *p$! *! &t '+)$! &($ t $ p$n &! up6 t $ tu#t($ '+)$! *5+ut #$$(- &t +ut #&t&n@In t &! p#+5($' -+u &(( !&'u(*t$ t $ +p$#*t&+n + t $ tu#t($ *n, "#$*t$ * "+'put$#&8$, !?$t" p*, *! $

U!$ * >5-> < *##*- (++# &" &! &n&t&*(&8$, t+ 8$#+!. R$*, "+''*n,! #+' *n *##*- t *t "+t $'. $$p t#*"? + t $ "u##$nt p+!&t&+n + t $ tu#t($ *t *(( t&'$! *n, $t $# t $ p$n &! "u##$nt(- up +A!!u'$ t *t t $ tu#t($ *( *-! !t*#t! *t p+!&t&+n <6< + t $ (++# &t &t! p$n up. T $ !$t + tu#t($ "+''* p#+@#*' 'u!t p#+"$!! *#$ *! +((+ !

Command -eaning

1 P$n up2 P$n ,+ n3 Tu#n #&@ t4 Tu#n ($ t

M+)$ +# *#, 1< !p*"$!+# * nu'5$# +t $# t *n1<%

: P#&nt t $ <>5-> < *##*-En, + ,*t* !$nt&n$(%

Supp+!$ t *t t $ tu#t($ &! !+'$ $#$ n$*# t $ "$nt$# + t $ (++#. T $ +((+ &n@ [p#+@#*'\ +u(, ,#* p#&nt * 12>5-12>! u*#$

26 1236 1236 1236 121

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 467/499

:

A! t $ tu#t($ '+)$! &t t $ p$n &t ,+ n6 !$t t $ *pp#+p#&*t$ $($'$nt! + *##*- (++# t+ 1!. K $n t $ :"+''*n, p#&nt% &! @&)$n6 $#$)$# t $#$ &! * 1 &n t $ *##*-6 ,&!p(*- *n *!t$#&!?6 +# !+'$ +t $# " ++!$. K $#$)$# t $#$ &! * 8$#+ ,&!p(*- * 5(*n?. K#&t$ * C p#+@#*' t+ &'p($'$nt t $ tu#t($ @#*"*p*5&(&t&$! ,&!"u!!$, $#$. K#&t$ !$)$#*( tu#t($ @#*p &"! p#+@#*'! t+ ,#* &nt$#$!t&n@ ! *p"+''*n,! t+ &n"#$*!$ t $ p+ $# + -+u# tu#t($ @#*p &"! (*n@u*@$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 468/499

$OP$RT #./.0.:N

DIRECTOR $ISTIN+ COMMAND SIM0$ATOR

Problem '(D$)$(+p * p#+@#*' t *t !&'u(*t$ * @$n$#&"#.R "+''*n,. T $ &nput &(( 5$ #$*, #+' *n &nput &($

n*'$, #.R4TOT. T $ " *#*"t$#! *((+ $, &n t *t &($ &(( 5$

1. A ,+t .% t+ !$p*#*t$ t $ &($ n*'$ *n, t $ $ t$n!&+n +pt&+n*(%.2. C *#*"t$#! #+' A t+ Upp$# *n, L+ $#"*!$ &(( 5$ *((+ $,%.3. Nu'5$#! #+' < t+ .

T $ p#+'pt "+''*n, &(( *((+ t $ +((+ &n@ " *#*"t$#!

1. A ,+t .% +pt&+n*(%2. An *!t$#&!? e% t+ !u5!t&tut$ +n$ +# '+#$ " *#*"t$#!.3. A u$!t&+n '*#? h% t+ !u5!t&tut$ +n(- +n$ " *#*"t$#.

T $ +((+ &n@ *#$ $ *'p($! + )*(&, "+''*n,!.

DIReA.E;E6 DIR ABe.COM6 DIR AhBhCh.DAT6 DIR ABChJe.e6 DIR JELP6 DIRe.e6 DIR .hhh6 DIReAhB.e

T $ #u($! +# &($n*'$! &(( 5$ t $ !*'$ u!$, +# MS>DOS. At t $ $n, t $ p#+@#*' &(( ,&!p(*-t+t*(! + &($! ,&!p(*-$, +n !"#$$n *n, t $ t+t*( + &($! #$*, +n t $ &($. R$'$'5$#6 t $ p#+@#*' 'u!t!$n!&t&)$.0ample :utput(

C:--AN# DIRe.E;EABC.E;EFINISJ.E;EPROGRAM.E;ETEST.E;E

T+t*( &($! #$*, 2 %. T+t*( &($! !$($"t$, 4%.

C:--AN# ZDIReJ.eFINISJ.E;EASJ.T;T

T+t*( &($! #$*, 2 %. T+t*( &($! !$($"t$, 2%.

C:--AN# ZDIR AhBhCe.e N+t &($! +un,

T+t*( &($! #$*, 2 %. T+t*( &($! !$($"t$, <%.

C:--AN# ZDIR AhCe.eABC.E;EA;CTOT.BAT

T+t*( &($! #$*, 2 %. T+t*( &($! !$($"t$, 2%.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 469/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A4C4C4A!+"&*"&7n ,$ C&$n"&*! ,$ C+'put*,+#*!%

2< ,$ '*#8+ ,$ 1

*O+0EO DE PRO+RAMACI<N

Problem =(

T+ $#! + J*n+&% E)$#- 5u,,&n@ "+'put$# !"&$nt&!t 'u!t @#*pp($ &t "$#t*&n "(*!!&" p#t $ T+ $#! + J*n+& !$$ F&@. .1 % &! +n$ + t $ '+!t *'+u! + t $!$. L$@$n, *! &t t *t &n * t$'p($E*!t6 p#&$!t! *#$ *tt$'pt&n@ t+ '+)$ * p$@ *n, *##*n@$, #+' 5+tt+' t+ t+p 5- ,$"#$*!&n@ !&8$.

*tt$'pt&n@ t+ '+)$ t $ !t*"? #+' t &! p$@ t+ * !$"+n, p$@ un,$# t $ "+n!t#*&nt! t *t $ *"t(- +n$ ,&!?*t * t&'$6 *n, *t n+ t&'$ '*- * (*#@$# ,&!? 5$ p(*"$, *5+)$ * !'*(($# ,&!?. A t &#, p$@ &! *)*&(*5t$'p+#*#&(- +(,&n@ t $ ,&!?!. Supp+!$,(- t $ +#(, &(( $n, $n t $ p#&$!t! "+'p($t$ t $&# t*!?6 !+ t(&tt($ &n"$nt&)$ +# u! t+ *"&(&t*t$ t $&# $ +#t!.

L$t u! *!!u'$ t *t t $ p#&$!t! *#$ *tt$'pt&n@ t+ '+)$ t $ ,&!?! +#' p$@ 1 t+ p$@ 3. K$ &! t+*n, *(@+#&t ' t *t &(( p#&nt t $ p#$"&!$ !$ u$n"$ + ,&!?>t+>,&!? p$@ t#*n! $#!.

I $ $#$ t+ *pp#+*" t &! p#+5($' &t "+n)$nt&+n*( '$t +,!6 $ +u(, #*p&,(- &n, +u#!$()$!+p$($!!(- ?n+tt$, up &n '*n*@&n@ t $ ,&!?!. In!t$*,6 & $ *tt*"? t $ p#+5($' &t #$"u#!&+n &n '&&''$,&*t$(- 5$"+'$! t#*"t*5($. M+)&n@ ,&!?! "*n 5$ )&$ $, &n t$#'! + '+)&n@ +n(- n>1 ,&!?! *n,

#$"u#!&+n% *! +((+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 470/499

FOGUEO CUTBCortesía de: Nelliud D. Torres

Marzo 20, 1998

EXPERT DIVISION

TECO EDITOR :

Problema:

TECO rue un editor de texto famoso que se usó mayormente en la computadora PDP-10 de la compañíaDIGITAL. E1 motivo principal de utilizar un editor que trabaje por líncas era debldo a los teletipos queimprimían en papel. Estos teletipos funcionaban igual que un terminal, incluso utilizaban un tecladoprácticamente igual a de las computadoras de hoy en día. Sin embargo tenían la desventaja de que no podíanmanejar pantalla, ya que no se puede controlar esas funciones en papel. De esa necesidad surge TECO el cualpermite que se pueda editar un archivo de texto sin la capacidad de manejo de pantalla.

Los comandos de TECO son a base de caracteres y su delimitador es el signo de dó1ar ($). Un signo dedólar significa una separación entre un comando y otro; dos signos de dó1ar ($$) le indica al editor que tieneque ejecutar los comandos dados por el usuario. A continuación una exphcación de los comandos másutilizados: ,!

/ 1. J - E1 comando "J" le indica a TECO movimiento en el texto. Las dos formas de utilizarlo para las

competencias son las siguientes:a. BJ - Mueve' el pointer al principio del buffer.b. ZJ - Mueve el pointer al final del buffer.

2. L - Mueve el poiter al principio de la línea que el usuario indique. Por ejemplo:*. 0L - Se mueve al principio de la línea en que se encuentre el pointer.b. 5L - Se mueve cinco líneas hacia adelante y pone el pointer al principio de la

quinta linea.c. -1L - Mueve el pointer una línea hacia atrás y coloca el pointer al principio de la

línea. Es 1o mismo que L.

3. C - Mueve el pointer "n" cantidad de caracteres. Por ejemplo:*. C > Mu$)$ $( p+&nt$# un "*#*"t$# * (* ,$#$" *. E! (+ '&!'+ u$ 1C. 5 3C > Mu$)$ $( p+&nt$# t# ! "*#*"t$#$! * (* ,$#$" *.".>1C > Mu$)$ $( p+&nt$# un "*#*"t$# * (* &8 u&$#,*.

En "*!+ ,$ u$ !$ &nt$nt$ '+)$# $( p+&nt$# * (* &8 u&$#,* - -* $!t$ (+"*(&8*,+ * (* &8 u(`n$*6 n+ !$ $n)&*#_ '$n!*0$ ,$ $##+# - !$ ,$0* $( p+&nt$# $n $!* p+!&"&7n

4. T > D$!p(&$@* (* (&n$* $n ,+n,$ $!t$ (+"*(&8*,+ $( p+&nt$# + * p*#t&# ,$ $!* (+"*(&8E0$'p(+!*. T D$!p(&$@* (* (`n$* $n ,+n,$ $!t* $( p+&nt$#.

5. OT > D$!p(&$@* $( t$ t+ "+##&,+ ,$!,$ $( p#&n"&p&+ ,$( 5u $# *!t* ,+n,$ !$$n"u$nt#$ $( p+&nt$#.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 471/499

c. 5T - Muestra las próximas cinco líneas comenzando en la línea en donde este el pointer.d. HT - Muestra en pantalla todas la líneas del buffer.

5. I - Inserta texto entre las líneas a partir de la localización del pointer. Ejemplo:

Itexto a inclur$ - Inserta el string "texto a incluir".

6. K - Se utiliza para eliminar líneas o texto a partir del pointer. Ejemplos:a. K - Elimina texto a partir de la localización del pointer hasta el final de la línea.b. Si el pointer estaba al principio, se dejará la línea en blanco.c. OK - Elimina texto desde el principio de la línea hasta el pointer.

5K - Elimina las próximas 5 líneas a partir de donde se encuentre el cursor.Recuerde que si el cursor esta al principio de la línea, esa primera línea debe quedar en blanco.

7. D - Se utiliza para eliminar caracteres a partir de la localización del pointer. Ejemplos:

*. D - Elimina el primer caracter que este a la derecha del pointerb. 5D- Elimina los pr6ximos 5 caracteres a la derecha del pointer.c. -2D - Elimina los dos caracteres que estén a la izquierda del pointer. Si el

pointer está al principio de la línea, no se elimina nada y no se envía"~' mensaje de error.

8. EX- Guarde el texto y sale de editor~ El formato es: EX$$

Para comenzar a correr la aplicacón se invocará el siguiente comando: TECO texfile.txt. El archivo yadebe existir ya que para simplificar el problema, el editor no tiene que erear un archivo de la nada, Pararepresentar el pointer, se utilizará el asterisco. Recuerde que hasta que no se incluya el comando "T", TECO nodespliega las líneas. Cualquier comando que se salga del rango, el editor lo ignora y no lo ejecuta. AContinuación un ejemplo de como debe trabajar el editor: (Las áreas subrayadas son el output del editor el elresto son comandos de usuario)

e:>TECO programa.txt*0LT$$*IDENTIFICATION DIVISION*HT$$*IDENTIFICATION DIVISION

PROGRAM ID. PRUEBAENVIROMENT DIVISION

STOP RUN*2LT$$*ENVIRONMENT DIVISION.

*5C$3D$0LT$$ENVIR*ENT DIVISION.

IONM^<LT^^ENVIReONMENT DIVISION.

eE;^^C.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 472/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Computadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Intermediate

Problem B · Hotel Reservation

Write an interactive program to manipulate a database. This database manages the hotel reservations.

The hotel has 6 rooms, from room 101 to room 106. Room numbers ending in odd numbers are single

rooms. Rooms ending in even numbers are double. The program must read: Name, Number of guests,

Date of Entry.

Display a menu with the following Options:

1. Reservation \ Check-In2. Room Status3. Checkout4. Statistics5. Exit Program

Option 1: Access to make a Reservation or Check-InOption 2: Displays the room status (Occupied, Vacant)Option 3: Reads the date a guest leaves.Option 4: Indicates number of times each room has been occupied Option 5: duh!

The program should validate for the correct number of people in each room an that theroom isn't occupied. Also validate the exit date-

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 473/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Computadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Intermediate

Problem 4 : Plot Functions

Write a program that plots polynomial functions.

Input:order, coefficients and constant

Output: (Graph)

Range of:x = 1 to 70y = 1 to 20

Example: (Input)Order: 3Coefficients:

Coefl: 4Coef2:-2Coef3:2

Constant: 4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 474/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Computadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Intermediate

Problem 2 · Factorials

Write a program that finds the factorial number to any number within I and 25. Validate the input for the

range. To exit the program enter X.

Example 1:

Input:

Enter the number: 3

Output:

Factorial of 3! = 6

Example 2:

Input:

Enter the number: 25

Output:

Factorial of 25! = 15511210043300000000000000

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 475/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Computadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Intermediate

Problem Q: Equal to Zero

Read a sequence of digits from I to N (where N <= 9) in increasing order:

I 2 3 4 5...N

Insert either a + (for addition) or a - (for substraction) between each of the digits so that the resultant

sum is zero.Diaplay all possible combinations that sums zero.

Example:

Input:Number = 7

Output:1+2-3+4-5-6+7=0

1+2-3-4+5+6-7=0

1-2+3+4-5+6-7=0

1-2-3-4-5+6+7=0

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 476/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

(Asociación de Ciencias de Computadoras)

20 de marzo de 1998

FOGUEO DE PROGRAMACIÓN Beginners

Problem B: Distance, Midpoint and Slope

Write a program that reads two points, (XI, Y1) and (X2, Y2), from a user and find:

a) the distance between the points

b) the midpoint of the line segment

c) the slope of the line trace from one point to another(If not defined indicate so):

d) the ecuation in the form point-slope

#istance Formula

, P16 P2%X ;1>;2% 2 Y1>Y2% 1b2%

-idpoint Formula(

;1 ;2%b26 Y( Y2%b2

0lope(

'X Y2>Y(% b ;2>;I%

D&!p(*- t $ ,&!t*n"$!6 t $ '&,p+&nt6 t $ !(+p$ *n, t $ $"u*t&+n.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 477/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

(Asociación de Ciencias de Computadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Beginners

Problem 4 : Draw Shapes

Write a program that draws different shapes at random.

Example:

Input:Enter number of shapes: 5

Output:

Screen

A.C.C

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 478/499

PROBLEMA #5

Escribe un programa que utilizando funciones de gráficos dibuje una pelotita, la cual seguirá la moción indicadaen el próximo dibujo.

Nota: la pelotita no puede salir del margen de la pantalla, y la misma debe estar lo más cercano al bordeposible.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 479/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Cmputadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Beginners

Problem 2 : File Management

Write a program that reads from one file and writes to another file.

Read from the inventory file (Invent. in) and read all the data of the items that begin with 10 and store in

another file (Invent. out). Give indications to the user that the program, is Reading, Writing, Thinking and

Done. At the end display how many items were moved.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 480/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Cmputadoras)

20 de marzo de 1998 FOGUEO DE PROGRAMACIÓN

Beginners

Problem Q: Ardes Labels

Write a program that reads an address and displays on the screen in proper order.

Example:

Input: John H. Doe, Hc-02 Box 3769, Levittown, P.R, 00943

Output:

Doe, J.H.

Hc-01 Box 3769

Levittown, PR 00943

The name used will consist of a first name, middle initial and last name (In that order) and then

prints the last name, followed by a comma and the first AND middle initial, each followed by a period.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 481/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Computadoras)

21 de febrero de 1998

Competencias: Estudiantes de Nuevo lngreso

Ejercicio #1:

Una compañía desea transmitir data a través de las líneas telefónicas, pero su preocupación es que lainformación sea interceptada indebidamente por otras entidades. Toda su data es transmitida en forma de

enteros de cuatro (4) dígitos. Dicha compañía ha solicitado sus servicios para crear un programa que codifique

su data para que su transmisión sea más segura.

Su programa debe leer un entero de cuatro(4) dígitos y codificarlo utilizando la siguiente formula:

cambie cada digito a: (La suma de ese digito + 7) mod 10 . Luego intercambie el primer dígito por el tercero y

el segundo digito por el cuarto.

Presente el resultado en pantalla.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 482/499

Universidad de Puerto RicoAdministración de Colegios Regionales

Colegio Universitario Tecnológico de Bayamón

A.C.C(Asociación de Ciencias de Cmputadoras)

21 de febrero de 1998

Competencias: Estudiantes de Nuevo lngreso

Ejercicio #2:

Decodifica el código generado por el primer programa (Ejercicio I).

Su programa debe leer este código entero de cuatro dígitos, descodificarlo y presentado en pantalla.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 483/499

C+'p$t$n"&*! E!tu,&*nt$! ,$ Nu$)+ In@#$!+

E0$#"&"&+ 3

E( p#+p7!&t+ ,$( p#+@#*'* $! "#$*# un *(@+#&t'+ u$ ($* un '$n!*0$ ,$( *#" &)+-$N0A8$4TOT4

E!t$ '$n!*0$ ,$5$ !$# t#*,u"&,+ * "7,&@+ M+#!$. En p*nt*((* ,$5$ *p*#$"$# $( '$n!*0$ t*( - "+'+ $!t$( *#" &)+ - (u$@+ ,$5$ p#$!$nt*# !u t#*,u""&7n.

C7,&@+ M+#!$

*X .> 0X .>>> #X .>. 5X > ?X >.> !X "X >.>. (X .>.. tX >,X >.. 'X >> uX ..>$X . nX >. )X >X ..>. 9X >>.>> X .>>@X >>. +X >>> X >..>X . PX .>>. -X >.>>&X .. X >>.> 8X >>..

1X .>>>> :X > .2X ..>>> X >>3X >> X >>>..4X .> X >>>>.X .. <X >>>>>

E0$'p(+ ,$ "+##&,*M$n!*0$ J+(*.

S*(&,*J+(*.

.>>>.>...>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 484/499

Categoría intermedio

PRO+RAMA DECODI*ICACI<N DO#$E

E1 programa anteriormente mencionado consiste en una doble decodificación de datos Estructurada en la sigumanera la letra A debe ser reeplasada por el espacio en blanco la letra B debe ser suplantada por la letra Z ymismo consecuentemente Por todo el abecedario. Despues de haber concluido con la inversión la salida del progrdebe dar su valor numerico en respecto a la posición de el dato dentro del abecedario (el espacio en blanco despues de la letra Z.

Ejemplo:

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z -

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 2

E1 (-) = Espacio en blanco

Entrada= t o m aCodifucación nivel 1 =Codifucación nivel 2 = 14 17 21 27

La decodificación del mismo debe ser entrada en números y el resultado debe ser la entrada original en el ejercicianteriormente mencionado el mismo debe ir a el archivo encry.dat

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 485/499

Intermedio

Crear un programa que simule la registración de entrada y salida de un hospital. E1 Hospital solo acepta10 pacientes. E1 proceso de registración debe de estar siempre online hasta que el comando shutdown seaseleccionado en el menú. Los pacientes de alta se sacan de la lista activa y se colocan en una lista pasiva.E1 programa debe aceptar el nombre del paciente, el número de seguro social, dia y hora que entró y elcuarto donde se va a colocar. En el hospital hay solo 5 habitaciones de la habitación 101 a la 105. El

programa debe tener un menú para manejar la registración. E1 menú debe tener las opciones de aceptar unpaciente, dar de alta, cambiar a un paciente de cuarto y reportes. En reportes debe haber otro menú con lasopciones de imprimir la información en pantalla de un paciente buscada por seguro social, la opción decuartos para ver la capacidad disponible y la opción de pacientes dados de alta.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 486/499

Fecha llllbllllbllll Nombre de la competencia llllllllllllllll Categoría B$@&nn$#! Universidad( CUBYYYYY lllllllllllllAutor lllllllllllll Tipo de competencia E(&'&n*t+#&*Problema lllll Algoritmos lllllllllllllllllllllllll

C#$*# un p#+@#*'* u$ t#*n! +#'$ un !t#&n@!t#&n@ ut&(&8*n,+ (* "*nt&,*, '$n+# ,$ $,&"&+n$$,&"&+n$! !$ *"$n "+n (+! "+'*n,+! ,$ D$($t$ p*#* 5R&@ t p*#* '+)$#!$ * (* ,$#$" * $ In!$#t p*#* "+(+"*# ,*t

E( p#+@#*'* ,$5$ &n,&"*# "u*nt*! $,&"&(($)*#*n *"*5+. E( p#+@#*'* ,$5$ !$@u&# p&,&$n,+!t#&n@ *!t* u$ un+ ,&@* (+ "+nt#*#&+.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 487/499

5ig Sc ool C allenge B FP*@$. 1

Problem &(

An JTML L&n? G$n$#*t+# &! * p#+@#*' t *t #$"$&)$! *n Input &($ PROBI.IN % t *t +#u($! *n, @$n$#*t$! *n +utput &($ PROEI.+u# *""+#,&n@(-. M*?$ *n FITML L&n? "#$*t$! *n +utput &t$ +((+ &n@ t $!$ #u($!

Q In? ( ! n*'$0aQIIn? ( ! *,,'!!(Q In? 2 ! n*'$0aQ1In? 2 ! *,,'!!0

T $ +utput &($ PROE( .+u# ! +u(, 5$ *! +((+ !(

fL&Z fA JREFX ((In? &• S *,,'!! TMZ (&n? &6! n*'$A fL&Z FIREFX @&n? T! *,,'!! Z (&n? T! n*'$ fIAZ

T $ p#+@'' ! +u(, +#? n+ '*tt$# *t t $ n*'$! + t $ (&n?! *'6 *t t $ *,,#$!!$! + t $!$(&n?! *#$6 +# + '*n- (&n?! t $' *#$ &n t $ &($.

F+# t $ Input &($6 PROB1.IN\

Y* ++ ! JPa ttp bb .-* ++."+'T$!t P*@$a ttp bb'-!&t$.'-n+,$.+#@

t $ +utput &($6 PROB1. uT6 ! +u(, 5$

fUL.ZfLIZ fA JREFX ttp bb .-* ++."+' Z Y* ++ ! JP fbAZfLIZ fA JREEX ttp bb'-!&t$.'-n+,$.+#@ Z T$!t P*@$ fbAZ fbULZ

J&@ S" ++( C *(($n@$ 1P*@$ 2

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 488/499

Problem '(

M*?$ * p#+@#*'' t *t +utput! t $ "+'put$# "(+"?d! t&'$6 !&'u(*t&n@ t $ " *#*"t$#! #+' * "(+"?.

E 'p($I t $ "+'put$#d! t&'$ up+n $ $"ut&+n &! 21 AM6 t $ p#+@'' ! +u(, +utput

21 AI t $ +u# $($ PM6 In!t$*, O *n A6 * P ! +u(, 5$ #&tt$n * t$# t $ t&'$.

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 489/499

J&@ S" ++( C *(($n@$ 1P*@$ 3

Problem =(

M*?$ * p#+@#*' t *t #$*,! *n $n"+,$, &($ npRO:3.INI.%6 ,$"+,$! It6 *n, #&t$! t $ ,$"+,$, ,*

+utput &($ PROB3.OUT\%. T $ "+,(&"*t(+n &(( 5$ @&)$n 5- t $ +((+ &n@ !" $'$

ABCDEFGJIH LMNOP RSTUVK;YY;KVUTSR PONMLICIIJGFEDCBA

t *t &!6 A "+,& &$! t+ > *n, )&"$>)$#!*6 U "+,& &' t+ n+n *n, )I"$>)$#!*6 *n,[ N\ "+,& &$! 5$(t A(( " *'"t$#! t *t *' n+t ($tt$#! &(( 5$ "+p&$, un" *n@$, t+ t $ +utput &($6 5ut (+ $#"*!$ ($ 5$ ,$"+,$, t+ t $&# "+##$!p+n,&n@ ($tt$# n( $n In upp$#"*!$%6 !+ t *t *n # +u(, "+,& - t+

TM +u(, "+,& - t+ *n A In t $ +utput &($.In -+u# I'p($'$nt*tI+n6 YOU MAY NOT USE ARRAYS FOR DECODING. Y+u *)$ t+ ,$!&*(@+#&t ' t+ "*n- +ut t $ ,$"+,&n@ p#+"$!!6 5ut -+u '*- NOT u!$ *#'-n t *t "+nt*&n "+n)$#!&+T $ p#+@'' ! +u(, +#t +# ANY t$ t "+nt*&n$, In PROB3.IN6 Y 5ut t $ t$!t &($ t *t -+u *)$ 5$$@&)$n I! t $ +((+ &n@

A5CDEFG IH IMNOp RStUVK;- IH

A t$# $ $"ut&+n6 t $ +utput &#$6 PROBS.OUT6 ! +u(, "+nt*&n t $ +((+ &n@

Y;KVUTSR PONML HIJGFEDCBA1lW

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 490/499

J&@ S" ++( C *(($n@$ 1 P*@$ 4

Problem +(

M*?$ * p#+@'' t *t *!?! t $ u!$# +# t $ $($'$nt! Int$@$# nu'5$#!% + * ! u*#$ '*t#& "+nt*&#+ ! *n, 3 "+(u'n!6 *n, "*("u(*t$! *n, p#Int! +ut t $ ,$t$#'&n*nt + !*&, '*t#& . E *'p($ + + "*("u(*t$ t $ ,$t$#'In*nt + * 3 3 '*t#&

Q1 2 3Q4 >:Q

D$tX1 Q > :% >2 4 > :% 3 Q4 . %X > 2

T *t &!6 +n$ t*?$! t $ &#!t nu'5$# + t $ &#!t #+ In t &! "*!$6 * 1% *n, +n$ 'u(t(p(&$! &t p#+,u"t + (&$ +u# nu'5$#! t *t *' NOT "+nt*&n$, &n t $ !*'$ #+ *n, "+(u'n *! t $ 1. In t &! t $!$ +u# nu'5$' *' 6 >:6 *n, . T $n6 +n$ 'u(t&p(&$! t $ &#!t nu'5$# &t t $ t &#, %6 *t $n SUBSTRACTS t $ p#+,u"t + t $ +u#t nu'5$# *n, t $ !$"+n, >:%. T $n6 +n$ SUBSTRAt $ !$"+n, nu'5$# +n t $ &#!t #+ &n t &! "*!$6 2% 'u(t&p(&$, 5- t $ "#+!!>p#+,u"t + t $ nu'5$#n+t &n t $ !*'$ #+ *n, "+(u'n *! t $ 26 *n, &n*((-6 +n$ ADDS t $ t &#, )*(u$ +n t $ &#!t #+ 'u(t&p(&$, 5- t $ "+##$!p+n,&n@ "#+!!>p#+,u"t

.nput

Ent$# t $ )*(u$! +# R+ 1 > 2 <Ent$# t $ )*(u$! +# R+ 2 :Ent$# t $ )*(u$! +# R+ 3 41

:utput

T $ ,$t$#'&n*nt + t $ '*t#& &!. 234

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 491/499

J&@ S" ++( " *(#+n@$ 1 P*@$!

Problem (

M*?$ * p#+@#*' t *t !p(&t! t $ &($ !p$"& &$, 5- t $ u!$# +n t $ "+''*n, (&n$ &nt+ !'*$#$ t $ !&8$ + t $!$ &($! &! *(!+ !p$"& &$, +n t $ "+''*n, (&n$. E *'p($

C b p#+5 p#+5 .&n 4

&(( 5#$*? t $ &($ "*(($, [p#+5 .&n\ &n !'*(($# &($! + 4 " *#*"t$#! $*" . T $!$ &($! &(( 5$ "[p<<1 6 $t"$t$#*6 t *t &!6 t $ &#!t ($tt$# + t $ &($ !p$"& &$, +((+ $, 5- t #$$ nu'5$#!6 &" <<< t+ & n$"$!!*#-%. I t $ &($ ,+$! n+t $ &!t6 *n $##+# '$!!*@$ ! +u(, 5$ @&)$n.

T $ p#+@#*' ! +u(, +#? +# *n- &($ t *t &! !p$"& &$, +n t $ "+''*n, (&n$6 5ut & t $ t$!t

[p#+5 .&n

E!t* $! un* p#u$5*

&! 5#+?$n In &($! : " *#*"t$#! (+n@ $*" 6 t $!$ +u(, 5$

p<<<

E!t* $

p<<1

! un*

p<<2

p#u$5*

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 492/499

p#+@#*'* p#+@1.*#" &)+ ,$ $nt#*,* p#+@1.&n*#" &)+ ,$ !*(&,* p#+@1.+ut

Problema XB: Re"!a de NWmero" +rande"

E!"#&5* un p#+@#*'* u$ #$!t$ ,+! n/'$#+! ,$ *!t* 32 "& #*! ,$ (*#@+.

A!u'*

1. L+! ,+! n/'$#+! !$ $n"u$nt#*n $n un* '&!'* (`n$* !$p*#*,+! p+# un $!p*"&+.2. A'5+! n/'$#+! !+n $nt$#+! p+!&t&)+! *un u$ (* ,& $#$n"&* n+ t&$n$ u$ !$# p+!&t&)*.

,*t* ,$ $0$'p(+

4<< 3211<<< 2<<1

!*(&,*

4<< > 321 X 1<<< = 2<<1 X >1<<1

$liminatoria CUTB V+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 493/499

p#+@#*'* p#+@2.

*#" &)+ ,$ $nt#*,* p#+@2.&n

*#" &)+ ,$ !*(&,* p#+@2.+ut

Problema X4: Camino del Caballo

En A0$,#$8 J$ *@+n*(6 $( p*!+

,$( "*5*((+ !$ ,$ &n$ "+'+

'u$!t#* $( ,&*@#*'*. L*! 12

$ u&! 'u$!t#*n (+! ,+"$

p+!&5($! p*!+! ,$ $!t$ ,$!,$ (*

"*!&((* @:.

P#+5($'* E!"#&5* un p#+@#*'*

u$ "*("u($ $( "*'&n+ u$ $(

"*5*((+ ,$5$ t+'*# ,$!,$ un

$ _@+n+ &n&"&*( * +t#+.

$liminatoria CUTB V+

g e

c(b(

c&

dF

"

e(

;

f2

f"

f&

f$

f(

;

1

g(

g)

h(

(

f' i

k

B

4

2

BB

8 F

B

Q

BB B

F 8

Q

2

4

B

a b

c d

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 494/499

A!u'*

1. L*! p+!&"&+n$! ,$(

t*5($#+ !$ $!"#&5$n nd ,+n,$

d $! (* ($t#* ,$ (* "+(u'n*6 -

nd $! $( nu'$#+ ,$ (`n$*.

2. C*,* (`n$* ,$( *#" &)+ ,$

f

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 495/499

$nt#*,* $!t* $n $( +#'*t+ >-- ,+n,$ $! (* p+!&"&7n ,$ *##*n u$ ,$( "*5*((+6 - (*&n*(. T+,*! (*! p+!&"&+n$! $n $!t$ *#" &)+ !$ $n"u$nt#*n $n $( t*5($#+.

D*t* ,$ $0$'p(+ 03>"

!*(&,*

Un camino desde %= hasta c es %=>%,>h+>7 >c

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 496/499

(:

% pies

plataformas!

trompa!

piedra!

entrada cueva! 9

p#+@#*'* p#+@3.*#" &)+ ,$ $nt#*,* p#+@3.&n*#" &)+ ,$ !*(&,* p#+@3.+ut

Problema #3 : 2l elefante Furioso

Un $($ *nt$ $!t* 'u- u#&+!+ p+# u$ un*! #*t*! *n"+n!t#u&,+ un* "u$)* $n $( +n,+ ,$ !u p+8+ ,$ *@u*#$!"*. P+# (+ u$ $!t* * ,$"&,&,+ '$t$# (* t#+'p* $n$( *@u* - t*p*# (* $nt#*,* ,$ (* "u$)* "+n un* ,$ (*! p&$,#*! u$ !$ $n"u$nt#*n $n $( _#$*.D$!* +#tun*,*'$nt$6 $( $($ *nt$ !$ $n"+nt#7 "+n ,+! p#+5($'*! p#&'$#+6"+'+ $( p+8+ $! 'u- p#+ un,+ n+*("*n8* (* $nt#*,*6 p+# (+ u$ t$n,#_ u$ !+(t*# (* p&$,#*6 - !$@un,+6 u$ n+ (* pu$,$ !+(t*# ,&#$"t*'$nt$6 p+# u$ (*! #*t*!6 "*n!*,*! ,$ t*nt+ 5u"$*#6 *n "+n!t#u&,+ *,$'_! un*! p(*t* +#'*! &n"(&n*,*! $n (*! u$ *"$n $!"*(* *( $nt#*# - !*(&# ,$( *@u*.

Cuando el ele7ante suelta la piedraJ esta acumula velocidadJ y rebota cuando choca con unade las plata7ormas4 /erdaderamenteJ cada veQ Gue la piedra caeJ esta acumula velocidad4Por otro ladoJ la piedra la pierde cuando sube o cuando se mueve para la iQGuierda o laderecha4 :bserve el siguiente e%emplo(

!a piedra cae ' J choca con la plata7ormaJ se desplaQa ' a la derechaJ y cuando pierde

toda la velocidadJ vuelve a caer4

!as piedras pueden chocar con las plata7ormas por encima o por deba%o4 $l e7ecto es

siempre el mismo( la piedra puede subir o moverse para los lados la misma cantidad

de pies Gue ba%a4

$liminatoria CUTB V+

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 497/499

Problema( #ado Gue el ele7ante puede hundir la trompa en cualGuier parte del poQo unos +piesJ determine de donde debe soltar la piedra para Gue esta tape la entrada del la cueva4

Asumir(

$l poQo mide pies de ancho y pies de pro7undidad4

$l ele7ante puede mover el ultimo pies de la trompaJ por lo Gue puedeJ dado Gue

no se encuentre ninguna plata7orma en el caminoJ hundir la trompa = pies y . para la

iQGuierda o la derecha4

$l archivo contiene un mapa del poQoJ donde los puntos 246 llenan los espacios de aguaJ

las plata7ormas se representan con X o < J dependiendo de la dirección de estaJ y la

entrada de la cueva se marca con una 54 !a entrada de la cueva siempre esta en el 7ondo4

0i la piedra pierde todo velocidadJ y se encuentra posada sobre el piso o una plata7ormaJ

no se mueve de ahí4

0i la piedra choca contra una de las paredesJ esta rebota en la dirección contraria4

0e garantiQa Gue el mapa tiene solución4

$l girar la trompa se debe especi7icar como a la iQGuierdaJ derechaJ o no es necesario4

data de e%emplo(

4 4 4 4 4 4 4 4

4 4 4 4 4 4 4 4

4 4 4 4 4 4 4 4

4 4 4 4 4 4 X 4

4 4 4 X 4 4 4 4

4 4 4 4 4 < 4 4

4 4 4 5 4 4 4 4salida(

distancia del borde(

pro7undidad( +

girar( no es necesario4

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 498/499

Fecha Nombre de la competenciaCategoría UniversidadAutor Tipo de competenciaProblema Algoritmos

N:TA 9$N$RA!( !A /A!.#AC.:N #$#AT:0 $0 R$EU$0.T: $N T:#:0 !:0

PR:B!$-A04

PROBLEMA #1

E!"#&5* un p#+@#*'* u$ #$*(&8$ un* !$#&$ ,$ "+n)$#!&+n$! ,$ G#*,+! F*#$n $G#*,+! C$("&u!. E( '&!'+ ,$5$ p$,&# ,$( u!u*#&+ $( p#&'$# )*(+# ,$ (* !$#&$6 - (* $!"$n (* u$ !$ ,$!$* u$ *u'$nt$ (* $!"*(*. A,$'_!6 $( u!u*#&+ t*'5& n $nt#*#_ $( n/'$#+,$ )$"$! u$ ,$!$* u$ !$ *@* (* "+n)$#!&7n. N+t* (* $"u*"&7n ,$ "+n)$#!&7n $! (* !&@u&$nt$ F*#$n $&t = 32%b1.

E0$'p(+ ,$ C+##&,*

Ent#$ $( p#&'$# )*(+# ,$ (* !$#&$ <Ent#$ (* $!"*(* $n u$ ,$!$* u$ *u'$nt$ (* !$#&$ 4Ent#$ $( n/'$#+ ,$ "+n)$#!&+n$! u$ ,$!$* #$*(&8*# 3G#*,+! F*#$n $&t G#*,+! C$("&u!

< 1<4 12.22

14.44

PROBLEMA #2

E!"#&5* un p#+@#*'* u$ ($$#_ ,$( u!u*#&+ un "*#*"t$#6 - (u$@+6 ,&#_ !& $( "*#M*-/!"u(* + M&n/!"u(*a - (+ &'p#&'&#_ $n p*nt*((*6 0u!t+ $n (* p+!&"&7n ,$( *( *5$t+($ "+##$!p+n,$. L+! $!p*"&+! *nt$!6 - ,$!pu ! ,$( "*#*"t$#6 ,$5$n $!t*# + up*,+! p+# > . N+t* S$ ut&(&8*#_ $( *( *5$t+ *'$#&"*n+.

E0$'p(+ ,$ "+##&,*

Ent#$ un "*#*"t$# ,

E( "*#*"t$# $! '&n/!"u(*.>>>,>>>>>>>>>>>>>>>>>>>>>>>

8/13/2019 Competencias Program Ac i on Inter Colegiales

http://slidepdf.com/reader/full/competencias-program-ac-i-on-inter-colegiales 499/499

PROBLEMA 3

E!"#&5* un p#+@#*'* u$ p&,* ,$( u!u*#&+ un n+'5#$ ,$ un $'p($*,+6 - un t+t*( ,$ +#*!t#*5*0*,*! - ,*,* $!t* &n +#'*"&7n *@* (+! "*("u(+! "+##$!p+n,&$nt$! $ &'p#&'* (*!&@u&$nt$ &n +#'*"&7n

a6 N+'5#$ ,$( $'p($*,+b6 E( !*(*#&+ 5#ut+ ,$( $'p($*,+c6 L* "*nt&,*, * ,$!"+nt*# p+# "+n"$pt+ ,$ &'pu$!t+!d6 L* "*nt&,*, * @*n*# p+# "+n"$pt+ ,$ +#*! $ t#*!e6 L* "*nt&,*, * ,$!"+nt*# p+# "+n"$pt+ ,$ p(*n ' ,&"+76 t+t*( ,$ ,$,u""&+n$!g6 S*(*#&+ n$t+

4ota: Pa&a por %ora, %asta 8 %oras: @6. C*,* +#* p+# $n"&'* ,$ 4< +#*! ^ . <I'p $!t+ $( !*(*#&+ 5# t+ S& $( !*(*#&+ 5# t+ $! '* +# $ ^3<<6 $(